ID: 1017206436

View in Genome Browser
Species Human (GRCh38)
Location 6:151808255-151808277
Sequence TGCAGGAAAGGCGACAGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017206436_1017206445 9 Left 1017206436 6:151808255-151808277 CCGCAGCTGTCGCCTTTCCTGCA 0: 1
1: 0
2: 0
3: 21
4: 233
Right 1017206445 6:151808287-151808309 CCAGCAGGTGCCCTACTACCTGG 0: 1
1: 0
2: 0
3: 6
4: 120
1017206436_1017206448 25 Left 1017206436 6:151808255-151808277 CCGCAGCTGTCGCCTTTCCTGCA 0: 1
1: 0
2: 0
3: 21
4: 233
Right 1017206448 6:151808303-151808325 TACCTGGAGAACGAGCCCAGCGG 0: 1
1: 0
2: 0
3: 11
4: 141
1017206436_1017206440 -6 Left 1017206436 6:151808255-151808277 CCGCAGCTGTCGCCTTTCCTGCA 0: 1
1: 0
2: 0
3: 21
4: 233
Right 1017206440 6:151808272-151808294 CCTGCAGCCCCACGGCCAGCAGG 0: 1
1: 0
2: 6
3: 38
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017206436 Original CRISPR TGCAGGAAAGGCGACAGCTG CGG (reversed) Exonic
900226664 1:1536286-1536308 TGGAGGAAAGGGCACAGCAGCGG - Intronic
900872435 1:5313548-5313570 TGCAGGAAAGTCACCTGCTGTGG + Intergenic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG + Intergenic
902581050 1:17407869-17407891 CCCAAGAGAGGCGACAGCTGTGG - Exonic
904055821 1:27669203-27669225 TGCAGGTAAGGGGACAGGTAAGG - Exonic
904407777 1:30304594-30304616 GGCTGGAAAGGAGACAGATGGGG + Intergenic
905321847 1:37123287-37123309 GTCAGGACAGGAGACAGCTGGGG - Intergenic
905484472 1:38285756-38285778 TCCAGAAAAGGCCAGAGCTGGGG + Intergenic
905812326 1:40921750-40921772 TGCAGGAGAGGAGAGAGGTGTGG - Intergenic
907395337 1:54185729-54185751 TGCTGTCAAGGCCACAGCTGGGG - Intronic
907464274 1:54624611-54624633 TAGAGGAAAGGGGACAGCAGAGG + Intronic
908151661 1:61309095-61309117 TGGAGGAAAGGAGGAAGCTGGGG - Intronic
908678785 1:66635469-66635491 TGCAGGAAAGGGCACAGATTTGG + Intronic
909803686 1:79847829-79847851 TGCAGGGACGGCTGCAGCTGGGG - Intergenic
910105583 1:83628160-83628182 TGCAGAAAAGGGGACAGCCCTGG - Intergenic
910878673 1:91902836-91902858 TTTAGGAAAGGAGACAGCTGTGG + Intronic
912414415 1:109498364-109498386 GGTCAGAAAGGCGACAGCTGGGG - Intronic
914950742 1:152111243-152111265 AGCAGGAAAGGCGCGAGCAGCGG - Exonic
914950774 1:152111519-152111541 AGCAGGAGAGGCGAGAGCAGCGG - Exonic
915529149 1:156493512-156493534 TTCAGGAAAGGTGCCAGGTGAGG + Intronic
915734931 1:158078614-158078636 GGGAGGAAAGGAGGCAGCTGAGG - Intronic
916805930 1:168261205-168261227 TGCAGGAAAGGGCATAGCAGAGG - Intergenic
917202360 1:172531582-172531604 TTCAGGATAGGAAACAGCTGAGG - Intergenic
917443935 1:175090961-175090983 TGTAGTAGAGGCTACAGCTGTGG + Intronic
917804255 1:178599026-178599048 TGCAGTGGAGGCGTCAGCTGGGG + Intergenic
921348813 1:214214484-214214506 TGCAGGAAAGGCTGGAGCTTCGG + Intergenic
922274581 1:224065597-224065619 TGCCAGAAAGGTGACAGGTGGGG - Intergenic
1063488962 10:6445958-6445980 GGAAGGACAGGAGACAGCTGTGG + Intronic
1063640254 10:7822548-7822570 TGCAGTAGAGGCGAGGGCTGTGG - Intronic
1064949308 10:20829753-20829775 TGCAGGAAATCTGACAGCTCAGG + Intronic
1065641019 10:27782940-27782962 TGCAGTAAAGGTGTCAGATGGGG + Intergenic
1066324926 10:34349174-34349196 TGAAGGAAGTGCGACAGTTGTGG - Intronic
1067711617 10:48655481-48655503 TGAGGGAAAGGCGAGGGCTGGGG - Intronic
1067807812 10:49405365-49405387 TACAGGAAAGGCTGCAGCAGTGG + Intergenic
1067853093 10:49768192-49768214 TGCAGGGGAGGCGGCAGCAGAGG - Intergenic
1070579144 10:77705545-77705567 TGCAGGCAAGTCAACTGCTGTGG - Intergenic
1073443869 10:103569565-103569587 TTCAGGGAAGGGGACAGTTGGGG - Intronic
1075846126 10:125546113-125546135 GGCAGGAGAGACAACAGCTGGGG + Intergenic
1078238408 11:9507373-9507395 TGCTGGAAGGGCTCCAGCTGTGG - Intronic
1078461126 11:11515976-11515998 TGCAGGATAAGTGACAGGTGAGG + Intronic
1079078266 11:17396867-17396889 TGCAGGACAGGCGTGAGCAGGGG - Intronic
1083366502 11:62144788-62144810 GGGAGGAAAGGCGGGAGCTGCGG + Intronic
1083574238 11:63777907-63777929 TGGAGGAAAGGTGACTGCTGTGG - Intergenic
1083996340 11:66274882-66274904 TGCAGGAGAGGTGCCAGCTGGGG - Intronic
1088692057 11:112336654-112336676 AGCAGAAAAGGCAACAGGTGGGG + Intergenic
1088701189 11:112413570-112413592 TGCAGTCAAGGGGCCAGCTGGGG - Intergenic
1089128483 11:116193809-116193831 TGCAGGCAGGGGGAAAGCTGCGG - Intergenic
1089365546 11:117918888-117918910 TGCAGCACAGCTGACAGCTGGGG - Intronic
1089702693 11:120255068-120255090 GGCAGGAAAGGAGACACATGGGG - Intronic
1090617789 11:128531974-128531996 GGCAGGAAAAGAGACAGCCGAGG - Intronic
1091668336 12:2435254-2435276 TGGAGAAAAGGCGATTGCTGGGG - Intronic
1093277572 12:17148730-17148752 TGGGGGAAAGTCGACAGTTGCGG - Intergenic
1093511911 12:19938724-19938746 TGCAGTAAAGACAACAGATGAGG + Intergenic
1096629207 12:52914859-52914881 TGCAGGAAGGGCGACCACTAAGG + Intronic
1101813713 12:108129635-108129657 TGCAGCAGCGGCGACAGCGGTGG - Intronic
1102052546 12:109873332-109873354 TGAAGGAAAAGCCAGAGCTGAGG + Intronic
1102745019 12:115242725-115242747 TGGAGGAAGGGGGACTGCTGTGG - Intergenic
1103482170 12:121257796-121257818 GGCAGGAAAGGCCAGAGCTGAGG - Intronic
1103778684 12:123384676-123384698 GGGAGGAAAGGCGCCTGCTGCGG - Intronic
1103816291 12:123659580-123659602 TGCTGGTAAGGAGACAGCAGCGG + Exonic
1104402077 12:128484604-128484626 TGCAGGAAGGCAAACAGCTGTGG + Intronic
1105068094 12:133217342-133217364 TGCAGGAAAGGCCTCAGCCCAGG + Intergenic
1108718889 13:53109628-53109650 AGTAGGAAAGGCAACAGCAGAGG + Intergenic
1113067807 13:106389749-106389771 TGGATGAAAGGAGACAGCTGAGG - Intergenic
1113949896 13:114066115-114066137 TGCAGGAGAGGCGGGAGCCGAGG - Intronic
1118427705 14:65685064-65685086 GGCAGGAAAGGAGACAGCAATGG - Intronic
1122795004 14:104201632-104201654 TGCAGGACAGGCCCCAACTGAGG + Intergenic
1122997134 14:105271406-105271428 TGGAGGCAAGGCGACGGCAGGGG + Intronic
1123122187 14:105921835-105921857 TGCAGGAGTGGCCAAAGCTGGGG - Intronic
1123404851 15:20013400-20013422 TGCAGGAGTGGCCAAAGCTGGGG - Intergenic
1123514182 15:21020048-21020070 TGCAGGAGTGGCCAAAGCTGGGG - Intergenic
1124680635 15:31727639-31727661 TGGAGGAAAGGCCAAAGCTGAGG - Intronic
1124784073 15:32662846-32662868 TGCAGGAGAGCGGAGAGCTGGGG + Intronic
1125652923 15:41332350-41332372 TGCAGCCAAGACGGCAGCTGCGG + Exonic
1130549594 15:84881463-84881485 AACAGGAAATGCTACAGCTGAGG + Intergenic
1131252342 15:90838795-90838817 TGCAACAAATGCGTCAGCTGGGG - Intergenic
1132936096 16:2482086-2482108 TGCAGGAAAGGTCACACCTAGGG + Intronic
1138430142 16:56963203-56963225 GGGAGGAAAGGCAGCAGCTGGGG + Intronic
1138935949 16:61723401-61723423 TACTGAAAAGGAGACAGCTGGGG - Intronic
1141729970 16:85815613-85815635 TGCATGATAGGGGACAGGTGAGG - Intergenic
1142383252 16:89746019-89746041 AGAAGGAAGGGCGACAGCTGTGG + Intronic
1146673926 17:34760027-34760049 TGGAGGAAAGGAGACCGCAGGGG + Intergenic
1148120507 17:45207258-45207280 ACCAGTAAAGGTGACAGCTGTGG + Intergenic
1148577324 17:48721046-48721068 GGCAGGGAAGGAGCCAGCTGTGG + Intergenic
1149290083 17:55209445-55209467 TGAAGGAAGGGCCAGAGCTGGGG + Intergenic
1150183860 17:63158821-63158843 TGCAATCAAGGTGACAGCTGAGG + Intronic
1150758427 17:67937538-67937560 TGAAGGAAATGAGAGAGCTGTGG + Intronic
1151818555 17:76484294-76484316 TGAAGGAGAGGAAACAGCTGGGG - Intronic
1151848264 17:76673300-76673322 TGCAGGAGAGGTGGCAGATGAGG - Exonic
1156339346 18:36197187-36197209 TGCAGGAAAGGCATCAGCAGTGG + Intronic
1156490047 18:37490841-37490863 GGCAGGAAAGGGGGCAGCTCAGG - Intronic
1157486569 18:48091663-48091685 TGCAGGTGAGGAGACAGCTTCGG + Intronic
1159426707 18:68298341-68298363 TACAGGATAGGGAACAGCTGTGG + Intergenic
1160015386 18:75136158-75136180 TGCAGGACAGGTGAGAGCCGGGG - Intergenic
1161252148 19:3285986-3286008 TGCAGGAGGGGCGGCGGCTGGGG - Exonic
1162794009 19:13077422-13077444 TGCAGGACAGGGAACAGCTGGGG + Intronic
1163095946 19:15057184-15057206 AGCAGGAAAGGTCAAAGCTGGGG - Exonic
1163807272 19:19406534-19406556 GGCAGGAAGGGCGCGAGCTGGGG - Intronic
1165349619 19:35268870-35268892 TGCAGGAGCGGCGGCGGCTGCGG + Intergenic
1165804047 19:38569587-38569609 AGCAGGCAGGGCGACAGGTGGGG + Intronic
1165810271 19:38607781-38607803 TGGAGGAAAGGCCACATCAGGGG + Intronic
1166309875 19:41956936-41956958 TGCAGGAAAGCCGGCAGCTCAGG + Intronic
1166539825 19:43597614-43597636 TGCAGCAAAGGGGAAAGCTAGGG + Intronic
1167212092 19:48139715-48139737 TGCAGGGAAGGGGAGGGCTGGGG - Intronic
1167322657 19:48806124-48806146 GGTAGGAAAGGGGACAGCCGGGG - Intronic
1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG + Intergenic
925396413 2:3536612-3536634 TGCAGAAAAGGAGAGAGATGGGG - Intronic
926245330 2:11118928-11118950 CCCAGGAAAGCCGACAGCTCTGG + Intergenic
927709279 2:25314941-25314963 TGCAGCTCAGGCCACAGCTGGGG + Intronic
928096625 2:28408943-28408965 TGTGGGTAAGGAGACAGCTGTGG - Intronic
931867169 2:66425903-66425925 CGGAGGAAAGGAGACAGCCGGGG - Intergenic
932617117 2:73239826-73239848 TGCAGGAAAGGAGGCTCCTGAGG + Intronic
934620080 2:95798392-95798414 TGCAGGTATGGAGCCAGCTGGGG + Intergenic
934640807 2:96026165-96026187 TGCAGGTATGGAGCCAGCTGGGG - Exonic
938239733 2:129734241-129734263 TTCAGGAAATGCGACGGCTGAGG + Intergenic
940586331 2:155656565-155656587 TACAGGAAAAGAGACAGATGTGG + Intergenic
946310170 2:218878933-218878955 TGCAGAAACGGGGACAGCTTGGG - Intergenic
946345659 2:219108281-219108303 TTCAGGAAAGGAGGCTGCTGTGG - Intronic
947393573 2:229665106-229665128 TGCAGGAAATATAACAGCTGAGG + Intronic
947795071 2:232889444-232889466 TGGTGGAATGGGGACAGCTGGGG - Intronic
948702149 2:239767154-239767176 TGCAGGAAAGCGGTCAGGTGTGG - Intronic
949037424 2:241822245-241822267 TGGAGGAGGGGCCACAGCTGAGG + Intergenic
1169040453 20:2490153-2490175 TGCAGGCAAGGAGAAAGATGGGG + Intronic
1169109335 20:3021973-3021995 GGGAGGGAAGGTGACAGCTGTGG - Intronic
1169825572 20:9765047-9765069 TGGAGCAAAGGAGACAGGTGAGG - Intronic
1172094582 20:32454434-32454456 TGGAGGACAGGAGACTGCTGGGG - Intronic
1173964239 20:47099598-47099620 TACAGGAATGGTGACAGTTGAGG + Intronic
1174708047 20:52676952-52676974 TGCAGGAAGAGGGACACCTGAGG - Intergenic
1175923794 20:62462318-62462340 TCCAGGCCAGGCCACAGCTGGGG - Intergenic
1176284863 21:5014059-5014081 TGCAGAAAAAGCAGCAGCTGTGG + Intergenic
1177644524 21:23884827-23884849 TTCTGGAGAAGCGACAGCTGGGG - Intergenic
1178446592 21:32649208-32649230 TGCTGGAGATTCGACAGCTGTGG - Intronic
1179872318 21:44249416-44249438 TGCAGAAAAAGCAGCAGCTGTGG - Intronic
1180673860 22:17573646-17573668 TGCAGGGAAGGAGAGAGATGGGG - Intronic
1181260528 22:21593973-21593995 GGCAGGAATGGAGACAGGTGTGG - Intronic
1181315850 22:21970538-21970560 TGCAGGAAAGGGGATAGAGGAGG - Intronic
1181849787 22:25741947-25741969 AGCAGGGAAGGGGACAGCTCTGG - Intergenic
1182081336 22:27531075-27531097 TGCAGCCAAGGTGTCAGCTGTGG - Intergenic
1184141885 22:42582335-42582357 TGCAGGAGAGGGGCCAGCTTAGG + Intergenic
949297219 3:2539344-2539366 TGCAGGAATGGGGAAAGATGAGG - Intronic
954400180 3:50315389-50315411 TGCAGGAGAGGTCACAGTTGCGG + Intergenic
954409506 3:50364336-50364358 TCCAGGAAGGGCGGCAGCAGAGG + Intronic
954449913 3:50566255-50566277 TCCAGGAAAGGAAAAAGCTGTGG - Intronic
956406363 3:68932448-68932470 TGCTGGAGAAGCGGCAGCTGAGG + Exonic
956463835 3:69499362-69499384 TGCATGAAAAACAACAGCTGAGG + Intronic
960518601 3:118629651-118629673 TTCAGGAATGGGGACAGTTGTGG + Intergenic
962693888 3:137928758-137928780 AGAAGGAAAGGTGAAAGCTGTGG - Intergenic
962973369 3:140425260-140425282 GGAAGGAAAGGCTCCAGCTGTGG - Intronic
964772273 3:160236831-160236853 TGAAGAAAAGGCAAAAGCTGTGG - Intronic
965818356 3:172659822-172659844 TGAAGGAAAGGGGAAAGATGGGG - Intronic
966161969 3:176978113-176978135 TGCAGGAAAGTTGAGAGTTGAGG - Intergenic
971206857 4:24579104-24579126 TCAAGCAATGGCGACAGCTGTGG + Intronic
973833360 4:54784372-54784394 TGCAGGGGAGGCGGCAGCTGCGG - Intergenic
973862112 4:55076214-55076236 AGCAGGAGAGGTGAGAGCTGTGG - Intergenic
975745666 4:77472153-77472175 TTCAGGAAAGGGGTCAGCTCAGG - Intergenic
977128271 4:93198762-93198784 AGCATGAAAGTCCACAGCTGTGG + Intronic
982739822 4:159045803-159045825 TGCAGGCAAGCCGTCAGTTGGGG + Intergenic
985615311 5:916605-916627 TGCAGGGGAGGTGACAGCTCTGG + Intronic
986012278 5:3726664-3726686 TGCAGGAATTGCTACAGCTCTGG - Intergenic
987301233 5:16599818-16599840 AGCAGGAAAGGAGACAACAGTGG + Intronic
987693379 5:21297253-21297275 TGCAGCACAGGAGTCAGCTGAGG - Intergenic
988665086 5:33317978-33318000 TATAGGAAAGGAGACAGATGAGG + Intergenic
988873767 5:35420492-35420514 AGCAGGAAAGGTAAGAGCTGTGG + Intergenic
989454212 5:41623262-41623284 TTCAGGCAATGTGACAGCTGTGG - Intergenic
990846613 5:60147669-60147691 TGCAGTCAAGCCGCCAGCTGAGG + Intronic
991335740 5:65545117-65545139 TCCAGGAAAGGAGAAAGGTGGGG + Intronic
991941999 5:71862331-71862353 TCCAGGGAAGCAGACAGCTGGGG - Intergenic
993313166 5:86363518-86363540 TAGAGAAAAGGGGACAGCTGGGG + Intergenic
994026211 5:95087529-95087551 TTCAAGAAAGGCTACAGCTCTGG + Intronic
994652463 5:102545872-102545894 AGCAGGAAAGGAGACAGCTAAGG + Intergenic
996019132 5:118572944-118572966 TGGAGGACAGGCGACAGCGACGG + Intergenic
997606568 5:135179285-135179307 TGCAGGAGAGGGGACATCTCTGG + Intronic
999451788 5:151684013-151684035 TGAAGGAAAGGAAAGAGCTGAGG - Intronic
1001139576 5:169133297-169133319 TGAAGGACATGCCACAGCTGTGG + Intronic
1001971218 5:175956500-175956522 TGCAGGACAGGGGACAGGTGGGG - Intronic
1002246224 5:177887277-177887299 TGCAGGACAGGGGACAGGTGGGG + Intergenic
1008008141 6:46434326-46434348 TGCAGTAATGGTGGCAGCTGAGG + Intronic
1008785142 6:55158782-55158804 TGAAAGAAAGGCAGCAGCTGCGG + Intronic
1009202358 6:60761443-60761465 TACAGGAAAGAAGACTGCTGAGG - Intergenic
1010168812 6:72950540-72950562 TGGAGGAAGTGAGACAGCTGAGG - Intronic
1010305405 6:74315950-74315972 TGCAGGGAAGGGGGCAGCAGTGG - Intergenic
1012887259 6:104859856-104859878 TGCAGGAAAGGCGCGAGCAGAGG - Exonic
1013895227 6:115080336-115080358 TACAGGAAAGGGGCCAGGTGTGG + Intergenic
1014102441 6:117526922-117526944 TGCAACAAAGGTGTCAGCTGGGG + Intronic
1016373716 6:143399358-143399380 AGAAGGAATGGCGACAGCAGAGG + Intergenic
1017206436 6:151808255-151808277 TGCAGGAAAGGCGACAGCTGCGG - Exonic
1017300223 6:152848731-152848753 AGAAGGAAGGGAGACAGCTGAGG + Intergenic
1017654770 6:156617123-156617145 TACAGGAAAGGCTACAGCAAAGG + Intergenic
1018420029 6:163633189-163633211 TGCAGCCAAGGTGTCAGCTGGGG + Intergenic
1019049708 6:169173663-169173685 TGGAGGGCAGGCGACAGCGGAGG - Intergenic
1019159252 6:170058212-170058234 AGCAGGGAAGGGGACAGCGGAGG - Intergenic
1019492265 7:1321100-1321122 TGCAGCAGACCCGACAGCTGGGG + Intergenic
1022094479 7:27130300-27130322 TGCAGGGGCGGCGGCAGCTGGGG + Exonic
1022521153 7:31007804-31007826 TGCAGGACAGGCTGCAGTTGGGG - Intergenic
1022964525 7:35460160-35460182 TGCAGAAAAGGAGAAAGCTCAGG + Intergenic
1023418125 7:39950753-39950775 TGCAGGAGCGGCAACAGCAGCGG - Exonic
1023745037 7:43315296-43315318 TGAAGGAAAGGCCACAGAAGGGG + Intronic
1024811597 7:53218943-53218965 AGCGGGAAGGGAGACAGCTGGGG - Intergenic
1025827729 7:65024268-65024290 TGGAGGAAAGGCCACAGGTGGGG - Intergenic
1025915264 7:65860722-65860744 TGGAGGAAAGGCCACAGGTGGGG - Intergenic
1028391447 7:90321453-90321475 GGCAGGAGAGGCGAGAGCAGCGG - Intergenic
1029727386 7:102416094-102416116 GGCAGGAAAGGCGACTTCTAGGG - Intronic
1029992364 7:104974012-104974034 TGAAGGAACAGCGACAACTGAGG - Intergenic
1030060703 7:105618677-105618699 TCCAGGAAGGACAACAGCTGAGG - Intronic
1031764026 7:125752574-125752596 TGCAGAAAAGGAGACTGCTTTGG - Intergenic
1031985785 7:128163965-128163987 TGCAGGAATGGCCACATTTGTGG - Intergenic
1032240865 7:130157766-130157788 GACCGGAAAGGAGACAGCTGAGG + Intergenic
1032660673 7:133980251-133980273 TGCAAGAAATCTGACAGCTGTGG - Intronic
1034858166 7:154573341-154573363 TGCAGAAAGGGCGGCAGGTGTGG - Intronic
1035074982 7:156171197-156171219 TCCAGGAGAGGCCACATCTGAGG - Intergenic
1035259053 7:157650148-157650170 AGCAGGGAAGGGGAAAGCTGGGG - Intronic
1036181429 8:6588656-6588678 TGCAGGACAGGGGAGAGCAGCGG - Intronic
1036612999 8:10366054-10366076 TGCAGGACTGGGGACACCTGGGG + Intronic
1036797634 8:11767857-11767879 TGCTGGAAAGGCAACATCTTGGG + Intergenic
1037380975 8:18284755-18284777 TGCGGGAAAGGTGGGAGCTGTGG - Intergenic
1037832182 8:22196319-22196341 TGCAGGAAAGGGAGCAGCTCGGG - Intronic
1038164630 8:25073519-25073541 AGAAGGAAAGGCGAAGGCTGAGG - Intergenic
1039424916 8:37477724-37477746 TGCAGGAGAGGCCAGTGCTGGGG - Intergenic
1039530861 8:38260660-38260682 TGCAGGAAATGACGCAGCTGAGG - Exonic
1045047256 8:98291330-98291352 TGCAGGAAAGGAAAAAGCTTAGG - Intronic
1049194039 8:141305912-141305934 TGCAGGGAAGGAGAGGGCTGCGG - Intronic
1049519042 8:143078995-143079017 TACTGGAAAGGCCACAGCAGGGG + Intergenic
1049789957 8:144467998-144468020 TGCAGGAACGGCTGCAGCTCGGG - Intronic
1050489531 9:6173263-6173285 AGCAGGAAAGACCAAAGCTGAGG - Intergenic
1052786159 9:32830556-32830578 GACAGGAAAGGTGAGAGCTGTGG + Intergenic
1053491175 9:38504637-38504659 TGAAGGAAAGGCATCAGTTGTGG - Intergenic
1056451327 9:86719808-86719830 TGCAGACAAGGTGTCAGCTGGGG + Intergenic
1057708945 9:97419538-97419560 AGCAGGAAAGAGGACAGCTTTGG - Intronic
1057900422 9:98943950-98943972 TGCAGGAAGGGCGAGCGCGGCGG + Exonic
1058509410 9:105700745-105700767 TCCTGGAAAGGTGACAGCAGTGG + Intronic
1059179771 9:112200744-112200766 TGCATGAAATGCCAGAGCTGGGG + Intergenic
1060598407 9:124861897-124861919 TGCAGCAATGGTGAGAGCTGCGG - Exonic
1061482762 9:130905216-130905238 TGCAGGTGAGGCTCCAGCTGTGG - Exonic
1061486579 9:130923465-130923487 TGCTGGAAGAGCCACAGCTGGGG + Intronic
1062158395 9:135066725-135066747 TGCAGGAAAGGAGACACATGTGG + Intergenic
1062229268 9:135472404-135472426 TGCATGCATGGAGACAGCTGTGG - Intergenic
1062475193 9:136723226-136723248 TGCAGGGCAGGCGGCAGCAGTGG - Exonic
1062711191 9:137976044-137976066 TGCAGGAAAGGATACAGCCTGGG - Intronic
1203793657 EBV:164692-164714 TGCAGGACAGCCGACATCGGGGG - Intergenic
1186334753 X:8574230-8574252 AGCAGGAAAGGAGCCAGCCGTGG - Intronic
1186868593 X:13747140-13747162 TGATGGAAAGGCGAGAACTGTGG + Intronic
1188829547 X:34879662-34879684 TCCATGAAATGCTACAGCTGTGG - Intergenic
1188867397 X:35329991-35330013 TGGAGTAAAGGTGACAGCTGTGG + Intergenic
1190711445 X:53073466-53073488 TGCAGGAAAGAGGAGAGCTCCGG - Intronic
1191611614 X:63121533-63121555 TGCAGGAAAGTGGACTGCTGAGG - Intergenic
1192220622 X:69195262-69195284 AGCAGGGAGGGCCACAGCTGGGG - Intergenic
1194170813 X:90578677-90578699 TGGTGGAAAGGCGAGGGCTGGGG - Intergenic
1194935135 X:99939327-99939349 CCCAAGAGAGGCGACAGCTGTGG - Intergenic
1195156379 X:102127202-102127224 TGCAGGAAAGCGCCCAGCTGAGG + Exonic
1195306386 X:103587011-103587033 TGCAGGAAAGCGCCCAGCTGAGG + Exonic
1195651907 X:107293594-107293616 TGCTGGAGAGGGGACATCTGGGG + Intergenic
1197253675 X:124240304-124240326 TGCAGGAAAGCCGAAAACTTCGG - Intronic
1199643097 X:149882042-149882064 TGTCAGAAAGGAGACAGCTGTGG + Intronic
1200517047 Y:4156415-4156437 TGGTGGAAAGGCGAGGGCTGGGG - Intergenic