ID: 1017207546

View in Genome Browser
Species Human (GRCh38)
Location 6:151819772-151819794
Sequence ATTTTTCCACAGATGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 1, 2: 11, 3: 70, 4: 449}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017207546_1017207554 22 Left 1017207546 6:151819772-151819794 CCCAGTTCCATCTGTGGAAAAAT 0: 1
1: 1
2: 11
3: 70
4: 449
Right 1017207554 6:151819817-151819839 GGAACTGGTGCCAAAAATGTTGG No data
1017207546_1017207550 1 Left 1017207546 6:151819772-151819794 CCCAGTTCCATCTGTGGAAAAAT 0: 1
1: 1
2: 11
3: 70
4: 449
Right 1017207550 6:151819796-151819818 GTCTTCCATGAAACCGGTCATGG No data
1017207546_1017207555 23 Left 1017207546 6:151819772-151819794 CCCAGTTCCATCTGTGGAAAAAT 0: 1
1: 1
2: 11
3: 70
4: 449
Right 1017207555 6:151819818-151819840 GAACTGGTGCCAAAAATGTTGGG No data
1017207546_1017207556 24 Left 1017207546 6:151819772-151819794 CCCAGTTCCATCTGTGGAAAAAT 0: 1
1: 1
2: 11
3: 70
4: 449
Right 1017207556 6:151819819-151819841 AACTGGTGCCAAAAATGTTGGGG No data
1017207546_1017207552 7 Left 1017207546 6:151819772-151819794 CCCAGTTCCATCTGTGGAAAAAT 0: 1
1: 1
2: 11
3: 70
4: 449
Right 1017207552 6:151819802-151819824 CATGAAACCGGTCATGGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 56
1017207546_1017207549 -5 Left 1017207546 6:151819772-151819794 CCCAGTTCCATCTGTGGAAAAAT 0: 1
1: 1
2: 11
3: 70
4: 449
Right 1017207549 6:151819790-151819812 AAAATTGTCTTCCATGAAACCGG 0: 366
1: 675
2: 884
3: 752
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017207546 Original CRISPR ATTTTTCCACAGATGGAACT GGG (reversed) Intronic
901516792 1:9753081-9753103 ATTTCTCCACAGATGGGGGTGGG + Intronic
902120495 1:14160891-14160913 TTATTTCCACTGATAGAACTGGG - Intergenic
902286728 1:15411998-15412020 ATTTTCCCCCAGAAGGACCTTGG - Intronic
903701935 1:25255558-25255580 ATTTTTCCACAGCTGGGGGTGGG + Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905723755 1:40230157-40230179 ATATTTCTAAAGAGGGAACTGGG - Intronic
905765427 1:40596234-40596256 ATTTTTCCACGGATGGCAGGAGG - Intergenic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
907188061 1:52626498-52626520 ATGATTCCACTGATGGATCTTGG + Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
908910928 1:69071812-69071834 ATTGTTCCCCTGCTGGAACTGGG - Intergenic
909993982 1:82256235-82256257 ATTTTTAAACAGATCGAAATTGG + Intergenic
910104885 1:83621341-83621363 ATTTGTCCACTGATGGAAACAGG - Intergenic
911084541 1:93965528-93965550 ATGTTTCCACAGATGACCCTGGG + Intergenic
911363049 1:96903096-96903118 AGTTTTCCACAGATGGACAGTGG + Intergenic
913270016 1:117084066-117084088 ATTTTTCCAATGATGGATCAGGG - Exonic
914424084 1:147558586-147558608 ATGTCTCCACAGATAGAACCAGG - Intronic
914578147 1:148995035-148995057 ATTTATCTACTGATGGACCTAGG + Intronic
915100095 1:153492990-153493012 CTTTTTCCACTGATGCAGCTTGG + Intergenic
915254751 1:154618679-154618701 GTTATTCAACAGATGGAGCTGGG + Intronic
915731088 1:158055044-158055066 ATTTTACCATGGATGAAACTGGG + Intronic
917113358 1:171575800-171575822 TTTTTTCAACAGAAGAAACTTGG - Intronic
918608410 1:186458002-186458024 CTTTTTCAACAAATGGGACTGGG + Intronic
918852910 1:189715385-189715407 AATCTCCCACAGAGGGAACTAGG + Intergenic
919347652 1:196406031-196406053 ATTTCTTCACAGATGGCCCTAGG + Intronic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922896607 1:229105656-229105678 ATTTTTCCCATGATGAAACTGGG + Intergenic
924400956 1:243681098-243681120 ATTCTTTCAGAGATGGAGCTGGG - Intronic
924408907 1:243782685-243782707 ATTATTTAACAAATGGAACTGGG + Intronic
924650884 1:245926220-245926242 AGTTTTCAACAGATGGAATCTGG + Intronic
1063374781 10:5547725-5547747 ACTTTTCCACAGCTAGCACTAGG + Intergenic
1063609484 10:7551219-7551241 ATTTTTCCATCGATGGACTTTGG + Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064310394 10:14207288-14207310 ATTTTTCCACGGATGGGGGTGGG + Intronic
1064465930 10:15581916-15581938 TTTTTTCAACAAATGGCACTAGG + Intronic
1064611581 10:17108501-17108523 ATTATTCAAGAAATGGAACTGGG + Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1065045227 10:21741639-21741661 ACTTTTCCACAGAAGTAACATGG - Intronic
1066207280 10:33202021-33202043 ATTTTTACCCAGAAGGGACTCGG - Intronic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1066493280 10:35915744-35915766 ATTTTTCAAAATATGGAAATGGG - Intergenic
1067009392 10:42695681-42695703 TTTTTTTCACGGATGGATCTAGG - Intergenic
1067116315 10:43437706-43437728 CTATTTCCTCAGAAGGAACTGGG - Intronic
1067314327 10:45147570-45147592 TTTTTTTCACAGATGGATCTAGG + Intergenic
1067415761 10:46101070-46101092 AATTTTCCACAAATGAAGCTGGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068387102 10:56344687-56344709 TCTTTTCAACAGATGGTACTAGG + Intergenic
1068505150 10:57891082-57891104 TTTTTTCCACAGATGGTGGTGGG - Intergenic
1068765543 10:60759225-60759247 ATTTTTCCATGGATGGAGGTGGG + Intergenic
1068861791 10:61855169-61855191 ATTTTTCCACAGACGTAGGTGGG - Intergenic
1068934681 10:62624087-62624109 ATTGTTACCCAGATGTAACTGGG - Intronic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069457772 10:68567363-68567385 ATTTTTAAACAGATTGAACCCGG + Intronic
1070056634 10:72941324-72941346 ACTTTTCCCCAGATGGACTTGGG - Exonic
1070063350 10:73008071-73008093 AATTGTCCACAGATGAAACATGG + Exonic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071127988 10:82357754-82357776 ATTTTCCAACACATGGAATTTGG + Intronic
1071357881 10:84816739-84816761 ATTTTTCCATAGATGGGGGTTGG + Intergenic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074663435 10:115690266-115690288 ATTTTTCTACAGATGGGGGTGGG + Intronic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1075965154 10:126604872-126604894 ATTTTTCCATTAATGGATCTTGG + Intronic
1076268297 10:129128590-129128612 ATTCTTCCACAAATATAACTTGG - Intergenic
1076314218 10:129529316-129529338 ACTTTTCCACAGATGGGAGTGGG + Intronic
1076433920 10:130426613-130426635 ACTGTTCCACAGATGCCACTAGG - Intergenic
1077400644 11:2355148-2355170 ATTTATACAGAGCTGGAACTGGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1079963686 11:26954333-26954355 AGTTTTGCACAGATGCAACGGGG + Intergenic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1080765391 11:35291739-35291761 ATTTTTCCCCAGAGTTAACTTGG - Intronic
1080814721 11:35743876-35743898 ATTTTTTGGCAGATGGAATTAGG - Intronic
1081395886 11:42585830-42585852 TTTTTTCCCCAGATAGTACTGGG - Intergenic
1082731226 11:56800413-56800435 ATCATTCAACAAATGGAACTGGG + Intergenic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1085175050 11:74478542-74478564 ATTTTTCAATAGATGAAAATAGG - Intergenic
1085924988 11:81007199-81007221 TTTGTTCCACAGATAAAACTAGG - Intergenic
1086009722 11:82085895-82085917 ATGTTTCCATAGACGGAAGTGGG - Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088109250 11:106243150-106243172 ATCTTTCCTTAGCTGGAACTAGG + Intergenic
1089079894 11:115766775-115766797 ATTTGTCCAAAGAGAGAACTGGG - Intergenic
1089410671 11:118239395-118239417 ATTTTTCCAGTGAAGGAAATGGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1089620498 11:119719503-119719525 ATTTTTCCATATATAAAACTGGG + Intronic
1089938770 11:122393969-122393991 TTTGTTCCACAGTTGGAAATAGG + Intergenic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091942280 12:4498714-4498736 ATTTTTCCACAGACTGGAGTTGG + Intronic
1091956178 12:4645420-4645442 ATTTTTCCACGGATGGGAGTGGG + Intronic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092745885 12:11672153-11672175 ATTTTGCGACAGAAGGAACAGGG - Intronic
1093220968 12:16420239-16420261 ATTTTGCTTCAGATGGAAGTGGG - Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093332970 12:17865843-17865865 ATTTTACCACAGATAAAAGTAGG - Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1093661967 12:21767580-21767602 ATTTTTCCACTGATGGGGGTGGG - Intronic
1093766840 12:22973513-22973535 ATTTTTCCACAGATGAGGGTGGG + Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1095314114 12:40738282-40738304 ACTATTCCACAAATGGCACTGGG + Intronic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1096482801 12:51953072-51953094 ATTGACCCACAGATGGATCTGGG + Intronic
1096879681 12:54657741-54657763 ATTTTTCCATACACGGAGCTGGG + Intergenic
1097066418 12:56323903-56323925 ATTTTCCCTCAGATAAAACTGGG - Exonic
1097760159 12:63455313-63455335 TTTTTTCCACAGAGGAAACTGGG + Intergenic
1097824636 12:64162431-64162453 ATTTTTCCACAGATGATAGTGGG - Intergenic
1097841204 12:64323220-64323242 ATTTAGACACAGCTGGAACTGGG - Intronic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1099222240 12:79929050-79929072 ATTTTTCCACAGATGTGGGTTGG + Intronic
1099520225 12:83650802-83650824 GTTTTTCCACAGATTCATCTAGG + Intergenic
1099923586 12:88989470-88989492 ACTTTTTCACAGAGAGAACTAGG + Intergenic
1100618301 12:96248597-96248619 CATTTTCCACACATGGAACCTGG - Intronic
1101375565 12:104168413-104168435 ATTCTTCCACAGATGGGAGCAGG - Intergenic
1101635530 12:106537607-106537629 ATTTTTCCATAGATGGGAGTAGG - Intronic
1101928632 12:108994036-108994058 ATTAGTCCACAGAAGGAAGTAGG - Intronic
1102448681 12:113024037-113024059 ATTGGTCAACAGAAGGAACTTGG + Intergenic
1102530918 12:113546138-113546160 ATGCTTCCACAGAGGGACCTGGG - Intergenic
1102747436 12:115261577-115261599 ATTTTTTCATACATGGAAGTGGG + Intergenic
1102925333 12:116821695-116821717 ATTTTTCCACATGTGGAAGGAGG + Intronic
1104603719 12:130171671-130171693 ACTTTTCCACACATGGCACAGGG + Intergenic
1104648909 12:130517027-130517049 AGTTTCCCACACATGGAATTTGG - Intronic
1105575054 13:21643032-21643054 ATAATTGCACAGCTGGAACTTGG + Intergenic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106817439 13:33424316-33424338 ATTTTTACAGAGGTGGAATTTGG + Intergenic
1107749540 13:43549958-43549980 ATTTTTCCACAGATGGCAGCAGG + Intronic
1108038472 13:46316695-46316717 ATTTGTCCAAAAAGGGAACTGGG + Intergenic
1108256998 13:48620502-48620524 CTTTTTCCATTGTTGGAACTTGG - Intergenic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1111772609 13:92617511-92617533 ATTTAGTTACAGATGGAACTAGG - Intronic
1111963633 13:94838264-94838286 CTTTTTCAACAAATGGTACTGGG + Intergenic
1112150789 13:96761053-96761075 AAGTTTCCAGAGACGGAACTAGG - Intronic
1112581392 13:100679183-100679205 ATTTTTCCATGGATGGAGTTGGG - Intergenic
1114275345 14:21138527-21138549 ATTGTTCCACTTCTGGAACTGGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1114704218 14:24709056-24709078 ATTTTTTCACAGTTGGCTCTTGG - Intergenic
1115622584 14:35154641-35154663 AGTTTCCCACAGATGGTATTTGG - Intronic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1117656462 14:57961228-57961250 ATTTTTCAAGAGATGGTATTTGG - Intronic
1117717248 14:58593965-58593987 ATTTTTCCACAGCTGGGGTTGGG - Intergenic
1117768032 14:59103135-59103157 ATTTTTCCACAGATGACAGTGGG - Intergenic
1118513827 14:66505869-66505891 ATTTTTCCATGGATGGAGATGGG - Intergenic
1118815076 14:69306266-69306288 AATTTCCTACAGTTGGAACTAGG + Intronic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119454434 14:74742514-74742536 GTTTTTCCACAGATGGCAGTGGG + Intergenic
1119676860 14:76562331-76562353 ATTTTTGCATAGCTGGAACTGGG + Intergenic
1120428435 14:84381361-84381383 ATTTTTCCACGGATGGGGATGGG + Intergenic
1120924338 14:89782784-89782806 ATTTTTCCACAGATGAGATGGGG + Intergenic
1121263521 14:92583791-92583813 ATTTTTCCACAGATGGGATGGGG + Intronic
1121698285 14:95930573-95930595 AGTTATCCAGAAATGGAACTGGG + Intergenic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1122645678 14:103192114-103192136 ATTCTTGCATAGATGCAACTGGG - Intergenic
1124477176 15:30045205-30045227 AGTTGTCCACAGATGCACCTGGG - Intergenic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125360973 15:38864588-38864610 CTTTTTCCTCAGATGGCCCTAGG + Intergenic
1125549574 15:40535480-40535502 GTTTTTCCACATATTGAAATTGG + Intronic
1126998111 15:54468680-54468702 TATTTTCAACAGATGGTACTGGG - Intronic
1128248389 15:66148530-66148552 ATTTGACCACAGAGGGACCTGGG - Intronic
1128662763 15:69514208-69514230 ATTTTTCCACGGACGGGAGTTGG - Intergenic
1129111208 15:73338366-73338388 ACTCTGCCACACATGGAACTTGG + Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1130129032 15:81121054-81121076 GTTTTTCTAAAGATTGAACTTGG - Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1131293721 15:91129399-91129421 AATTGTCCGGAGATGGAACTGGG + Intronic
1131794918 15:96006508-96006530 ATTTTCCCACAGAAGCAACAAGG + Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1133986820 16:10675190-10675212 ATTTATACACAGAAAGAACTTGG - Intronic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137689807 16:50415436-50415458 CGTTTTCAACAGATGGTACTGGG - Intergenic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1139276269 16:65730356-65730378 AGTTTTCAACACATGAAACTTGG + Intergenic
1139476200 16:67203660-67203682 ATCTGTCCACAGGTAGAACTGGG - Exonic
1141165526 16:81658193-81658215 ATTAATCCACAAATAGAACTTGG + Intronic
1142435079 16:90051506-90051528 ATTTTTCCACAGATGGGCTGAGG - Intergenic
1144612873 17:16739638-16739660 ATTTTTCAACAAATGGTTCTGGG - Intronic
1144899911 17:18575951-18575973 ATTTTTCAACAAATGGTTCTGGG + Intergenic
1145132531 17:20369715-20369737 ATTTTTCAACAAATGGTTCTGGG - Intergenic
1146261668 17:31426018-31426040 CTTTTGCCACAGATGGTCCTCGG - Intronic
1147489863 17:40855935-40855957 GTATTTACACAAATGGAACTTGG - Intergenic
1148173680 17:45546101-45546123 ATGTTTCAACAGAGGGCACTGGG - Intergenic
1148275589 17:46299347-46299369 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148297698 17:46516915-46516937 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148362247 17:47021403-47021425 ATGTTTCAACAGAGGGCACTGGG + Intronic
1149231865 17:54544379-54544401 ATTTTTCCCCTGCTGGAGCTGGG + Intergenic
1150052101 17:61974688-61974710 ATTTTTCCATAGATGATTCTGGG + Intronic
1150404888 17:64893025-64893047 ATGTTTCAACAGAGGGCACTGGG - Intronic
1152078349 17:78171846-78171868 AGTTGTCCACAGATGCACCTGGG - Exonic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1153912209 18:9714239-9714261 ATTTTTCCACAGATGGGAGCAGG + Intronic
1154045628 18:10902202-10902224 ATTTTTCCACGGATGGGGGTAGG - Intronic
1154236240 18:12608955-12608977 ATTTTTCCACAAATGGGGGTGGG + Intronic
1155008877 18:21755170-21755192 CCATTTCCTCAGATGGAACTAGG + Intronic
1155409732 18:25530461-25530483 ACTTTTTAATAGATGGAACTTGG - Intergenic
1156053026 18:32961586-32961608 ATTTTTCCACAGACAGAGCAGGG + Intronic
1156530191 18:37807647-37807669 ATTTTTCCACAAGTGGAATTGGG + Intergenic
1157375624 18:47161688-47161710 ATTTTTCCACAGATGGGTTGGGG + Intronic
1157986886 18:52448282-52448304 ATTTTTCCACAGAGGGGCCAGGG - Intronic
1158259773 18:55593666-55593688 ATTTTAACACAGGTGGGACTCGG - Intronic
1158568325 18:58574685-58574707 ATTTTTCCACAGCCGGAACGGGG - Intronic
1158940902 18:62405298-62405320 ATTTTTCCACAGATGGGCTGGGG + Intergenic
1159142585 18:64415448-64415470 ATTTGTCCATAGATGAAAGTTGG + Intergenic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1159468601 18:68819321-68819343 CTTTTTCAACAAAAGGAACTAGG - Intronic
1160157953 18:76447761-76447783 CTTTTTCCAAGGCTGGAACTGGG + Intronic
1160281391 18:77494047-77494069 ATTTTTCCACAGATGAGATTGGG - Intergenic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1162568249 19:11456050-11456072 ATGTTGCCTCAGATGGGACTGGG + Intronic
1164252537 19:23493858-23493880 AATTTTCCACAGATGTATTTTGG - Intergenic
1164319261 19:24126063-24126085 AATTTTCCACAGATGTATTTTGG + Intronic
1164699126 19:30269920-30269942 ATTTTTCCACAGTCGTTACTGGG + Intronic
1165703505 19:37957025-37957047 TTTTTTCAACAAATGGAGCTGGG - Intronic
1166091737 19:40513632-40513654 ATGTTTGCTCAGCTGGAACTAGG + Intronic
1166910448 19:46151330-46151352 ATTTTTCAACAAATGGTGCTGGG - Intronic
1167170949 19:47831558-47831580 ATTTTTCCATGGATGGGAGTGGG - Intronic
1167925900 19:52820985-52821007 ATTTTCCCAGAGCTGGAGCTGGG + Intronic
925591786 2:5517124-5517146 ATCTTTGCACAGCTGGACCTTGG - Intergenic
926176422 2:10596237-10596259 AGTTTTCCACAGATGGTGGTGGG + Intronic
926514544 2:13825423-13825445 ATTTTTGTACAGATGGATTTGGG - Intergenic
926541356 2:14183833-14183855 AAGTTTCCACAGATGGCACCAGG - Intergenic
927505112 2:23607823-23607845 ATTTTTCCATGGATGGGGCTGGG - Intronic
927629903 2:24763959-24763981 ATTATGCCACAGATGGCAGTAGG + Intronic
928252343 2:29692434-29692456 ATTTTTCCACGGATGGTTTTGGG + Intronic
928974934 2:37076490-37076512 ATGTTTCCACTGAAGGATCTAGG - Intronic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
929434809 2:41920481-41920503 ATCTTGCCACAGATGCAACAAGG + Intergenic
931022460 2:58063777-58063799 ATGATTCCTCAGATGGATCTGGG + Intronic
931704300 2:64934450-64934472 ATTTTTACACAGAAGAATCTAGG - Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933332533 2:80912561-80912583 ATTTTTCCACAGTCAGATCTTGG - Intergenic
933450330 2:82441364-82441386 ATTTTTCCATGGATGGGAGTGGG - Intergenic
933842776 2:86300887-86300909 ATTTTTCATCAGAGGGGACTTGG - Intronic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
935327612 2:101951399-101951421 ATTTTTCCACTGATGGACTTTGG - Intergenic
935333940 2:101997757-101997779 ATTCCTCCAGAGATGCAACTTGG + Intronic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
935384198 2:102484284-102484306 AATTTTCCACTCATGCAACTGGG + Intronic
935796819 2:106650282-106650304 ATGATTCCTCTGATGGAACTGGG - Intergenic
936771817 2:115922699-115922721 ATTTGTCCTGAGTTGGAACTAGG + Intergenic
936920332 2:117682125-117682147 GTGATTCCACAGATGGATCTGGG + Intergenic
936958058 2:118043211-118043233 ATTTTTCAACAAATGGTGCTGGG - Intergenic
936998732 2:118441960-118441982 AGGTTTCCAGAGATGGAACTGGG - Intergenic
938871922 2:135486975-135486997 ATGATTCCTCTGATGGAACTGGG - Intronic
939848495 2:147276580-147276602 TTTTTTCCACAGAAGGTAGTTGG + Intergenic
940259158 2:151762739-151762761 ATTTATCCTTAGATGGAAATAGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
941189468 2:162360793-162360815 ATTTCACTACAGATTGAACTAGG - Exonic
941935296 2:170976988-170977010 ATTTTTCCCCAGGTGGGTCTTGG + Intergenic
942096660 2:172541075-172541097 GTTTTTCCACAAATAGAACATGG + Intergenic
942549810 2:177103629-177103651 ATTTTTCCACAGACCGGGCTGGG + Intergenic
942810013 2:179987927-179987949 ATTTTTCCACAGATGTTAGGGGG + Intronic
943156609 2:184187508-184187530 ATTTTTCCACATATGGGAGTGGG + Intergenic
943389053 2:187239611-187239633 ATTTTTCCACAAATGAATCCTGG + Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
943812801 2:192210563-192210585 ATTTGGCCTCAGATGGAAATGGG + Intergenic
944068754 2:195646887-195646909 CTTTTTCCACAGATGGCAGGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944101814 2:196035888-196035910 ATTGTTCCAGAGATGGAACTTGG + Intronic
945635192 2:212340313-212340335 ATTTTTCCACAGACAGAATAGGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946649472 2:221875250-221875272 ATTTTTCCACGGATGGGGGTAGG - Intergenic
946727406 2:222674051-222674073 ATTTTACCAATGAAGGAACTAGG + Intronic
947660889 2:231866801-231866823 TTTTTTCAACAGATGGCTCTGGG + Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948851421 2:240709138-240709160 CCTTTTCAATAGATGGAACTAGG + Intergenic
1169561628 20:6807517-6807539 AGTTTTCAACAAATGGTACTGGG + Intergenic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1170037972 20:12010155-12010177 ATTTTTATACAGATGCACCTTGG - Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1172350658 20:34236938-34236960 TTTTTTCAACAAATGGTACTAGG - Intronic
1173050101 20:39550990-39551012 ACTTTTCCACTGATGGCACTGGG - Intergenic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1178041721 21:28647102-28647124 GTTTTTCCACCAAGGGAACTTGG + Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1180938513 22:19641716-19641738 ATTTTTCCACCGATGGGGTTGGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181289446 22:21780150-21780172 ATTATTCAGCAGATGGTACTGGG - Intronic
1181809623 22:25395475-25395497 ACTTTTCCCCAGAGAGAACTTGG - Intronic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1182510753 22:30818414-30818436 TTTTTGCAACAGATGGCACTGGG + Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185125465 22:49008313-49008335 ATATTTCCACGGACGGAAGTAGG + Intergenic
1185189455 22:49425206-49425228 ATTTTCCCACGGATGGAAGTGGG + Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949434410 3:4013048-4013070 ATTTTTCCCCATATGGAGGTGGG + Intronic
950828418 3:15850145-15850167 CTTTTTCAACAAATGGCACTGGG + Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
951649310 3:24932020-24932042 AGGTATCCAAAGATGGAACTTGG - Intergenic
952180036 3:30907514-30907536 ATTTTTCAAAAGAGGAAACTGGG - Intergenic
952588813 3:34926249-34926271 ATTTTTCTACAGTTTTAACTGGG - Intergenic
952723697 3:36560026-36560048 ATTTTTCCAGAGATTAAATTGGG + Intergenic
954055243 3:48017893-48017915 ATTTTTCCACAGATAGCAGGAGG + Intronic
954918110 3:54165586-54165608 TTTTTTTTAGAGATGGAACTGGG - Intronic
955157504 3:56431240-56431262 GTTTTTCCAAAAATGGAGCTAGG - Intronic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
956468956 3:69544907-69544929 ATTTTTCAGAAGATGGAATTTGG - Intergenic
956610109 3:71113859-71113881 ACCTTTCCAAAGATGGCACTAGG + Intronic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960946788 3:122972587-122972609 ATGATCCCACAGATGTAACTGGG + Intronic
961157845 3:124695950-124695972 TTTTTTCCATATAAGGAACTGGG + Intronic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962053450 3:131843645-131843667 ATTTTTAAAAAGCTGGAACTAGG - Intronic
962635220 3:137324326-137324348 AATTTTCCACTGATGGGATTTGG + Intergenic
962697982 3:137970019-137970041 ATTTTTCTCCACATAGAACTTGG + Intergenic
962856352 3:139349264-139349286 ATTTTTCCTCAGAAGGATTTTGG - Intronic
962857655 3:139363465-139363487 ATTTTTCCACAGATGGGAAGGGG - Intronic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
964057305 3:152477101-152477123 ATTATTCAACACATGTAACTTGG + Intergenic
964240115 3:154582719-154582741 TTTTTTCAACAAATGGTACTGGG + Intergenic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
964583115 3:158261995-158262017 ATTTTTCCATGGATGGGGCTGGG - Intronic
964814516 3:160702413-160702435 TTTTTTCCAGAGAGGGAAATAGG - Intergenic
964909484 3:161761334-161761356 AATTTTCCTCTGATGGAACCGGG + Intergenic
965147936 3:164930004-164930026 ATTTTTCTACAGATAGAACTTGG + Intergenic
965239422 3:166175961-166175983 ATATTTCCACAGGTGAAACAAGG + Intergenic
965675412 3:171190172-171190194 ATTCTCCCACTGATGGAAGTGGG + Intronic
966510857 3:180761499-180761521 ATTTTTCCACACAAGGGATTGGG - Intronic
966563713 3:181352226-181352248 GTTTTTCCACAGATGGGAGTAGG + Intergenic
969204104 4:5629533-5629555 ATATTTCCACAGATAGAAAAAGG - Intronic
970690395 4:18612965-18612987 ATTTTTCCACAGATGAGGGTTGG + Intergenic
972670444 4:41209937-41209959 ATTTTTCCACGGATGGGGTTGGG + Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973654233 4:53029212-53029234 ATTTTTCCAAAGATGAAGATTGG - Intronic
975725328 4:77285957-77285979 ATTTTTCCACAGAAGGGTCTGGG + Intronic
975798754 4:78036440-78036462 ATTTTTCCATGGATGGAGGTGGG + Intergenic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
976502466 4:85807550-85807572 ATTTTTCCACCCTGGGAACTAGG + Intronic
976822291 4:89220051-89220073 ATTTTTCCATGGATGGGAGTAGG - Intergenic
977235181 4:94499948-94499970 ATTTTTCCACAGGTGGGTCAGGG - Intronic
977880518 4:102199087-102199109 ATATTTCCACATATGGATTTTGG + Intergenic
977957946 4:103052141-103052163 ATTTTTCCACTGATGGCAGGGGG + Intronic
978479701 4:109175074-109175096 ACTTTTACACAGATGGGAGTGGG - Intronic
978543466 4:109843971-109843993 ATTTATCCAGAGATGTAAATTGG + Intronic
978940435 4:114429496-114429518 ATTTTTCCCCTGCTGGCACTGGG - Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980193136 4:129551306-129551328 ATTTTTCCGCGGATGGACCTGGG - Intergenic
980639782 4:135562590-135562612 TTTTTCCCAAAAATGGAACTTGG - Intergenic
980656561 4:135794436-135794458 ATTTTTCCACAGACTGGAGTGGG + Intergenic
981961946 4:150551933-150551955 ATTTTTCCACAGACCAAAGTGGG + Intronic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
982473498 4:155822468-155822490 ATTTTACCAGAGTTGGAAGTAGG - Intergenic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
984588671 4:181591787-181591809 ATTTTTCCACAGACAGGAGTAGG - Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985834385 5:2260059-2260081 ATTTTTGCTCAGATGAGACTTGG + Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986232319 5:5877643-5877665 ATTTTTCCACAGAAGAACCTGGG + Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
987012869 5:13784966-13784988 ATTTTTCCACGGATGGGACGGGG + Intronic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989684322 5:44067054-44067076 ATTTTTCCATAAATAGAGCTAGG - Intergenic
989700257 5:44255510-44255532 AGTTTTCCACACATGAAATTTGG - Intergenic
990431400 5:55738343-55738365 ATTTGTACACAAATGGTACTCGG - Intronic
990431478 5:55738801-55738823 TTTTTTCCAAAGAAGGAATTAGG - Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
990957879 5:61361967-61361989 ATGTTTTCACATATGGAAATAGG + Intronic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991107806 5:62862869-62862891 ATTTTTCCAAAGATGATACATGG - Intergenic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
992485650 5:77191722-77191744 ATATTTCCACAGATCGAAGGTGG + Intergenic
992495575 5:77290128-77290150 CATTTTCCACACGTGGAACTAGG - Intronic
992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG + Intergenic
992941533 5:81767145-81767167 ATTTTCCCAATCATGGAACTAGG + Intergenic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994112342 5:96020839-96020861 ATTTTTCCACAGATGGGTTGGGG - Intergenic
994569968 5:101503610-101503632 GGTTTTCAACATATGGAACTTGG + Intergenic
995340942 5:111058481-111058503 ATTTTTCCCCTGCTGGAGCTAGG - Intergenic
995399558 5:111725504-111725526 ATTTTTCAACATATGAAACTTGG - Intronic
996795212 5:127338630-127338652 ATTTTTCTCTAGTTGGAACTTGG - Intronic
997169457 5:131701226-131701248 ATTTTTTCACGGATGGGGCTGGG - Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998094291 5:139388574-139388596 ATTTTGCCACATCTGGAACAAGG + Exonic
998143702 5:139713594-139713616 ATCTTTCCAAAGAGGGAAGTGGG - Intergenic
999193734 5:149767811-149767833 GTTTTTCCACAGATGGGGTTGGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999945670 5:156592606-156592628 ATTATTCCACAGAAGGAAAGGGG - Intronic
1000392457 5:160739133-160739155 ATTTTACCATAAATGGAAGTTGG - Intronic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1001235665 5:170027281-170027303 AGGTTTCCACATCTGGAACTAGG + Intronic
1002142259 5:177149596-177149618 GTTTTTCCACAGGTGGGAGTGGG + Intronic
1003141718 6:3477472-3477494 ATTTTCCCATTGATGGAACGGGG + Intergenic
1003298886 6:4858813-4858835 CTTTTTCCAGAGGAGGAACTGGG - Intronic
1003344273 6:5252104-5252126 ATTTTACCACTCATGAAACTAGG + Intronic
1003642197 6:7885322-7885344 ATTTTTCAGCTGAGGGAACTGGG + Intronic
1003913955 6:10768040-10768062 ATTTTTCTACAGATGGTGATAGG - Intronic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004212884 6:13669954-13669976 TTTTTTCAACAAATGGTACTGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004911782 6:20292744-20292766 ATTTTTCCCCAGATGGGACGGGG + Intergenic
1005086819 6:22015397-22015419 ATTTTTCCACGGATGGCGGTGGG - Intergenic
1006512822 6:34530783-34530805 ATTTTTCCACGGATGGGAGCGGG + Intronic
1006725997 6:36199345-36199367 ATTTTTCCACAGATGAGGGTGGG - Intronic
1008483540 6:52010946-52010968 ATTTTTTCACAGTTGGAATTAGG - Intronic
1008683265 6:53896985-53897007 GTATTTCCACAGATGTAACTTGG + Intronic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1009650675 6:66474084-66474106 ATTTTCTCACAGATGGTCCTGGG - Intergenic
1013119471 6:107128747-107128769 ATTTTTGCAGTGATGGAATTCGG + Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1016077982 6:139820406-139820428 ATTTTACCAAAGAGGAAACTAGG - Intergenic
1016124351 6:140381981-140382003 ATTGTTCCATAGAAGGATCTGGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017318229 6:153057583-153057605 ATTTTTCCACGGATGGGTGTGGG + Intronic
1017324050 6:153126996-153127018 ATTTTTCCACGGATGGCAGTGGG + Intronic
1017739008 6:157388708-157388730 ATTTTTTAAAAGATGGAAATTGG - Intronic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1017897861 6:158696932-158696954 TTTTTTCAACAAATGGCACTGGG + Intronic
1018367673 6:163138095-163138117 AGTTTTCCAAATTTGGAACTTGG - Intronic
1018942935 6:168321541-168321563 TTTTTTCAACAAATGGTACTAGG - Intergenic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1020663373 7:11008595-11008617 ATTTTTCCATGGATGGGACAGGG - Intronic
1020829620 7:13078108-13078130 TTTTTTCCAGAGAAGTAACTAGG - Intergenic
1021373292 7:19877223-19877245 ATTTTTCCATAGGTGGTATTTGG + Intergenic
1021471190 7:21003640-21003662 CTTGTCCCACTGATGGAACTGGG + Intergenic
1022833223 7:34088860-34088882 ATTGTTCCACAGATGCATCAGGG - Intronic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1025104907 7:56162808-56162830 ATTTTTCCACGGATGGGGGTTGG - Intergenic
1025817365 7:64927465-64927487 AATTTTCCACAAATGTATCTTGG + Intronic
1026516784 7:71079632-71079654 ATTTATCCACTGATGACACTTGG - Intergenic
1026544869 7:71313161-71313183 ATTTTTCCACTTGTTGAACTAGG + Intronic
1027538601 7:79439007-79439029 ATTTTTCCAGAAAGGAAACTTGG - Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1028522976 7:91752722-91752744 ATTTTTCCCCTGCTGGGACTGGG + Intronic
1028703243 7:93808154-93808176 CCTTTTCAACAAATGGAACTGGG + Intronic
1030390048 7:108916574-108916596 TTTTTTCAACAAATGGTACTGGG - Intergenic
1030625046 7:111835764-111835786 ATTTTTCAACAGAAGCAGCTGGG + Intronic
1031223949 7:119010566-119010588 ATTTTTCCACAAATGAAGGTGGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1033853102 7:145521962-145521984 ATTTTTCCACAGATGGGTTGTGG - Intergenic
1034321553 7:150188111-150188133 ATTTTCCAATAGAAGGAACTAGG - Intergenic
1034771201 7:153779171-153779193 ATTTTCCAATAGAAGGAACTAGG + Intergenic
1035530722 8:349023-349045 ATGTCTCCACAGCTTGAACTAGG + Intergenic
1035594584 8:845891-845913 TCTTTTCCACAGATGGTACCAGG - Intergenic
1036196815 8:6724968-6724990 GTTTTTCTACAGATGGCACATGG + Intronic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1037376501 8:18235743-18235765 ATTTGTCCAAAGCTGGAAGTGGG + Intergenic
1037940761 8:22949156-22949178 ATTTTTCCATAGATGTGACTGGG + Intronic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038514898 8:28179494-28179516 ATTTTTCCACAGATAGTAAGGGG + Intronic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1040902658 8:52432682-52432704 TTTTTTCCACACATAGAAATAGG - Intronic
1041818378 8:62000577-62000599 CTTTTTCAACAAATGGTACTAGG - Intergenic
1043866829 8:85384163-85384185 ATTTTTCCACAGACCGACGTGGG - Intronic
1044374259 8:91450812-91450834 AAATTTCCACAGATGAAATTGGG + Intergenic
1044494987 8:92866825-92866847 ACTTTTCCACAGCTCTAACTGGG - Intergenic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045594625 8:103637992-103638014 ATTTTTCCCCTGATTCAACTGGG + Intronic
1045676558 8:104614348-104614370 AGTTTTCCACAGATTGGAGTGGG + Intronic
1045907717 8:107368061-107368083 ATGATTCCTCAGATGGATCTGGG - Intronic
1046373132 8:113337401-113337423 TTTGTTCAACAAATGGAACTGGG + Intronic
1047532433 8:125689163-125689185 ATTTTTCAACACATGGACTTTGG + Intergenic
1047973975 8:130111369-130111391 ATTTTTCCAGAGACAGTACTTGG - Intronic
1048228085 8:132609893-132609915 ATTTGTCCATAGAAAGAACTTGG - Intronic
1048468745 8:134688661-134688683 GTCTTTCCAGAGCTGGAACTGGG - Intronic
1048489812 8:134882298-134882320 ACTTTGCCAAAGAGGGAACTAGG + Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1048954636 8:139525772-139525794 ATCTCTCCAGAGATGAAACTTGG + Intergenic
1051009951 9:12399466-12399488 ATAATTCCACTGATGGATCTGGG + Intergenic
1051378608 9:16431727-16431749 ATTTTTCCACAGATGTGAGTAGG + Intronic
1052460142 9:28752525-28752547 AATTTTCCACAGAAGAAATTTGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1055501879 9:76909433-76909455 AATGTTCCAGAGATGGAGCTTGG - Intergenic
1055517086 9:77044196-77044218 ATTTTTTCAGAGATGGAACTGGG + Intergenic
1055623652 9:78150600-78150622 AGTTGTCCACAGATGCACCTGGG + Intergenic
1055642704 9:78332790-78332812 CTTCTTCCCCAAATGGAACTTGG + Intergenic
1056039911 9:82654129-82654151 ATTGTTGCATAGATGGAATTAGG - Intergenic
1056593754 9:87987752-87987774 AGTTTTCCACGGATGGAAGTAGG - Intergenic
1057515366 9:95715913-95715935 ATTTTCACAAAGAAGGAACTCGG + Intergenic
1057924901 9:99137086-99137108 GTTTTTCCACTAATGGAACTTGG - Intronic
1059163207 9:112054601-112054623 TTTTTTCAACAAATGGTACTAGG + Intronic
1059361844 9:113749658-113749680 ATTCTTCCACACATGGCAGTGGG - Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060317122 9:122522457-122522479 ATTTTGTCACAGATGGAAAGTGG + Intergenic
1060501043 9:124155651-124155673 TCTTGTCAACAGATGGAACTGGG - Intergenic
1060878708 9:127102592-127102614 AGTTTTCCAAAGATGACACTTGG - Intronic
1061400218 9:130364499-130364521 ATGTTTCCACCGAGGGAAATTGG - Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1186103927 X:6185757-6185779 ATTATTGCACAGATTGATCTTGG - Intronic
1187013874 X:15307368-15307390 ATTTTTCCACAGATGAGGGTGGG + Intronic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1188913136 X:35875315-35875337 ATTTTTCAACAAATGCAATTTGG - Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1192605941 X:72517651-72517673 TCTTTTCCACAAATGGTACTAGG - Intronic
1192958324 X:76097087-76097109 CTTTTTCTACAAATGGAACTGGG + Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193365180 X:80623256-80623278 ATTTTTCCCCTGCTGGAGCTGGG - Intergenic
1193504340 X:82322450-82322472 ACTTTTCAACAAATGGGACTAGG - Intergenic
1195623964 X:106988691-106988713 AATTTTCCACAGAGATAACTTGG + Intronic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1197030337 X:121805392-121805414 ATTTTTCCACAGTTCAATCTTGG + Intergenic
1197808840 X:130423155-130423177 ATTTTTCCACAAATGGGGGTGGG - Intergenic
1198134545 X:133735367-133735389 TCTTTTCAACAAATGGAACTTGG + Intronic
1198270898 X:135055377-135055399 ATTTTTCCATGGATGGGGCTGGG + Intergenic
1198438408 X:136638913-136638935 ATTTTTACAAAACTGGAACTGGG + Intergenic
1199293338 X:146129914-146129936 ACTTTTGTACATATGGAACTTGG + Intergenic
1199361448 X:146924167-146924189 ATTTATCAACAAATGGTACTAGG - Intergenic
1199916223 X:152344005-152344027 ATTTTTCAGTAGATAGAACTGGG - Intronic