ID: 1017208863

View in Genome Browser
Species Human (GRCh38)
Location 6:151833281-151833303
Sequence TACTCTGAAGTCTTTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017208858_1017208863 -4 Left 1017208858 6:151833262-151833284 CCTGTAGGCCAGTGGGTCTTACT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1017208863 6:151833281-151833303 TACTCTGAAGTCTTTTGGGTGGG 0: 1
1: 1
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017208863 Original CRISPR TACTCTGAAGTCTTTTGGGT GGG Intronic
901210138 1:7520022-7520044 TGTGCTGAAGACTTTTGGGTAGG - Intronic
902151801 1:14449228-14449250 TTCTCTGATGTCTTCTGGTTTGG + Intergenic
902958684 1:19945644-19945666 TACTCTGGAGACTCTTGGGTAGG + Intergenic
904958854 1:34314613-34314635 CTCTCTGAAGTCTTTTTTGTAGG - Intergenic
905574075 1:39029304-39029326 TACTCTTAAGTGTTTTTAGTGGG + Intronic
907529066 1:55074999-55075021 TACTCTTAAGTTGTTTGGGCAGG - Intronic
909320815 1:74283305-74283327 TACTCTGCAGGCTTTTGGTCTGG + Intronic
910491642 1:87779080-87779102 TACACTGAAGTGCTTTGGGGAGG + Intergenic
911538094 1:99124733-99124755 TATTCTGAAATTTTTTTGGTGGG + Intergenic
912504800 1:110149303-110149325 AACTCTGAAGTCCTATGGGTGGG - Intergenic
912768053 1:112434369-112434391 TACTTTGAAGTATTTAGGTTGGG - Intronic
915927205 1:160031853-160031875 TAGTCTGCAGTCGTTTCGGTTGG - Exonic
917222340 1:172745397-172745419 TACTGTGCAGGCTTTTGGGATGG - Intergenic
917653521 1:177102866-177102888 TTCTCTGAAGTCTTTTGGGTTGG - Intronic
921550184 1:216526220-216526242 GACTCTAACATCTTTTGGGTGGG - Intronic
922181166 1:223234048-223234070 GACTCTGCTGCCTTTTGGGTAGG - Intronic
923207152 1:231770396-231770418 TACTCTGAATTCTTGTGTTTGGG + Intronic
1065988834 10:30986600-30986622 TACCCTGAAATGTTTGGGGTCGG + Intronic
1070246749 10:74739371-74739393 TAGTCAGAAGTCTGGTGGGTGGG - Intergenic
1076304845 10:129458639-129458661 AACTCTGCAGTCTTTGGAGTTGG + Intergenic
1076877813 10:133225273-133225295 TACTCTGAAGTTTGTTGAGTTGG - Exonic
1076928314 10:133507280-133507302 TAGGATGCAGTCTTTTGGGTGGG - Intergenic
1077895987 11:6453900-6453922 TACTCTGGAGTCCTTAGGGCTGG - Intronic
1078073161 11:8132369-8132391 GACTCTGAAGGCTTTTGAGGAGG - Intronic
1078519001 11:12048496-12048518 TGCTCTGATCTCTTGTGGGTAGG + Intergenic
1082037378 11:47656364-47656386 AATTCTGAAGTCTCTTTGGTAGG - Intergenic
1082182521 11:49137267-49137289 TCCTCCGAACTCTATTGGGTGGG + Intergenic
1083408555 11:62475496-62475518 GACACTGAGGTCTATTGGGTTGG + Intronic
1083872054 11:65494606-65494628 TACTGGGAAGTTATTTGGGTTGG + Intergenic
1088810978 11:113392100-113392122 TGCTCTCAAGACTTCTGGGTAGG + Intronic
1089270395 11:117297927-117297949 TACTTTGACGTATTTTGAGTCGG - Intronic
1091340047 11:134804151-134804173 TACTCTGAAGACTTATGTTTGGG + Intergenic
1092391081 12:8079964-8079986 AAGACTGGAGTCTTTTGGGTTGG + Intergenic
1092633116 12:10406922-10406944 TACCCTGATGTCTTTTGGTTTGG - Intronic
1093006440 12:14056709-14056731 TACTGTGAAGACTTTTGTGCAGG - Intergenic
1093418100 12:18943992-18944014 TACTCAGAAATTTTTTGGGGGGG - Intergenic
1097289639 12:57903790-57903812 TGCTCAGCAGTCTCTTGGGTTGG - Intergenic
1098744652 12:74220355-74220377 TACCCTGAAGTCTAGTGGCTAGG + Intergenic
1098890532 12:76005968-76005990 TTCTCTGAACTCTATTAGGTGGG + Intergenic
1107134226 13:36926439-36926461 TACTCTGAAGCCTTTGTGGGAGG + Intergenic
1107290617 13:38849040-38849062 TACAATGAGGTCTTTAGGGTAGG - Intronic
1107707726 13:43123679-43123701 TACTCTGGGGTCTTCTTGGTGGG + Intergenic
1110143676 13:72163503-72163525 TACCCTGAAGACTTTTGGTTTGG + Intergenic
1111255609 13:85663462-85663484 TACTCAGCAGTCTTTTTTGTAGG + Intergenic
1114017402 14:18443592-18443614 TGCTCTGTAATCTTTTGTGTGGG + Intergenic
1114023767 14:18505442-18505464 TATTCTGAAATCCTTTGGGAGGG - Intergenic
1114721557 14:24888339-24888361 TTCTCTGATGTATATTGGGTGGG - Intronic
1116482144 14:45404122-45404144 TACTCTGACTTTTTTTGGATGGG + Intergenic
1116661984 14:47721995-47722017 TAAAATGAAGTCTTTAGGGTGGG + Intergenic
1120140839 14:80927660-80927682 TGCACTGAGGTCTTTTTGGTGGG - Intronic
1122048633 14:99040629-99040651 TCATCTGAAGTGTTTTGGGAAGG - Intergenic
1127554545 15:60074644-60074666 TACTTTGAACTCATTTGAGTGGG - Intergenic
1128421278 15:67493552-67493574 TATTCTGGAGTCTTTTGTCTAGG - Intronic
1129962838 15:79703833-79703855 TACTCTGTATTCTTTTGAGGGGG - Intergenic
1130202074 15:81841411-81841433 TAATCTGAATACTTCTGGGTGGG - Intergenic
1144284662 17:13762222-13762244 AATTGTGAAGTCTTTTGGGAAGG - Intergenic
1145113526 17:20186912-20186934 GGTCCTGAAGTCTTTTGGGTTGG + Intronic
1145227977 17:21147011-21147033 TACTATGAAGACATTTGGATAGG + Intronic
1145776072 17:27529913-27529935 GAATCTGAGGTCTTTAGGGTAGG + Intronic
1147845438 17:43401144-43401166 ATCTCTGTAGTTTTTTGGGTGGG + Intergenic
1151159983 17:72157179-72157201 TAAAATGAAGTCTTATGGGTAGG + Intergenic
1153827870 18:8893432-8893454 TAAAGTGAAGTCATTTGGGTGGG - Intergenic
1157678635 18:49586608-49586630 AATTCTGAAGGCTTTTGAGTCGG + Intronic
1157817266 18:50738694-50738716 AAGTCTGAAGTCTTCGGGGTGGG - Intergenic
1162436498 19:10663133-10663155 TCCTCTGAGGCATTTTGGGTGGG + Intronic
1164219982 19:23184634-23184656 TAGTCTGAGGTCTCCTGGGTTGG + Intergenic
1165867147 19:38945864-38945886 GATTCTGGAGGCTTTTGGGTAGG + Intronic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925920595 2:8635084-8635106 TAAGATGAAGTCTTATGGGTGGG - Intergenic
926023676 2:9519650-9519672 TACACTGAGGTCATATGGGTGGG + Intronic
926211903 2:10877645-10877667 TACTCAGAAGTCAGGTGGGTTGG - Intergenic
928898174 2:36288732-36288754 AACTTTGAAGTCTAATGGGTTGG + Intergenic
929979083 2:46662306-46662328 TACTCTGAGTTGATTTGGGTTGG - Intergenic
935325090 2:101928612-101928634 TCCTCTGAAGTCTTTGTGGAGGG + Intergenic
937636746 2:124164765-124164787 GACACTGGAGGCTTTTGGGTAGG + Intronic
939761156 2:146181688-146181710 TACTCTGTAGTTTTTAAGGTTGG + Intergenic
940935259 2:159486660-159486682 TCCTTTGAAGACTTTTGAGTAGG - Intronic
941914512 2:170801744-170801766 CCCTCTGAAGTCTATTGAGTAGG - Intergenic
943929258 2:193828888-193828910 GACTCTGATGTCTTTTGATTTGG + Intergenic
945877769 2:215296227-215296249 TACTCTGAAGTCTGATGCTTGGG - Intergenic
946491103 2:220150021-220150043 TACTTTGAAGACCTCTGGGTTGG + Intergenic
946553764 2:220832071-220832093 TTCTCTGAATTGTTTTGGTTGGG - Intergenic
1172168879 20:32916909-32916931 CTCTGTGAAGTCTTTAGGGTAGG + Intronic
1173445850 20:43117481-43117503 TACTCAAAAGACTTTTGAGTAGG + Intronic
1177462754 21:21434382-21434404 TACTCAAAAGTCTTGTGGCTAGG + Intronic
1177581443 21:23027836-23027858 TACTCTGAAGTCTTTATTTTGGG + Intergenic
1180447937 22:15432973-15432995 TATTCTGAAATCCTTTGGGAGGG - Intergenic
1182142515 22:27973279-27973301 TACTCGGGAGGCTTTTAGGTGGG - Intergenic
1183575875 22:38688736-38688758 TACTTTTAAGTCCTTTTGGTAGG - Intronic
1184899273 22:47434217-47434239 TTCTCTGAAGTCTCTCGGGAAGG - Intergenic
951934583 3:28007736-28007758 TGCTATGAAGTCTCTTGGGCTGG + Intergenic
952954278 3:38547283-38547305 TGCCTTGAATTCTTTTGGGTAGG - Intergenic
954890303 3:53921357-53921379 TAATGTGAAGTCATTAGGGTGGG + Intergenic
956465375 3:69515419-69515441 TATTTTGAAGTCTTTTGCATGGG + Intronic
956586166 3:70867190-70867212 TACTCTGAGCTATTTTGGGAAGG - Intergenic
959461863 3:106636862-106636884 TAATATGAAGTCATATGGGTGGG - Intergenic
961891872 3:130137272-130137294 TATCCTGAAGTATTTTAGGTAGG + Intergenic
962643364 3:137411653-137411675 TACTATGAGGTCGTTAGGGTGGG - Intergenic
963285484 3:143430807-143430829 CAAGCTGAAGTCTGTTGGGTAGG + Intronic
963553565 3:146756885-146756907 TACTCTGAAGTCGTTTGCTGTGG + Intergenic
965554291 3:170003697-170003719 TATTATGGAGTCTTTTGTGTTGG + Intergenic
967706153 3:192653168-192653190 TTCTCTGCAGTCTTTGGGTTTGG + Intronic
967969383 3:194987893-194987915 TCCTCTGAGGTTTTTTGCGTGGG + Intergenic
971888652 4:32487185-32487207 AACTCTGTAGTCTTTTTTGTTGG + Intergenic
973719370 4:53707716-53707738 TACGCTGAGGTCATTAGGGTGGG - Intronic
974683934 4:65199746-65199768 AACTGTGAAGTCTTTTGGGAAGG - Intergenic
975651823 4:76600982-76601004 TACTCTAAAATCTATTAGGTTGG + Intronic
975817297 4:78231802-78231824 TACTTTGAAGTATTTGGGGATGG + Intronic
976128270 4:81856395-81856417 CACTCTGAAGTCTTTGGGGGAGG - Intronic
976678784 4:87732456-87732478 TAAGATGAAGTCATTTGGGTGGG + Intergenic
977694658 4:99951826-99951848 TACTCTGAAGTACTTTAGATTGG + Intergenic
978360722 4:107928964-107928986 TACTAAGAGATCTTTTGGGTGGG - Intergenic
979011030 4:115368717-115368739 TACTCTAACTTCATTTGGGTGGG + Intergenic
979011186 4:115371490-115371512 TACTCTAACTTCATTTGGGTGGG + Intergenic
981369211 4:143939603-143939625 TATTTTTAAGACTTTTGGGTAGG - Intergenic
983553366 4:169038279-169038301 TCCTCTGAATTTTTTTGGGGGGG + Intergenic
984951288 4:185009590-185009612 TCCTCTGAGGTCTTTAGGGGAGG - Intergenic
985026852 4:185746953-185746975 TAAACTGAAGTCATTAGGGTGGG + Intronic
985350020 4:189050075-189050097 TATTCTAAAGTCTTGTGGGTAGG - Intergenic
986923855 5:12721513-12721535 TATTCCATAGTCTTTTGGGTGGG + Intergenic
987270962 5:16308528-16308550 TTCTCTAAAGTCTTTTAGATAGG + Intergenic
988366475 5:30307004-30307026 TATTCTGATGTCTTGTGTGTTGG + Intergenic
989323971 5:40168345-40168367 TATTCTGTAGTTTTTTGGGTGGG - Intergenic
991362073 5:65831297-65831319 TTTTCTGAAGTCATTTGGGAAGG + Intronic
991425423 5:66487314-66487336 TTCTCTTAAGTCATTTTGGTGGG - Intergenic
992339416 5:75807308-75807330 TACTCTGAATTTTTTTTTGTCGG + Intergenic
992519282 5:77533541-77533563 TACTCTAAAGTATTTGGGATAGG - Intronic
992947084 5:81821719-81821741 TACGCTGCATTCTTTTGAGTAGG - Intergenic
993783500 5:92099096-92099118 TACTCTGAAGGCATTAGGGAGGG + Intergenic
995681530 5:114726181-114726203 TAGACTGATGTCCTTTGGGTTGG - Intergenic
997853051 5:137349843-137349865 TACTCTGAGGTCATTAGGGTGGG - Intronic
1000811200 5:165864082-165864104 CTCTTTGAAGTCTTTTTGGTGGG + Intergenic
1003550331 6:7097620-7097642 TAAAATGAAGTCTTTAGGGTGGG - Intergenic
1007225058 6:40308055-40308077 TTCTCTGAAGACTCTTAGGTAGG - Intergenic
1010404882 6:75493527-75493549 TCCTCTGTATTCTTTTGGGCTGG - Exonic
1010786565 6:80009044-80009066 TAGTCTGGATTTTTTTGGGTAGG + Intronic
1010931989 6:81814820-81814842 GACTCTGAATTCTTAAGGGTGGG + Intergenic
1011732216 6:90276454-90276476 GACACTGAAGTCTTTTGTGTTGG + Intronic
1012627332 6:101420212-101420234 TACTCTGAAATTTACTGGGTGGG - Intronic
1012779584 6:103540583-103540605 TAAAATGAAGTCTTATGGGTGGG + Intergenic
1013240640 6:108242358-108242380 TACTGTGATGTTTATTGGGTGGG - Intronic
1015597304 6:134877945-134877967 TAAAATGAAGTCTTTAGGGTAGG - Intergenic
1016052590 6:139545386-139545408 TACTGTGCAGTCTTTTGGAAGGG + Intergenic
1016816299 6:148306249-148306271 TTCTCTGGCTTCTTTTGGGTTGG - Intronic
1017208863 6:151833281-151833303 TACTCTGAAGTCTTTTGGGTGGG + Intronic
1018363205 6:163093656-163093678 GAGTCTGAAATCTTTTAGGTAGG - Intronic
1022625845 7:32035117-32035139 TAGGCTGATGTCCTTTGGGTTGG - Intronic
1022951026 7:35337992-35338014 CACTCTGAAGGCTCTAGGGTAGG - Intergenic
1023327278 7:39074020-39074042 TACTCAGAAGTCTTTTGAGAAGG - Intronic
1023452185 7:40298598-40298620 TACACTGCAGTCATTTGTGTAGG + Intronic
1023490843 7:40739344-40739366 TACTATGTAATCTTTTGGATTGG + Intronic
1024127758 7:46318170-46318192 TACTCAGAAGTCATTTGGAAAGG - Intergenic
1024217272 7:47257947-47257969 TAGTTTGTAGTCTTTTGAGTTGG + Intergenic
1024933054 7:54684811-54684833 TATTCTGATGTCTTTTCGTTTGG - Intergenic
1026871919 7:73857909-73857931 TTCACTCAAGTCTTCTGGGTTGG + Intergenic
1032276545 7:130461296-130461318 TTCTTTGGATTCTTTTGGGTAGG + Intergenic
1034085509 7:148318600-148318622 TAATTTGAATGCTTTTGGGTAGG - Intronic
1034839212 7:154380280-154380302 CACGCTGAAGTATTTTGGGGTGG + Intronic
1035520546 8:272674-272696 TACTCTGAGGCCTTTTGTGGAGG + Intergenic
1035933885 8:3815703-3815725 TACTCTGAATTCTTTGGACTTGG + Intronic
1036219189 8:6906941-6906963 TTCCCAGAAGTCTTTTTGGTAGG - Intergenic
1040914032 8:52550652-52550674 TTCTCTGAAGTCTTGAGGGAAGG + Intronic
1042481553 8:69309178-69309200 GACTCTGAACTCTTGTGGATTGG - Intergenic
1042577032 8:70232159-70232181 TACACTGAAGACTGTTGGGGAGG - Intronic
1042722442 8:71841122-71841144 TACACTGGAGACTTGTGGGTGGG + Intronic
1042724123 8:71853711-71853733 TACTTTTAACTCTTTGGGGTAGG + Intronic
1044070560 8:87755188-87755210 AATTCTGAAGTCTTTTTGTTGGG + Intergenic
1046573287 8:115993557-115993579 AAATCTGAAGTCTTTTTGTTTGG + Intergenic
1046716782 8:117576727-117576749 TACTCAGAAGTGTTTCGGGATGG + Intergenic
1047844381 8:128790063-128790085 TACTCTGAAGCCTTCTGATTAGG + Intergenic
1048984227 8:139724760-139724782 TACTTTAAAGACTTTTGGCTGGG + Intergenic
1052951522 9:34217067-34217089 TACTCTCTACTCTTTTGGGAAGG + Intronic
1053096091 9:35329290-35329312 TAAACTGAAGTCATATGGGTGGG + Intronic
1053314567 9:37040817-37040839 TCCTCTGAGGTCTTCTGTGTAGG + Intergenic
1054782106 9:69174643-69174665 TACTCTGAAGTCACTTGGGCTGG + Intronic
1057385672 9:94604064-94604086 TTCTCCGAAGGCTTTTGGGTTGG + Intronic
1058278441 9:103078292-103078314 TACTCTGAAAACTATTAGGTTGG - Intergenic
1058580625 9:106452579-106452601 CACTCTGAAGCCTTTTTGCTAGG + Intergenic
1058665487 9:107310772-107310794 TACTCCAAAGTGTTGTGGGTAGG - Intronic
1060366662 9:123022906-123022928 TACTCTGAAATGTTTTTGGGGGG + Intronic
1062087835 9:134657803-134657825 GACTCTGATGTCTTCTGGGGAGG + Intronic
1185818817 X:3182343-3182365 TAAAATGAAGTCATTTGGGTGGG + Intergenic
1186441647 X:9591974-9591996 TAATCTAAACTCTTTTGAGTTGG + Intronic
1186623007 X:11261280-11261302 TCCTATGAAGTCTGATGGGTGGG - Intronic
1187999191 X:24963155-24963177 TATTATGAAGTGTTTTAGGTGGG + Intronic
1188451802 X:30315080-30315102 CACTCTGACGTCTATTAGGTTGG + Intergenic
1191045996 X:56137588-56137610 CACTCTGAGGACTGTTGGGTGGG + Intergenic
1191958650 X:66674656-66674678 TACTGTAAAGTATTTTGGTTTGG - Intergenic
1192907689 X:75568698-75568720 TACTTTGAAGTCTGCTGTGTCGG + Intergenic
1194432625 X:93828956-93828978 TACTCTGAGGTTTTGGGGGTTGG - Intergenic
1196468332 X:115995131-115995153 TTCTGTGAAGTATTTTGTGTGGG - Intergenic
1198326126 X:135575175-135575197 AAGTATGCAGTCTTTTGGGTTGG - Exonic
1200388947 X:155923260-155923282 TGCTCTTAATTCTTTTGTGTAGG + Intronic
1201064300 Y:10077902-10077924 TACTCTGAATTCTTCTGTCTAGG - Intergenic
1201261517 Y:12163220-12163242 TAAAATGAAGTCATTTGGGTGGG - Intergenic