ID: 1017216865

View in Genome Browser
Species Human (GRCh38)
Location 6:151918296-151918318
Sequence CACTTGCATGAGATTTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017216865_1017216866 -8 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216866 6:151918311-151918333 TGCAAGTGTAGCAATGAGAGAGG 0: 1
1: 0
2: 1
3: 14
4: 204
1017216865_1017216872 25 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216872 6:151918344-151918366 GTTCTAATTTAGGAGGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 226
1017216865_1017216868 15 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216868 6:151918334-151918356 GTATGATTGAGTTCTAATTTAGG No data
1017216865_1017216871 24 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216871 6:151918343-151918365 AGTTCTAATTTAGGAGGAAAGGG No data
1017216865_1017216867 -7 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216867 6:151918312-151918334 GCAAGTGTAGCAATGAGAGAGGG 0: 1
1: 0
2: 1
3: 16
4: 219
1017216865_1017216870 23 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216870 6:151918342-151918364 GAGTTCTAATTTAGGAGGAAAGG No data
1017216865_1017216869 18 Left 1017216865 6:151918296-151918318 CCTGGTTAAATCTCATGCAAGTG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1017216869 6:151918337-151918359 TGATTGAGTTCTAATTTAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017216865 Original CRISPR CACTTGCATGAGATTTAACC AGG (reversed) Intronic
904994442 1:34620390-34620412 ATCTTGCATGAAATTTAACTAGG - Intergenic
910739216 1:90496552-90496574 CACATGCATGAGACTTGCCCAGG - Intergenic
911476587 1:98380887-98380909 CATTTGCCTGTGGTTTAACCTGG + Intergenic
911586457 1:99696664-99696686 CACTTGCATGAGAGTCACACAGG + Intergenic
912613222 1:111070006-111070028 CATATGCAGGAGATTGAACCTGG - Intergenic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
915641213 1:157228313-157228335 AACTTTCATGAGATTTATCTTGG + Intergenic
915668268 1:157464628-157464650 AACTTTCATGAGATTTATCTTGG - Intergenic
917068637 1:171125068-171125090 CCCTTGTATGAGATTTAAATGGG - Intergenic
917715739 1:177735321-177735343 CACTTGGGGGAGAATTAACCTGG - Intergenic
918463165 1:184796303-184796325 CATTTGCAGGACATTTAACATGG + Intronic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
923026970 1:230212143-230212165 CACTTGCCTGAGTTCTAACAGGG + Intronic
1067207992 10:44235954-44235976 CACTGGCTTGAGATTTACCCAGG - Intergenic
1071094216 10:81954352-81954374 CACTTCCATGAGATTAAAAAAGG - Intronic
1073842889 10:107518523-107518545 CCCTTGCATGTGATTTAAGCTGG + Intergenic
1077832325 11:5887203-5887225 CTCTTGCAGGAGATTTAAGTAGG + Intronic
1080437020 11:32254624-32254646 GACTTTCATGGGGTTTAACCAGG - Intergenic
1086664116 11:89458210-89458232 CATTTGCAAAAGATTTAATCTGG + Intronic
1087091782 11:94281135-94281157 CATTTACCTGAGATTTCACCAGG - Intergenic
1092836236 12:12491748-12491770 CACTCTCATGAGATCTAGCCTGG + Intronic
1093719429 12:22421943-22421965 CACATGCAGGAGATTGAAACCGG + Intronic
1093719928 12:22428583-22428605 CACATGCAGGAGATTGAAACCGG + Intronic
1102308342 12:111823951-111823973 CCCTTGCATGAGATGTAAAAAGG + Intergenic
1106277562 13:28227344-28227366 CAATTCAATGAGATTTAAACAGG - Intronic
1108348769 13:49571413-49571435 GACATTCATGAGGTTTAACCAGG - Intronic
1116088624 14:40275094-40275116 CACATGCAGGAGATTGAAACTGG - Intergenic
1118639871 14:67782449-67782471 CACTTGCCTGAGCTCTATCCTGG + Intronic
1122334175 14:100957511-100957533 TACCTGCATGATTTTTAACCAGG - Intergenic
1125175898 15:36821426-36821448 AATTTGCATCAGATTCAACCTGG + Intergenic
1126912830 15:53433306-53433328 CATTTGAATGAGATTTTACCTGG + Intergenic
1130373530 15:83307764-83307786 CACGTGCATGTGTTTTAGCCTGG - Intergenic
1134373127 16:13644354-13644376 AAGTTGCATTATATTTAACCTGG - Intergenic
1135665305 16:24330640-24330662 CACTTGCATGAGAATCACCTGGG - Intronic
1138730559 16:59189424-59189446 CACTTGCATGTGATTTCCCAAGG + Intergenic
1143815737 17:9512823-9512845 CACATGCATAAGAATGAACCTGG + Intronic
1150162575 17:62911331-62911353 CACTTGCATGAGATTTGGTTGGG - Intergenic
1152588802 17:81200999-81201021 CAGTTCCATGAGATTCCACCAGG - Intronic
1156883348 18:42106321-42106343 TTCTTGCATGGGATTTAACATGG + Intergenic
1158790941 18:60779756-60779778 CACATGCAGGAGATTGAAGCTGG + Intergenic
1163222256 19:15930081-15930103 TACATGCATGAGATATAAGCGGG + Intronic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
929435597 2:41926379-41926401 CACTTGGATGAGACTTTCCCAGG - Intergenic
929980626 2:46675993-46676015 AATTTGTATGGGATTTAACCTGG - Intergenic
935859109 2:107308612-107308634 CACATGCAGGAGAATTAAGCTGG - Intergenic
939191065 2:138917309-138917331 CACTTCAATCAGATTTTACCTGG - Intergenic
939959830 2:148556800-148556822 AACTTGGATGAAATATAACCTGG + Intergenic
947241179 2:227996093-227996115 CTCTTGCATTAGAATCAACCAGG - Intronic
1169860696 20:10148493-10148515 CACTTGCCTGTGATTCCACCTGG - Intergenic
1173562456 20:44015911-44015933 CACTGGCCTGAGTTTTAACAGGG - Intronic
1174057052 20:47805232-47805254 CCCATGCACGAGATTTAACGTGG + Intergenic
954873192 3:53783615-53783637 CACTCACATGAGATTCAGCCCGG - Intronic
955277472 3:57559976-57559998 CACTTGTATGTGATTTAAAATGG + Exonic
957763193 3:84586693-84586715 CACATGCAGGAGATTGAAACTGG - Intergenic
963480804 3:145871560-145871582 CACTTGCATCAGAATTAGTCAGG + Intergenic
964835204 3:160930401-160930423 CACTTGCAAGAGATTTATGGGGG + Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
967585224 3:191205723-191205745 GACTTGTATGATATTTAACTTGG - Intronic
970574937 4:17418011-17418033 GACCTGCATGAGATTCAGCCTGG - Intergenic
975502776 4:75105170-75105192 CATTTGCATGAAATTAAAGCAGG - Intergenic
983457819 4:167986279-167986301 CACTTGCATGAGAGTTCACTGGG - Intergenic
983818757 4:172167290-172167312 GTCTTGAATGAGGTTTAACCAGG + Intronic
986745206 5:10737612-10737634 TACATGCCTGAGATTTAAGCTGG + Intronic
986884291 5:12214995-12215017 CAGTTGCATTTGATTTTACCTGG - Intergenic
990319599 5:54616833-54616855 AACTTGCCTGTGTTTTAACCAGG + Intergenic
992583560 5:78207936-78207958 CACTTGATTGATATTTTACCTGG - Intronic
995300642 5:110576829-110576851 CACATGCAGGAGATTGAAACTGG + Intronic
998420568 5:141981466-141981488 CACTTTTATAAGATATAACCAGG - Intronic
999080184 5:148836192-148836214 CACTGACATGGCATTTAACCAGG + Intergenic
999864013 5:155680581-155680603 CAATTGCAGTAGATTTATCCAGG + Intergenic
1002840841 6:904198-904220 CACATGTATGAGATTCTACCTGG - Intergenic
1005144448 6:22671915-22671937 CACCTTCTTGAGATTTACCCAGG - Intergenic
1006968386 6:38013757-38013779 CACGTGTATGAGGTGTAACCTGG - Intronic
1007679645 6:43625415-43625437 CACCTGCATGAGATTCAGTCTGG - Exonic
1017216865 6:151918296-151918318 CACTTGCATGAGATTTAACCAGG - Intronic
1018156157 6:160987095-160987117 CATGTGCATGAGATGGAACCAGG - Intergenic
1018506017 6:164469861-164469883 CATTCTCATGAGATTTAAACAGG + Intergenic
1020513333 7:9087164-9087186 GACTTGCATTAGATTAAATCAGG + Intergenic
1020931956 7:14408288-14408310 TACTTCCATGATAATTAACCAGG - Intronic
1023102823 7:36736401-36736423 CCTTTGCATGAGTTTTCACCTGG + Intergenic
1024469000 7:49747567-49747589 CATTTACATGAGATTTAGGCGGG + Intergenic
1031224116 7:119012437-119012459 CACATGCAGAAGATTTAAACTGG + Intergenic
1031555823 7:123174848-123174870 CACTTGCTTGCAATTTAACCTGG + Intronic
1032809001 7:135390184-135390206 CACTGGCATGTGCTTTAACTTGG - Intronic
1035930373 8:3773771-3773793 CACTTGAATGATATTTATTCTGG - Intronic
1038129494 8:24713921-24713943 GACTTGCATGAGAATTTCCCTGG - Intergenic
1038817871 8:30924198-30924220 CACTTGAATGAGATTTTGACAGG + Intergenic
1040714853 8:50238436-50238458 CATATGCATGAGATTAAAACTGG + Intronic
1043354134 8:79392673-79392695 CACTTGCCTTAGATTTGGCCAGG + Intergenic
1047069121 8:121322688-121322710 AACTTGCATGACATATAAGCAGG - Intergenic
1048396307 8:134017240-134017262 AACTTCCTTGAGATTTTACCAGG - Intergenic
1048909113 8:139117353-139117375 GACTCGCATGAGAATGAACCAGG - Intergenic
1052414691 9:28162781-28162803 CACTTACATGGGACTTAACTTGG + Intronic
1058331938 9:103772841-103772863 CACATGCATAAGAATTAAACTGG - Intergenic
1059075028 9:111183864-111183886 CACATGCAGGAGATTGAAACTGG - Intergenic
1061295477 9:129674638-129674660 CAGTTGCTTGAGATTTGACAAGG + Intronic
1191139766 X:57104604-57104626 CCCTTGCATGATATTTAAAAAGG - Intergenic
1194220233 X:91181262-91181284 CACATGCAGAAGATTTAAACTGG - Intergenic
1194811477 X:98392356-98392378 CACATGCAGAAGATTGAACCTGG - Intergenic
1198719487 X:139600527-139600549 CACTTGTTTGAGATATAACATGG - Intronic
1199928281 X:152492671-152492693 CACATGCAGGAGAATTAAACTGG - Intergenic
1200132465 X:153858356-153858378 CACTTCCATGAGACTCATCCAGG - Intergenic
1200556748 Y:4645014-4645036 CACATGCAGAAGATTTAAACTGG - Intergenic
1202075072 Y:21029316-21029338 CACTTGCATGATATGTAAAAAGG + Intergenic