ID: 1017217699

View in Genome Browser
Species Human (GRCh38)
Location 6:151929421-151929443
Sequence ATATGTTAAAAGTAAAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2295
Summary {0: 1, 1: 5, 2: 36, 3: 288, 4: 1965}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017217699_1017217702 1 Left 1017217699 6:151929421-151929443 CCATTCCTTTACTTTTAACATAT 0: 1
1: 5
2: 36
3: 288
4: 1965
Right 1017217702 6:151929445-151929467 AGAGTTATTACATTTAAAGTGGG 0: 1
1: 0
2: 2
3: 36
4: 291
1017217699_1017217701 0 Left 1017217699 6:151929421-151929443 CCATTCCTTTACTTTTAACATAT 0: 1
1: 5
2: 36
3: 288
4: 1965
Right 1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG No data
1017217699_1017217703 14 Left 1017217699 6:151929421-151929443 CCATTCCTTTACTTTTAACATAT 0: 1
1: 5
2: 36
3: 288
4: 1965
Right 1017217703 6:151929458-151929480 TTAAAGTGGGCATTATTACTAGG 0: 1
1: 0
2: 1
3: 21
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017217699 Original CRISPR ATATGTTAAAAGTAAAGGAA TGG (reversed) Intronic
Too many off-targets to display for this crispr