ID: 1017217700

View in Genome Browser
Species Human (GRCh38)
Location 6:151929426-151929448
Sequence CTCTGATATGTTAAAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 278}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017217700_1017217702 -4 Left 1017217700 6:151929426-151929448 CCTTTACTTTTAACATATCAGAG 0: 1
1: 0
2: 6
3: 41
4: 278
Right 1017217702 6:151929445-151929467 AGAGTTATTACATTTAAAGTGGG 0: 1
1: 0
2: 2
3: 36
4: 291
1017217700_1017217703 9 Left 1017217700 6:151929426-151929448 CCTTTACTTTTAACATATCAGAG 0: 1
1: 0
2: 6
3: 41
4: 278
Right 1017217703 6:151929458-151929480 TTAAAGTGGGCATTATTACTAGG 0: 1
1: 0
2: 1
3: 21
4: 256
1017217700_1017217701 -5 Left 1017217700 6:151929426-151929448 CCTTTACTTTTAACATATCAGAG 0: 1
1: 0
2: 6
3: 41
4: 278
Right 1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017217700 Original CRISPR CTCTGATATGTTAAAAGTAA AGG (reversed) Intronic
900271007 1:1788689-1788711 CTTTGATATGTTAACTGTAACGG + Intronic
900723083 1:4192213-4192235 CACACATATATTAAAAGTAAAGG - Intergenic
904967118 1:34383685-34383707 CACAGATAGATTAAAAGTAAAGG + Intergenic
905828568 1:41046257-41046279 CTCAGATATGGCAAAGGTAAGGG + Intronic
906090470 1:43174926-43174948 ATCTGATTTGTAAAGAGTAATGG - Intronic
906592114 1:47035047-47035069 CTCTGAAATTTTAAAAGTTCAGG + Intronic
906894835 1:49759234-49759256 CTCTGATATGTGATAAAAAATGG + Intronic
906905928 1:49892288-49892310 CTCTGACTTGTTAAAGCTAAGGG + Intronic
907879449 1:58532442-58532464 CTCTAATATCTTTCAAGTAATGG - Intronic
909200251 1:72682749-72682771 ATCTGATATATTCAAAATAATGG + Intergenic
909329817 1:74397637-74397659 CTCTGATATCTAAACAGTTATGG - Intronic
909367245 1:74841127-74841149 CTCTGATATTTAAAAACTAATGG + Intergenic
910272642 1:85413198-85413220 CTATGATAAGTGGAAAGTAAAGG + Intronic
910735556 1:90451590-90451612 CACAGATAATTTAAAAGTAAAGG + Intergenic
911381706 1:97123029-97123051 CTCTATTATCTTTAAAGTAAAGG + Intronic
912254040 1:108041057-108041079 CTCTGCTATGTTAAATTCAAAGG - Intergenic
912653678 1:111465425-111465447 TTCAGATCTGGTAAAAGTAATGG + Intergenic
916177719 1:162056402-162056424 CTCCCATGTATTAAAAGTAATGG + Intergenic
916390273 1:164322843-164322865 TCCTGATCTGTAAAAAGTAAGGG + Intergenic
916630010 1:166602176-166602198 GTCTGAAATGCTAAGAGTAAAGG - Intergenic
917575466 1:176316740-176316762 CTCTGATGGCTTACAAGTAAAGG + Intergenic
918274167 1:182935870-182935892 TTCAGATATGTTCAAAGTAAAGG - Intronic
918299845 1:183193141-183193163 CTCTGATATTTTTAAAGGAAAGG - Intronic
919263765 1:195235587-195235609 CTCCCATCTTTTAAAAGTAATGG - Intergenic
924389267 1:243534161-243534183 CACTGATAGATTAAAAGTAAAGG + Intronic
1062859490 10:799346-799368 CACTGATAGGCTCAAAGTAAAGG + Intergenic
1063000847 10:1920718-1920740 TTGTGATATATTAAAAATAAAGG + Intergenic
1063181886 10:3609246-3609268 CTCTGATATGCTCAAAGTAAAGG + Intergenic
1063182544 10:3617805-3617827 CTTTGATAAGTCAAAAGTACTGG - Intergenic
1063884239 10:10561735-10561757 CTCAGATATGTACAAAGGAAAGG - Intergenic
1064978088 10:21139112-21139134 CTCTCAGATGTTAAGAGTCACGG + Intronic
1065054447 10:21829656-21829678 CACTGAAAGGTTGAAAGTAAAGG - Intronic
1065260517 10:23919046-23919068 GTCTGAGATGTTGAAAGAAATGG + Intronic
1066667395 10:37798508-37798530 CTGTTATATGTAAAAATTAAAGG + Intronic
1067664348 10:48262232-48262254 CACAAATAGGTTAAAAGTAAAGG + Intronic
1069331387 10:67297555-67297577 CTATGATATGTTAACAGAGAAGG - Intronic
1071453342 10:85820595-85820617 GTGTGAGATGTTAAAAATAAAGG + Intronic
1072080512 10:92025406-92025428 CACTGAGATTTTAAAAGTAGAGG - Intronic
1072772933 10:98157886-98157908 TTCTGATATGTGAAAGGTAGAGG + Intronic
1072893397 10:99344963-99344985 CTCTGACGTGTTAAGAGCAATGG - Intronic
1075267338 10:121013243-121013265 CACATATATATTAAAAGTAAAGG + Intergenic
1076174190 10:128354333-128354355 CTCTAATATGTTAATATTAAAGG - Intergenic
1076174242 10:128354791-128354813 CTTTAATTTATTAAAAGTAATGG + Intergenic
1079406789 11:20154779-20154801 ATTTGCTATGTTACAAGTAAAGG - Intergenic
1079939572 11:26661980-26662002 CTTTTATATGTTAGAAATAATGG - Exonic
1081281691 11:41216971-41216993 CTCTGAGAGATTAAAAGAAACGG + Intronic
1085979527 11:81706959-81706981 ATCTGATTTGTTGAAAGTCATGG + Intergenic
1085981222 11:81728824-81728846 CTCAAATATTTTAAAAGTATGGG - Intergenic
1086000746 11:81983160-81983182 ATCAGATAAGTAAAAAGTAAAGG - Intergenic
1087874108 11:103335321-103335343 CTCTGTTATGTAAAAACTTAAGG - Intronic
1087906302 11:103701858-103701880 CTATGATTTTTTAAAACTAAAGG - Intergenic
1092479813 12:8849787-8849809 CTCTGAGATGTTAACAGTCCTGG + Intronic
1093864372 12:24207194-24207216 TTCTGTTATTGTAAAAGTAAAGG + Intergenic
1094339105 12:29390468-29390490 GCCTGATATGTTAAAATTAGAGG + Intergenic
1094753054 12:33436603-33436625 TGCTGATATGGTAAAAATAATGG + Intronic
1097718287 12:62991876-62991898 AACTGATATGTTAAAAGAGAAGG - Intergenic
1098111233 12:67123883-67123905 CTGGGATATGATAAAAGTAGAGG + Intergenic
1098712935 12:73789713-73789735 CTCACATGTGTTAAAAGTAAAGG - Intergenic
1098737472 12:74125170-74125192 CACATATATATTAAAAGTAAAGG + Intergenic
1100112860 12:91266815-91266837 CAATGAAATATTAAAAGTAATGG - Intergenic
1106742278 13:32657431-32657453 CACTGATAGGGTCAAAGTAAAGG - Intronic
1107008243 13:35639422-35639444 GTCTGAAATGATAAAAGGAAAGG - Intronic
1109276373 13:60308099-60308121 CTCTGGTATGTTATAGGTAATGG + Intergenic
1109589120 13:64453808-64453830 CCCTGAGATGTAAGAAGTAAAGG - Intergenic
1110043582 13:70798679-70798701 CTTTGACAAGTTAAAAATAAAGG - Intergenic
1110507442 13:76304094-76304116 AACTGATTTATTAAAAGTAATGG + Intergenic
1110707619 13:78612868-78612890 TTCTGATATGTTAAAGCTAATGG - Intergenic
1112537151 13:100270671-100270693 CTGTGAAATGTTAAAATAAATGG + Intronic
1112785153 13:102943406-102943428 CTCTGATGGGTTTTAAGTAATGG + Intergenic
1115400200 14:32949492-32949514 CTCTGATATGTGAATGCTAAAGG + Intronic
1116083927 14:40210362-40210384 CTCAGAAAGGTTAAAAGTAAAGG + Intergenic
1116815249 14:49577700-49577722 GACTGATATGTCAAAATTAAGGG - Exonic
1116819538 14:49614478-49614500 CTCTGATATGTTAAAGTAATGGG + Exonic
1118092836 14:62501326-62501348 TTCTGATATGTTAAAATTTCTGG + Intergenic
1120129272 14:80786039-80786061 CATTGATATTTTAAAAATAATGG - Intronic
1120340511 14:83215617-83215639 CTCTCAAATGTCAAAAATAAAGG - Intergenic
1120903971 14:89602939-89602961 CTCAGAGAAGTGAAAAGTAAGGG + Intronic
1124346535 15:28926040-28926062 CACTGGTAGGTTAAAAGTAAAGG - Intronic
1124697204 15:31874213-31874235 ATCTGTTTGGTTAAAAGTAAAGG - Intergenic
1126175800 15:45734130-45734152 CTCTGATACGGCAAAAGGAAAGG + Intergenic
1126224427 15:46254089-46254111 CACAGATACATTAAAAGTAAAGG + Intergenic
1126345757 15:47692333-47692355 TTCTGATATGTTCACAGTAGAGG - Intronic
1127571413 15:60245991-60246013 CACAGATAGGGTAAAAGTAAAGG + Intergenic
1127638963 15:60897273-60897295 CCCTGATATGTAATAAGTTAGGG - Intronic
1129000886 15:72332863-72332885 CACAGATGGGTTAAAAGTAAAGG - Intronic
1131590738 15:93746299-93746321 TGATGATATGTTCAAAGTAAAGG + Intergenic
1131964278 15:97823277-97823299 CTTTTATATGATAAAAGCAAAGG - Intergenic
1138688218 16:58745100-58745122 CTGATATATGTTAAAAGTAGAGG - Intergenic
1139792241 16:69447949-69447971 CTCTGATATGCTCAGAGTAGAGG + Intronic
1140762133 16:78119215-78119237 CTCTGATTTGGTAAAAGCAACGG + Intronic
1140929273 16:79611891-79611913 ATCTGATAAGTTAAAACTAAGGG - Intergenic
1141315245 16:82956468-82956490 CTCTGATATGTTAAAGAAAATGG - Intronic
1144794140 17:17879668-17879690 GTCTGAGATGTTAACAGAAATGG - Exonic
1148220247 17:45856316-45856338 CTCAGAGATATTGAAAGTAATGG - Intergenic
1148944292 17:51245368-51245390 CTCAGATATTTTAAATGTATGGG - Intronic
1152430025 17:80243703-80243725 CTGTGGTATTTTTAAAGTAATGG - Intronic
1154531131 18:15346173-15346195 CTTTGATATTTTAAAAATATAGG - Intergenic
1155489169 18:26381856-26381878 CCCTGATATGTTATTATTAATGG + Intronic
1156075401 18:33271368-33271390 CACAAATATGTTGAAAGTAAAGG + Intronic
1158755342 18:60317517-60317539 TTCAGATATGTTAAAAGTTAGGG - Intergenic
1159237014 18:65688807-65688829 CTTTGAAATATTGAAAGTAATGG + Intergenic
1160435364 18:78848005-78848027 CTCTGATATCTTACAAGGAAGGG + Intergenic
924980289 2:213646-213668 ATGTGAAATGTTAAAAATAAGGG - Intergenic
925793637 2:7519424-7519446 TTGTGATATTTTAAAAGTCATGG - Intergenic
926732519 2:16047577-16047599 CTCTGTTATTTTAAAAAAAAAGG + Intergenic
927227485 2:20783651-20783673 CACAGATATGTTGCAAGTAAAGG - Intronic
928036621 2:27830162-27830184 CACTGATATGTAAATACTAATGG - Intronic
928590133 2:32805989-32806011 CTCTGTTATGTCCAAAGTACTGG - Intronic
929295594 2:40243100-40243122 CTATGATATGTAGAAACTAAGGG - Intronic
929913283 2:46112256-46112278 CTCAGACAGGTTCAAAGTAAAGG - Intronic
931023159 2:58074153-58074175 CGCAGATAAATTAAAAGTAAAGG - Intronic
935231591 2:101102600-101102622 CTCACATAGGTTAAAAGTAAAGG + Intronic
936588608 2:113781300-113781322 CTCTTATATGTGAAATCTAAAGG + Intergenic
937490072 2:122357430-122357452 GTTTTATATATTAAAAGTAATGG + Intergenic
939005919 2:136786672-136786694 CTCTGTGATGCTAAAAATAATGG + Intronic
939476279 2:142692104-142692126 CTCTGTAATGGTAAAAGAAAAGG + Intergenic
940687145 2:156866438-156866460 CTCAAATATGTGAAACGTAAAGG - Intergenic
941022747 2:160426408-160426430 CTCTAATTTTTTAAAAGGAATGG + Intronic
941979397 2:171438713-171438735 CACAGATAGATTAAAAGTAAAGG - Intronic
942052496 2:172153279-172153301 CTCTGATAGGGCAAAAGGAAAGG - Intergenic
943278456 2:185899017-185899039 CTCAGCTAGGGTAAAAGTAAAGG - Intergenic
944256868 2:197632112-197632134 ATCTGATTTGCTCAAAGTAAGGG + Intronic
944470054 2:200043352-200043374 CTCTCATATGGTAAGAGAAATGG - Intergenic
945729131 2:213511300-213511322 CACTGATATTTTAAAAGTGATGG - Intronic
945793448 2:214333145-214333167 CTATGATATTTTAAAAGGAAAGG - Intronic
946383810 2:219369119-219369141 CACTGAAATGGTAAAAGTGACGG + Intergenic
946983466 2:225245755-225245777 CTCGAATAAATTAAAAGTAATGG + Intergenic
947090478 2:226504846-226504868 CTCAGAGATGTTAAAATTAAGGG + Intergenic
948134125 2:235623135-235623157 CTATGATATTTTAAAATCAATGG + Intronic
1169149596 20:3278755-3278777 ATCAAATATGGTAAAAGTAAAGG + Intronic
1172506865 20:35469474-35469496 CTCTGATAGGGAAAAAGGAAGGG - Intronic
1172581124 20:36049737-36049759 GCCTGATATGTTAAAATTAGAGG - Intergenic
1173702338 20:45083986-45084008 CTCTATGATGTTAAAAGTCAGGG + Intergenic
1174746721 20:53070954-53070976 CACTGAGGTGTTTAAAGTAATGG + Intronic
1175686772 20:61035883-61035905 TTCAGACAGGTTAAAAGTAAAGG - Intergenic
1176865416 21:14049395-14049417 CACAGATACATTAAAAGTAAAGG + Intergenic
1176901592 21:14448797-14448819 CTCTAAAATGATAAAAATAAAGG - Intergenic
1180690527 22:17711040-17711062 CTTTGAGCTGTTAAAAATAAGGG + Intronic
1181446509 22:22979702-22979724 ATTTGATATGATAAAGGTAAAGG + Intergenic
949285188 3:2394604-2394626 CTCTCATGTGTTATAAGTCAGGG + Intronic
949627773 3:5887359-5887381 CTCTGCTATGTAAACAGGAAGGG - Intergenic
949671797 3:6405410-6405432 CACAGATACATTAAAAGTAAAGG + Intergenic
951678063 3:25264588-25264610 GTCTGATATTTAAAAAGTAAAGG - Intronic
952168602 3:30779550-30779572 CTCTGAAGTATTGAAAGTAATGG + Intronic
954953780 3:54500260-54500282 CACAGATATATTAAAAGTAAAGG - Intronic
955079097 3:55641237-55641259 CTCTTATATCTGAAAAGTCAGGG - Intronic
955756404 3:62229167-62229189 CTCTGAGATGCTAAAAGAGATGG + Intronic
957689336 3:83547394-83547416 CTCTGATAGGTTAAAGGTAAGGG - Intergenic
958628655 3:96659179-96659201 ATCTAATATTTTAAAAGAAAGGG + Intergenic
958745614 3:98129981-98130003 CACTGCTTTGTTAAAAATAAAGG + Intergenic
958809218 3:98840475-98840497 CAGTGATATGTTCAAAGTACGGG + Intronic
959093821 3:101932430-101932452 CTCTGCCATGTAAAAAGAAAGGG + Intergenic
959416701 3:106084599-106084621 ATTTCATATGTTGAAAGTAATGG - Intergenic
960411384 3:117330789-117330811 TTCTAATAGGTTAAAAATAAAGG - Intergenic
962065812 3:131979548-131979570 CTCACATAAGTTTAAAGTAAAGG - Intronic
962226690 3:133617432-133617454 CTCTGGAATGTAAAAAGTACAGG + Intronic
962557072 3:136564427-136564449 ATCTGATAGGTAAAAAGAAATGG + Intronic
964934807 3:162070557-162070579 CTCAGATATATTAATATTAATGG + Intergenic
965217634 3:165883625-165883647 CTGTGTTATCTTAAAAGAAAAGG + Intergenic
965736940 3:171830480-171830502 CACTCATATGTTAAAAATAAAGG + Intergenic
966130963 3:176639043-176639065 CTCTGATAGGATAAATGTAAAGG + Intergenic
966163266 3:176989905-176989927 ATCTCATTTATTAAAAGTAATGG - Intergenic
966931203 3:184676943-184676965 CTATGAAATGGTAAAAGTCATGG - Intronic
967162831 3:186754358-186754380 CTCTGAGATGTTAACAGTGAGGG + Intergenic
967960665 3:194920779-194920801 CTCAGATATGTTAAGAACAAAGG - Intergenic
968793050 4:2681950-2681972 CCCTGAGAAGTTAAAAGTAAAGG - Intronic
969383169 4:6821149-6821171 CTCTGATATGCAAAAACTGAAGG - Intronic
974100963 4:57415894-57415916 CTCTTAAATGTTAAAAGGTAGGG + Intergenic
974496505 4:62635155-62635177 TTTGGATATGCTAAAAGTAAGGG - Intergenic
974505455 4:62764740-62764762 CACAGATAAGTTGAAAGTAAAGG + Intergenic
975006252 4:69290460-69290482 CTCTGAAGTCTGAAAAGTAATGG + Intronic
975170792 4:71229842-71229864 CTGTGAAATTTTAAAAGGAATGG + Intronic
977589588 4:98812017-98812039 CTCAGATACATTATAAGTAAAGG - Intergenic
978326977 4:107569849-107569871 CTGGCATATGTCAAAAGTAAAGG + Intergenic
978679262 4:111359116-111359138 CCTTGGTATGTTAAAGGTAATGG - Intergenic
979730296 4:124015876-124015898 CCCTGATATGGTCAAAGTCAAGG - Intergenic
980028092 4:127790587-127790609 AACTGAAATGTTAAAAGTGATGG - Intronic
981614230 4:146629872-146629894 GTTTGATATGTAAAAGGTAAGGG + Intergenic
981874474 4:149524124-149524146 CCCAGAAATGTTAAAAGTGAAGG + Intergenic
983880011 4:172922592-172922614 GTGTGCTATGGTAAAAGTAAGGG + Intronic
984315452 4:178124296-178124318 CACAGATGGGTTAAAAGTAAAGG + Intergenic
984664479 4:182410801-182410823 ATATGATATGTCAAAACTAAAGG - Intronic
985121483 4:186647348-186647370 CTCAGATATCTTAAAAATAAAGG - Intronic
986876319 5:12115379-12115401 CTCTGAGATGATAAAGGTAGAGG - Intergenic
987989229 5:25189806-25189828 GCCTGATATGTTAAAATTAGAGG - Intergenic
988217818 5:28299443-28299465 CTATCATAAGTAAAAAGTAAGGG - Intergenic
989266207 5:39476916-39476938 CTGTGATGTGCTAAAACTAAAGG - Intergenic
990928673 5:61060900-61060922 CTCTGAAATGTAAAGATTAAAGG + Intronic
991316586 5:65315624-65315646 CTCAGCTAGGTTAAAAGTAAGGG + Intronic
992780007 5:80119180-80119202 AGCTAATATGTTAAAAGTACTGG + Intronic
992902404 5:81311025-81311047 CTCTGTGAGGTTAAAAGGAATGG + Intronic
993100468 5:83532427-83532449 CTATGAGATGTTAAAAGTATGGG + Intronic
993765597 5:91853389-91853411 TTCTGATGTGTTAATAGTAATGG + Intergenic
994521284 5:100840200-100840222 CTCTAAAATGTTAAAATAAAAGG - Intronic
994563179 5:101403765-101403787 CTCTGACATGTTTAAACAAAGGG + Intergenic
994731515 5:103497357-103497379 ATCTGAGATGCTAAAAGTAAAGG - Intergenic
995224171 5:109685616-109685638 CTGTGATTTTTTAAAGGTAATGG - Intergenic
995820980 5:116232273-116232295 CTTTGAGATGTTAAAAGTGGGGG + Intronic
995931457 5:117451455-117451477 ATCTGAGATGTAAAAAGTAAAGG - Intergenic
997268095 5:132510076-132510098 CTCAAATTTGGTAAAAGTAAAGG + Intergenic
998518649 5:142780135-142780157 ATCTAATATATTAAAAGCAAAGG - Intronic
998543441 5:143005187-143005209 TTCTGATATGTTAAGATAAAAGG + Intronic
999226693 5:150031311-150031333 ATGTGTTATGTTAAAAATAAAGG - Intronic
999515717 5:152299686-152299708 TTCTGAGAAGTTAAATGTAAAGG + Intergenic
1000804546 5:165773300-165773322 CTCTGTTTTCTTACAAGTAAAGG - Intergenic
1000895592 5:166851367-166851389 CTCTCATATATTAAAAATAGTGG - Intergenic
1001840003 5:174867504-174867526 CTCTTATCTATTAAAAGTAATGG + Intergenic
1003041246 6:2689347-2689369 CTCTGATATAATTAAAATAATGG - Intronic
1003352393 6:5330323-5330345 CTCAGAGATGTTCAAAGAAAGGG - Intronic
1003778190 6:9392812-9392834 CTCTGGTATATTAAGAGTATTGG - Intergenic
1004006665 6:11643135-11643157 AACTGAGAGGTTAAAAGTAAGGG + Intergenic
1005437067 6:25825081-25825103 CTCAGATAAGTTAGAAGTAAAGG - Intronic
1005497839 6:26404324-26404346 TTCCAATATTTTAAAAGTAAAGG + Intronic
1005675233 6:28147896-28147918 GTCTCATCTGTTAAGAGTAAGGG + Intronic
1006236811 6:32640655-32640677 CTCTGTTTTGTTAATAGTAATGG - Intronic
1006246831 6:32744520-32744542 CTCTGTTTTGTTAATAGTAGTGG - Intronic
1006880595 6:37335566-37335588 CATAGATAGGTTAAAAGTAAAGG - Intergenic
1008809226 6:55473109-55473131 CTCAGGTATGTTAAAAGTAAAGG - Intronic
1009378047 6:62995620-62995642 ATCTGATATTTTAAAAGTATGGG - Intergenic
1009564216 6:65291249-65291271 ATCTGATATGTTAAGAGTGGAGG + Intronic
1010054362 6:71547102-71547124 CTCAGATAAGTTAAAAGTAAAGG + Intergenic
1011087849 6:83562486-83562508 TTCTGATATGAGAAAATTAAAGG - Intronic
1012252636 6:96995889-96995911 CTCTGAGATGTTACTGGTAAGGG - Intronic
1012558221 6:100543484-100543506 GACAAATATGTTAAAAGTAAAGG + Intronic
1013557174 6:111268305-111268327 TTCAGATATGTTAACAGTATGGG - Exonic
1013704928 6:112821300-112821322 CTTTGATATGTAATTAGTAATGG + Intergenic
1013944517 6:115705663-115705685 CACTGATAGGTTAAAAAAAATGG + Intergenic
1013973600 6:116049554-116049576 CTGTTATATGATAAAAGTACAGG + Intronic
1014109991 6:117609703-117609725 CCCTGATTTATTAAAAGCAAAGG - Intergenic
1014794544 6:125709538-125709560 CACAGATAGGATAAAAGTAAAGG - Intergenic
1015344483 6:132139644-132139666 CTCTTTTCTGTAAAAAGTAATGG + Intergenic
1017217700 6:151929426-151929448 CTCTGATATGTTAAAAGTAAAGG - Intronic
1017371743 6:153718159-153718181 TTCTTATTTATTAAAAGTAATGG - Intergenic
1018167511 6:161112635-161112657 CACAGATATGTTGAGAGTAATGG - Intronic
1018236675 6:161732743-161732765 CTCTGACATCTTTAATGTAATGG - Intronic
1018470396 6:164091273-164091295 CTGTTTTACGTTAAAAGTAAAGG - Intergenic
1018815530 6:167327784-167327806 CTCTGAAATCCTAAAAGTATAGG + Intronic
1020636586 7:10702871-10702893 GTTTGCTATGTTAAAAGAAAAGG + Intergenic
1020893549 7:13910687-13910709 CTTTGATACCTAAAAAGTAATGG - Intronic
1021127616 7:16871424-16871446 ATATGATCTGTTAAAATTAACGG + Intronic
1021421736 7:20453194-20453216 CTCTGAAATTTTTACAGTAATGG + Intergenic
1021717568 7:23473763-23473785 CTCTGATCTGTTTAAACTAGAGG + Intergenic
1022577534 7:31512467-31512489 TTCTGACATGTTAAATGTAGGGG + Intergenic
1024019678 7:45355342-45355364 CTGAGATAGGTTAAAAGAAAAGG + Intergenic
1024723121 7:52160480-52160502 CTCTGATATTTTTATAGTAGTGG - Intergenic
1024836611 7:53527122-53527144 CCCAGGTATATTAAAAGTAAAGG + Intergenic
1026378886 7:69779431-69779453 ATCTGTTATGTTCAAAATAAAGG + Intronic
1026568577 7:71510246-71510268 CCCTGAAATGTAAAATGTAATGG + Intronic
1027610552 7:80354896-80354918 ACCTGATATATGAAAAGTAAAGG + Intergenic
1027726990 7:81819192-81819214 CTCTGATCTTTTAAAATTAAAGG + Intergenic
1030429392 7:109423916-109423938 TTCTGATAGGATAAATGTAAAGG - Intergenic
1030855982 7:114558105-114558127 CTCTAGTATATTAAAAGTCAGGG - Intronic
1031019729 7:116613998-116614020 CTTTGACTTGTTAAAAGTACAGG + Intergenic
1031220702 7:118961223-118961245 CTATGATATGTAAAATGCAAAGG - Intergenic
1031411913 7:121449370-121449392 ATCAGATATGTTATAAGGAAAGG + Intergenic
1031879728 7:127183070-127183092 CTCAAATATGTTAAAAGTAAAGG + Intronic
1032064249 7:128753013-128753035 CTCTAAAATGTTAACAGGAAAGG - Intronic
1032965794 7:137095530-137095552 CACTCATAGGTTCAAAGTAAAGG + Intergenic
1033440901 7:141377881-141377903 ATATAATATGTTAACAGTAAGGG - Intronic
1034342333 7:150365919-150365941 CTCTGATTTGTGATAAGTTAAGG + Intergenic
1036678011 8:10851081-10851103 CTCTGATGTTTTCAGAGTAAAGG + Intergenic
1036835350 8:12059870-12059892 CACTCATAGGTTCAAAGTAAAGG + Intergenic
1036857191 8:12306433-12306455 CACTCATAGGTTCAAAGTAAAGG + Intergenic
1037231009 8:16658884-16658906 CACATATATATTAAAAGTAACGG + Intergenic
1037267006 8:17074461-17074483 CTATAATATATTAAATGTAAAGG + Intronic
1037289846 8:17338772-17338794 CTCTGAGAATTTAAAAGGAAGGG + Intronic
1037790818 8:21940153-21940175 TAATGATATTTTAAAAGTAATGG + Intronic
1038322355 8:26539128-26539150 CTAAAATATGTTAAAAGTAGAGG - Intronic
1039254388 8:35703016-35703038 TCCTGATATGTTAAAAATTAGGG - Intronic
1040656584 8:49517316-49517338 CAGTGATATGTTAAAACTATGGG - Intergenic
1040695697 8:49995042-49995064 TTCTCACATGTTAAAAGAAAAGG - Intronic
1041473864 8:58240958-58240980 CTCTGATAGGTTGAAAGTAAAGG + Intergenic
1041936808 8:63341200-63341222 CTCTGACTTGATAAAAGAAAGGG - Intergenic
1041988654 8:63957318-63957340 TTCTTATATCATAAAAGTAATGG + Intergenic
1042846320 8:73172703-73172725 CTCTGAACTGTTTAAAGTACTGG + Intergenic
1043034760 8:75182220-75182242 CGCTGATAGGTTCAAAGTATAGG + Intergenic
1043195219 8:77284616-77284638 CTCTGACATGATATAATTAATGG - Intergenic
1043228587 8:77768571-77768593 CTCTGAGAAGTAATAAGTAAAGG - Intergenic
1044117895 8:88356682-88356704 CTTGTATATGTTCAAAGTAAGGG + Intergenic
1044895443 8:96886694-96886716 CTCTTAGAGGTTAAAAGAAATGG - Intronic
1045208706 8:100071770-100071792 TTCTTACATGTTAAAAGTCAGGG + Intronic
1045733289 8:105266596-105266618 CTCTGTTTGGTTGAAAGTAAGGG - Intronic
1046938092 8:119904796-119904818 CTCTGGTCTCTTAAAAATAAAGG - Intronic
1050147295 9:2583015-2583037 CTCTAATATATTTAAAGTCAAGG + Intergenic
1050800455 9:9605880-9605902 CTCTTTTATGTTATAAGTAAAGG + Intronic
1051283946 9:15475263-15475285 CTTTCATTTATTAAAAGTAAAGG - Intronic
1051492996 9:17687966-17687988 CTCTAGTATTTAAAAAGTAAGGG + Intronic
1051762273 9:20480781-20480803 CTCTGAGATATTAAAATAAATGG - Intronic
1052142918 9:25009574-25009596 CTCAGATTTATTAAGAGTAATGG - Intergenic
1052188273 9:25625587-25625609 TTCAGATATGTTCCAAGTAATGG + Intergenic
1053195330 9:36113340-36113362 CTCTCATGTGTTAAAATAAATGG + Intronic
1053659719 9:40261003-40261025 CTGTGATATCAAAAAAGTAAAGG - Intronic
1053910090 9:42890359-42890381 CTGTGATATCAAAAAAGTAAAGG - Intergenic
1054371847 9:64407301-64407323 CTGTGATATCAAAAAAGTAAAGG - Intronic
1054524879 9:66115213-66115235 CTGTGATATCAAAAAAGTAAAGG + Intronic
1054679466 9:67897015-67897037 CTGTGATATCAAAAAAGTAAAGG - Intronic
1055423496 9:76168806-76168828 GTTTTATATGTTGAAAGTAATGG - Intronic
1056996328 9:91464009-91464031 TGCAAATATGTTAAAAGTAAAGG - Intergenic
1058222700 9:102322452-102322474 CTGAGATAGGTTTAAAGTAAAGG + Intergenic
1058314807 9:103552651-103552673 CACAAATAAGTTAAAAGTAATGG + Intergenic
1058349174 9:104000437-104000459 CTGATATATGTTAAAATTAAAGG + Intergenic
1059629432 9:116104640-116104662 CTAGGATATGTTAATAGAAATGG - Intergenic
1059706905 9:116833550-116833572 CACAGATATGTTAAAAGAAAAGG + Intronic
1059815178 9:117904197-117904219 CTCTGTTATGTCAAATGCAACGG + Intergenic
1060432202 9:123560404-123560426 CTCTGATAAGTTAGAAGCCATGG + Intronic
1060472924 9:123963568-123963590 CTGTCATCTGTTAAAAGAAAGGG - Intergenic
1188110072 X:26186563-26186585 TTCAGACAGGTTAAAAGTAAAGG + Intergenic
1188373959 X:29404823-29404845 CTCTGATAAATGAAAACTAAGGG - Intronic
1188417122 X:29949118-29949140 CTCTCATATGTTAAAGAGAAAGG + Intronic
1188608725 X:32069041-32069063 ATCTGAAATGTTAAAAGTTTGGG + Intronic
1189519433 X:41750588-41750610 GTCTGAATTGTGAAAAGTAATGG + Intronic
1192054882 X:67763243-67763265 CTCGAATAAATTAAAAGTAAAGG + Intergenic
1193397475 X:81003013-81003035 TACTGATATGTTAAAATTAGAGG - Intergenic
1194131738 X:90090120-90090142 CTCTAAAGTATTAAAAGTAATGG - Intergenic
1195003800 X:100667452-100667474 CTCTGATTTGGAAAAGGTAAGGG - Intronic
1195699708 X:107694696-107694718 CACATATATATTAAAAGTAAAGG - Intergenic
1195953330 X:110301852-110301874 TTCTAATATGTTTAAAGTCATGG - Intronic
1196000142 X:110774236-110774258 CACAGATGGGTTAAAAGTAAAGG - Intronic
1197031858 X:121826010-121826032 GTTTCATATGTTAAAAGTTAAGG - Intergenic
1197619467 X:128731781-128731803 CTGTGATATGTTAGAAGCATGGG + Intergenic
1198442598 X:136677929-136677951 GTCTTATATCTTAAAGGTAAGGG - Exonic
1198446254 X:136718140-136718162 CACTTATAAATTAAAAGTAAAGG + Intronic
1198684487 X:139213089-139213111 ATCTGATATGCAAAAAGTATTGG - Intronic
1199927838 X:152487643-152487665 CTCTGAAATGTAAAAAATAATGG + Intergenic
1200371869 X:155735675-155735697 CCCAGATATATTAAAAGTAAAGG - Intergenic
1200565237 Y:4756712-4756734 CGCTCATATGTTAATAGTGAAGG + Intergenic