ID: 1017217701

View in Genome Browser
Species Human (GRCh38)
Location 6:151929444-151929466
Sequence CAGAGTTATTACATTTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017217700_1017217701 -5 Left 1017217700 6:151929426-151929448 CCTTTACTTTTAACATATCAGAG 0: 1
1: 0
2: 6
3: 41
4: 278
Right 1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG No data
1017217699_1017217701 0 Left 1017217699 6:151929421-151929443 CCATTCCTTTACTTTTAACATAT 0: 1
1: 5
2: 36
3: 288
4: 1965
Right 1017217701 6:151929444-151929466 CAGAGTTATTACATTTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017217701 Original CRISPR CAGAGTTATTACATTTAAAG TGG Intronic
No off target data available for this crispr