ID: 1017225021

View in Genome Browser
Species Human (GRCh38)
Location 6:152010955-152010977
Sequence AACAATAATGAGAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 476}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017225021_1017225026 11 Left 1017225021 6:152010955-152010977 CCTACCTCCTTCTCATTATTGTT 0: 1
1: 0
2: 2
3: 37
4: 476
Right 1017225026 6:152010989-152011011 ACAATATTATCAGTAATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017225021 Original CRISPR AACAATAATGAGAAGGAGGT AGG (reversed) Intronic
902441561 1:16433443-16433465 AACCCTAATGAGAAAGAGGCTGG - Intronic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
903249490 1:22042394-22042416 AACAATAATTAAAACGAGGCTGG - Intergenic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
905478674 1:38246524-38246546 AACATCATAGAGAAGGAGGTGGG - Intergenic
906631247 1:47370234-47370256 ATCAATGATGAGAGGGACGTGGG - Intronic
906917376 1:50025340-50025362 AAAAATAAAGAGAAAGATGTGGG + Intergenic
907462588 1:54613988-54614010 AACTCTTATGAGAATGAGGTAGG - Intronic
907572255 1:55494044-55494066 AATAATAATAATAAAGAGGTAGG - Intergenic
908113498 1:60919700-60919722 AACAAAAATGAGTAGGACATAGG - Intronic
909256058 1:73423858-73423880 AACAATATTGAAAAGGAGCTTGG + Intergenic
910785544 1:90994149-90994171 AACAGTTATGAGAACGATGTAGG + Intronic
911149759 1:94586509-94586531 CACAATAATGAGAATGAATTAGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912839454 1:113026049-113026071 AACAAAAATGACAAGGGGGCCGG + Intergenic
913244542 1:116860108-116860130 AGCAATAATCTGAATGAGGTAGG - Intergenic
913369496 1:118082784-118082806 AGCAAAAATGTGAAGGAAGTAGG + Intronic
916413758 1:164574118-164574140 AAAAACACAGAGAAGGAGGTGGG - Intronic
916472731 1:165139776-165139798 AAGAAAAAAGAAAAGGAGGTGGG + Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
918380893 1:183954044-183954066 AACAGTATTCAGAAGGAGCTTGG - Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
921677613 1:217993715-217993737 AAAAAAAAAGAGGAGGAGGTGGG + Intergenic
921762383 1:218930933-218930955 AACAACAATGAGTAGGAAATAGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
923120474 1:230985582-230985604 GACAATACTTGGAAGGAGGTAGG - Intronic
923259546 1:232255039-232255061 AACATTAATCCAAAGGAGGTTGG - Intergenic
923467151 1:234259362-234259384 AACAATAATAAGAAAGAAATAGG + Intronic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
923917658 1:238527483-238527505 ATCAATAATGACAATGTGGTGGG - Intergenic
1063298527 10:4830753-4830775 TACCACAATGAGAGGGAGGTTGG + Exonic
1063312383 10:4965992-4966014 TACAATAATGAGGAGCAGGTTGG + Exonic
1063315551 10:5001581-5001603 TACAATAATGAGGAGCAGGTTGG - Exonic
1063325458 10:5096488-5096510 TACAATAATGAGGAGCAGGTTGG + Exonic
1063328642 10:5132669-5132691 TACAATAATGAGGAGCAGGTTGG - Intronic
1063331354 10:5162920-5162942 TACCAAAATGAGGAGGAGGTTGG - Intergenic
1063334720 10:5200259-5200281 TACAATAATGAGGAGCAGGTTGG + Exonic
1064616996 10:17169071-17169093 AGCAATACTGTGAAGGAAGTGGG + Intronic
1065186041 10:23172289-23172311 ATCGAAAATGAGATGGAGGTCGG + Intergenic
1065321864 10:24517564-24517586 AACAAAAAGGAGAACGAGGAGGG - Intronic
1066105180 10:32150023-32150045 AACAATAATGAGCAGGACCAAGG - Intergenic
1066395990 10:35022208-35022230 AACAATAAAGAGAAGGAAACAGG + Intronic
1066426535 10:35312461-35312483 CACCATAGTGAGAAGGATGTAGG - Intronic
1067327095 10:45279848-45279870 GAAAATAATGAGCAGGAGGAAGG + Intergenic
1067515113 10:46933120-46933142 AATAATAATGACAAGGAGGGCGG - Intronic
1067647143 10:48118690-48118712 AATAATAATGACAAGGAGGGCGG + Intergenic
1067679763 10:48424952-48424974 AACATTAACAAAAAGGAGGTAGG - Intronic
1068837828 10:61573624-61573646 AAAAATAATGAAAAGGTGGGGGG + Intergenic
1069208676 10:65728004-65728026 AACAACAATGAGAAGGGAGAAGG + Intergenic
1070168598 10:73915816-73915838 TACAAAACTGAGAAGGAGGCTGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070841259 10:79489583-79489605 AAGAATACTGAGAAGGGGGAAGG - Intergenic
1070873873 10:79783356-79783378 TAAAATAATGAAGAGGAGGTGGG - Intergenic
1071489426 10:86126096-86126118 AACAAAAGTAAGAAGGATGTTGG + Intronic
1071640805 10:87305495-87305517 TAAAATAATGAAGAGGAGGTGGG - Intergenic
1071654431 10:87432441-87432463 TAAAATAATGAAGAGGAGGTGGG + Intergenic
1071939870 10:90577390-90577412 AGCAATAAAGAAAAGTAGGTGGG - Intergenic
1073463303 10:103678836-103678858 AACAATAAGGAAAAGGTGGGAGG + Intronic
1073833554 10:107414934-107414956 AAGAAGAAAGAGAAGGAAGTTGG + Intergenic
1074255198 10:111794995-111795017 AACAGTAGTGAAAAGGAGGAGGG + Intergenic
1074522523 10:114238482-114238504 AAGAATAATGGGAAGGAGCATGG + Intergenic
1074850188 10:117433164-117433186 AACAAGATTGATAGGGAGGTTGG + Intergenic
1075084285 10:119403929-119403951 AACAAAAAATAGAAGCAGGTTGG - Intronic
1076193373 10:128498409-128498431 AACAGTAATGTGAATGAGTTGGG + Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078451400 11:11443527-11443549 ACCAATAAGGAGAAAGAGGGTGG + Intronic
1078488674 11:11748710-11748732 ATCAATATTGGCAAGGAGGTGGG + Intergenic
1078597375 11:12699275-12699297 AAGAGTAATGAGAAATAGGTAGG - Intronic
1079417920 11:20257367-20257389 GACAAAAATGAAGAGGAGGTGGG + Intergenic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1081138758 11:39471838-39471860 ACAAATTATGAGAAGGAGATGGG - Intergenic
1081178677 11:39960130-39960152 ATCACTAATGAGAGGGAAGTAGG + Intergenic
1083868727 11:65473503-65473525 AACAATAAAAAGAGTGAGGTAGG + Intergenic
1084763495 11:71290947-71290969 ATCAATAATGAGAAGAATTTTGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086740886 11:90367472-90367494 ACCAGTAATGAGAGGGAGATTGG + Intergenic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087808882 11:102588503-102588525 AATAATAATATGAAGGAAGTAGG - Intronic
1088224079 11:107599877-107599899 AACAACAATGAAAAGGAATTTGG - Intronic
1088254840 11:107893703-107893725 AAGAATAATGAAAAGGGGCTGGG + Intronic
1088720371 11:112586958-112586980 AACAACCCTGAGAGGGAGGTAGG + Intergenic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092669131 12:10842687-10842709 AACAAAAATGACAAAGATGTTGG - Intronic
1093422304 12:18988464-18988486 AACAATAATTAAAAAAAGGTGGG - Intergenic
1093773900 12:23049920-23049942 AACAAAAATGAGAAGGAAGGGGG + Intergenic
1093938450 12:25026466-25026488 AAGGATAATGAAAAGGTGGTCGG + Intronic
1093954526 12:25201170-25201192 AGCAAAAATGGGAAGGAGGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095524801 12:43112616-43112638 ACCAATAATGCAAAGGAGGAGGG - Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1097691011 12:62734739-62734761 TTCAATAAAGAGCAGGAGGTGGG + Intronic
1097724358 12:63058028-63058050 AACAATAAAAAGAAGAAGATAGG - Intergenic
1097861051 12:64519078-64519100 GACAATAATACGAGGGAGGTGGG - Intergenic
1098029983 12:66243529-66243551 ATGGATATTGAGAAGGAGGTGGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099194931 12:79604421-79604443 AACTATCATGAGAATGAGATTGG + Intronic
1100344999 12:93720732-93720754 AACAATAATCAAAAGCAAGTGGG - Intronic
1101401005 12:104386672-104386694 ACCAATCATCAGAAGGGGGTGGG - Intergenic
1101432934 12:104641751-104641773 AGCAAACATGAGAAGGAGGATGG + Intronic
1102369763 12:112372727-112372749 AATAATAATAAGATGGATGTGGG - Intronic
1102641983 12:114374863-114374885 ATCAATAAAAAGAAGGAGGGAGG + Intronic
1102688303 12:114741186-114741208 AATAATAATGAGGTGGAGGAAGG - Intergenic
1102816020 12:115867244-115867266 AAAAATAATGAGTAGGAACTTGG + Intergenic
1105309740 13:19195746-19195768 AAAAATTTTCAGAAGGAGGTCGG + Intergenic
1105667115 13:22572427-22572449 AAAAATAATGAAATGGGGGTAGG + Intergenic
1105714585 13:23049910-23049932 AACAATATACAGAAAGAGGTTGG + Intergenic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1106438769 13:29746907-29746929 AACAAGAATGACAAGGAGTAGGG + Intergenic
1106933125 13:34688740-34688762 AATAATAATAAAAAGGAAGTAGG + Intergenic
1107808469 13:44176657-44176679 AACAATAGTGATGAGAAGGTAGG + Intergenic
1111166542 13:84464535-84464557 AAGAATAACTAAAAGGAGGTTGG + Intergenic
1111292312 13:86185830-86185852 AACAGCCATGAGGAGGAGGTGGG + Intergenic
1111515909 13:89330612-89330634 AGCAAGAGAGAGAAGGAGGTGGG + Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112563106 13:100531198-100531220 GACAATTATCAGATGGAGGTGGG + Exonic
1113112339 13:106837038-106837060 AAGAGGAATGAGAAGAAGGTTGG + Intergenic
1113495336 13:110723835-110723857 ACCGCTAATGGGAAGGAGGTGGG + Intergenic
1114492950 14:23114560-23114582 AAAAATTTTGAGAAGGAGGCAGG - Intergenic
1115097239 14:29651609-29651631 AATAATAATGAGAAGGAGAGAGG - Intronic
1115439325 14:33413905-33413927 AGCAACAATGGGAAAGAGGTTGG - Intronic
1116445273 14:45001942-45001964 AACAATTATTAGATAGAGGTAGG + Intronic
1117094110 14:52280436-52280458 AACCAAAATGAGATGCAGGTTGG - Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1118467737 14:66046022-66046044 AACAGTTATGAAAAGGAGGAGGG - Intergenic
1118541443 14:66831723-66831745 AACAATTTTGAGATGTAGGTAGG - Intronic
1118559045 14:67057686-67057708 AACAAGAAAGAGAAAGAGGAAGG - Intronic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119230596 14:72976399-72976421 AACCATTATGCCAAGGAGGTGGG + Intronic
1119253685 14:73179806-73179828 AAAAGTAATGAGAGGTAGGTGGG - Intronic
1119530098 14:75353973-75353995 GACAAAATTGGGAAGGAGGTGGG - Intergenic
1119965872 14:78914897-78914919 AGCAATAAGGGGAAGGAGGGGGG + Intronic
1120266778 14:82260809-82260831 AAAAATAATGAGAAGGAAAGAGG + Intergenic
1120551016 14:85873239-85873261 AACACTAATGAAAAGTAGGCGGG - Intergenic
1120870098 14:89329292-89329314 AATAATAATGAAAAAGAGCTTGG - Intronic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1124460563 15:29886723-29886745 AACCATAATGAGAAATATGTAGG + Intronic
1124647805 15:31452024-31452046 AATAACAATAAAAAGGAGGTAGG - Intergenic
1125522807 15:40357659-40357681 AAAAAGAAAGAGAAGGAGCTGGG + Intergenic
1125792555 15:42379758-42379780 AACAATAATCAAAAGAAAGTTGG - Intronic
1125851144 15:42904036-42904058 AACAATCATCAGAATGAGCTTGG + Intronic
1127918235 15:63472797-63472819 AATAATGATAAGAAGAAGGTAGG + Intergenic
1128406526 15:67346083-67346105 AACAATAATGAAAAGAAAGCTGG + Intronic
1128928129 15:71677657-71677679 AACAATCAGCAGAAGGGGGTGGG - Intronic
1129501448 15:76042011-76042033 ATCAATAATGAGAGGGACTTTGG + Intronic
1129859427 15:78848754-78848776 AACAAAAATGGGAAGGAGCCAGG - Intronic
1131615886 15:94017114-94017136 AACTATAAAGAGAAAGATGTGGG + Intergenic
1131646469 15:94350224-94350246 AACCATAAGGTGATGGAGGTAGG + Intronic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131972075 15:97903293-97903315 AACAATAATGTGGAGCAGGAAGG - Intergenic
1132054745 15:98641841-98641863 AACAAGATTGAGAAGATGGTAGG - Intergenic
1132797351 16:1731700-1731722 TACAAAAACGAAAAGGAGGTTGG - Intronic
1134392261 16:13830837-13830859 AAAAAAAAAAAGAAGGAGGTTGG - Intergenic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135481995 16:22828341-22828363 AACAAGAATGAGCAGCAGGGTGG - Intronic
1135508315 16:23058760-23058782 AACAATAGTGATGAGGAGGAGGG - Intergenic
1135861651 16:26061488-26061510 AACAATTATGATCAGGAGGTGGG + Intronic
1135872824 16:26166730-26166752 TACAATACTGAAAAGGGGGTGGG - Intergenic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1138869187 16:60860572-60860594 AAAAATAGTGAGCAGGAGCTAGG + Intergenic
1139279596 16:65759052-65759074 AACAATATTGAAAGGGAGGCTGG + Intergenic
1139699127 16:68696427-68696449 AACAAAAATGATTAGGAGGCTGG + Intronic
1140558781 16:75953204-75953226 AAGTATACTGAGAAGGAGCTAGG + Intergenic
1140823332 16:78683213-78683235 AAAAATAGAGACAAGGAGGTGGG + Intronic
1141209632 16:81965342-81965364 AATAATAATGAAAATGAGGCTGG + Intergenic
1141540627 16:84718024-84718046 AACAATGATGAGAGAGAGATTGG + Intronic
1143298565 17:5890932-5890954 AACCAAAATGAGTAGGAAGTGGG - Intronic
1143336070 17:6172450-6172472 AAAAAGAATGAGAATGAGATAGG - Intergenic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1144431130 17:15192567-15192589 AAGAGAAATGAGAAGAAGGTGGG - Intergenic
1145710259 17:26964810-26964832 AACAAAAATGGCAAGCAGGTAGG - Intergenic
1145832862 17:27931270-27931292 AAGAATGCTGAGAATGAGGTTGG - Intergenic
1146967295 17:37043354-37043376 AACAACAGTGAGACGGGGGTGGG - Intronic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148955115 17:51347308-51347330 AAAAATGATGAGAAGGAGAGAGG - Intergenic
1150052678 17:61980258-61980280 AAGGAAATTGAGAAGGAGGTTGG - Intronic
1150553136 17:66229231-66229253 ATCAATAATGATAAGTAGGCCGG - Intronic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1153847365 18:9062089-9062111 CAGAATAATGAGAAGTATGTGGG - Intergenic
1154473101 18:14723778-14723800 AATAATAATAATAAGGAGCTGGG - Intergenic
1154943244 18:21135563-21135585 AACAATAATCAAAAGGAATTTGG + Intergenic
1155535546 18:26812737-26812759 AACAATGAGAAGAGGGAGGTGGG + Intergenic
1155830014 18:30503625-30503647 AACAATAACAAGAAGAAAGTTGG - Intergenic
1156939617 18:42750920-42750942 AATTCTAATAAGAAGGAGGTAGG + Intronic
1157558969 18:48632792-48632814 AACAGCAATGAGAGGGGGGTGGG - Intronic
1157636793 18:49165095-49165117 AACATTAATCATAAGGAAGTTGG + Intronic
1158437677 18:57444860-57444882 AACAAAAATGGGAAGGGGGGTGG + Intronic
1158642891 18:59219023-59219045 AACAATAAATAGAAGCTGGTAGG - Intergenic
1158841583 18:61393965-61393987 AAAATTAATGAGAAGGAGAGTGG - Intronic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1163939883 19:20481802-20481824 AACAATATTGGAAAGGAGGTGGG + Intergenic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1164987374 19:32658364-32658386 AACAGGAATGAGAAGCAGGCAGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166278630 19:41774404-41774426 AAGTGTAATGAGAAGGAAGTAGG + Intergenic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166767183 19:45258706-45258728 AAAAAAAAAGACAAGGAGGTTGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167193836 19:48012981-48013003 AACAAAAAAGAGAGGGGGGTGGG - Intronic
1167507242 19:49877380-49877402 TACAATATGGAGAAGGAAGTGGG + Exonic
1168449338 19:56451958-56451980 ATCAATAATGAGAAGAACTTTGG + Intronic
926562571 2:14434233-14434255 AAAAATACTGAGAAGAAGGAAGG + Intergenic
927611144 2:24542005-24542027 AATAATAATGAAAAGTAGATTGG + Intronic
928068249 2:28188420-28188442 AACTATACTGAGAAGGGGATAGG + Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
928903539 2:36347178-36347200 AACAATAATGATAAGGAATATGG + Intergenic
928966456 2:36980030-36980052 AACAAAAATGAAAAGAAGCTGGG + Intronic
930289480 2:49475581-49475603 AACAATAAGCAAAAGGAGTTTGG + Intergenic
930546462 2:52773513-52773535 AACCATTATGAAAAGGAGTTTGG + Intergenic
930881992 2:56280701-56280723 AAAAACAATGAGGTGGAGGTGGG + Intronic
931424432 2:62157972-62157994 AGCAATAGTGAGATGGAGATCGG - Intergenic
931527455 2:63172519-63172541 AAAAATAATAATAAAGAGGTAGG + Intronic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
931942036 2:67262741-67262763 AACAATAATAATAAAGAGGGTGG - Intergenic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933151128 2:78916528-78916550 AACTAGAATGAGCAGAAGGTGGG + Intergenic
933367372 2:81370621-81370643 TACAATCATGAGAATGAGGATGG - Intergenic
933422046 2:82061314-82061336 AACAAAAATCTGAAGCAGGTAGG + Intergenic
936676615 2:114723042-114723064 CACATTCATGAGATGGAGGTGGG + Intronic
936995042 2:118404558-118404580 GACATTAACGAGGAGGAGGTGGG + Intergenic
937392317 2:121500260-121500282 AACACGAAGGAGGAGGAGGTGGG + Intronic
937608669 2:123833894-123833916 AATAATTATGAGAAGGGGATTGG + Intergenic
937777855 2:125801922-125801944 AACATAAAGGAGAAGGTGGTGGG + Intergenic
938929845 2:136076992-136077014 AGAGATAATGAGAAGGAGGGTGG + Intergenic
939803697 2:146745750-146745772 CTCAATAATGAGAAAGAGTTTGG + Intergenic
940020428 2:149150948-149150970 AAGAATAATGAGAATAGGGTAGG - Intronic
940654038 2:156466951-156466973 ACCAACAGTGAGAACGAGGTTGG - Intronic
941384331 2:164834694-164834716 AACTATAATGTGAAAGCGGTTGG + Intronic
941686025 2:168449762-168449784 TACAATATTGAGTGGGAGGTGGG - Intergenic
943064064 2:183069020-183069042 GACAATCATGGGAAGGAGGTTGG + Intergenic
943181857 2:184554545-184554567 GACATCAATGTGAAGGAGGTAGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943647128 2:190418457-190418479 ACCAAGAATGACAAGGTGGTTGG + Intronic
944187312 2:196963374-196963396 AATATTAAGGAGAGGGAGGTAGG + Intergenic
944306997 2:198189826-198189848 GATAATAATGAGAAGGATGATGG + Intronic
945314292 2:208354785-208354807 AACAATAATGAGAATTATATAGG + Intronic
945559216 2:211317440-211317462 AACAAAAAAAAGAAGGAGATGGG - Intergenic
945864098 2:215157619-215157641 AACAATATTGAGAAGCAATTTGG - Intergenic
947067488 2:226244989-226245011 AACACTAATGAAAAGAAAGTTGG - Intergenic
947103336 2:226644851-226644873 AACATAAAAGGGAAGGAGGTTGG + Intergenic
947991213 2:234489084-234489106 AACAATACTGAGAGGTAGGCAGG + Intergenic
948132486 2:235610855-235610877 GACAAGAATGAGAAGGCTGTGGG - Intronic
948617894 2:239213163-239213185 GACAAGAATGAGGAGGAGGAGGG + Intronic
1170227488 20:14007910-14007932 AATAATAATGAGGATGAGTTAGG + Intronic
1170896098 20:20415891-20415913 AACAATAATGAGAGTAAAGTTGG - Intronic
1172726965 20:37051930-37051952 AACATTAATGAAAAGAAGGCAGG + Intronic
1172862076 20:38062423-38062445 AATAAAACTGAGTAGGAGGTTGG - Intronic
1173646033 20:44633741-44633763 AACAAGACTGAGAAAGAGGTTGG + Intronic
1173660373 20:44729199-44729221 AACAAAAAGTAGATGGAGGTGGG + Intergenic
1173713045 20:45176937-45176959 AACATTAATGAGAAGGAAGTGGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174394681 20:50239655-50239677 TAGAATGATGAGAAGGAGCTGGG + Intergenic
1174409463 20:50324669-50324691 AACACTGATGGGAAGAAGGTGGG - Intergenic
1174824916 20:53760268-53760290 AATAAGAAAGAGAAGAAGGTAGG + Intergenic
1174828572 20:53791752-53791774 AATAATAATGAAAATGAAGTTGG - Intergenic
1175068859 20:56315086-56315108 AACAATAATGAGACATAGGCAGG + Intergenic
1175606105 20:60313625-60313647 AATAATAATGAGAAGGAACCAGG + Intergenic
1176801380 21:13434071-13434093 AATAATAATAATAAGGAGCTGGG + Intergenic
1177079834 21:16625144-16625166 AATAAATATGAGATGGAGGTAGG - Intergenic
1177285590 21:19044660-19044682 AGCAAGATTAAGAAGGAGGTAGG + Intergenic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1180371251 22:12039292-12039314 AATAAAAATAAGAAGGAGGTTGG + Intergenic
1182912504 22:33996860-33996882 AACAAAAATAAGAAGCAGGCTGG - Intergenic
1183426136 22:37740416-37740438 AACAATGGTGAGAAGGTGGGGGG + Intronic
1183438051 22:37806697-37806719 AACAAAAATGAGAAGGAAACTGG - Exonic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
1184098190 22:42327961-42327983 AGCTATGATGGGAAGGAGGTAGG - Intronic
949335131 3:2966465-2966487 AACAATTACCAGAAGGAGGGAGG + Intronic
949706186 3:6820134-6820156 AACACTAAGGAAAATGAGGTGGG - Intronic
949786361 3:7746088-7746110 ACCAATAAAGAGAAGGTGGAGGG + Intergenic
951080932 3:18449103-18449125 AAGAATCATGACAAGAAGGTCGG + Intergenic
951974221 3:28485706-28485728 AACCCTAATGAAAAGGAAGTAGG - Intronic
952145596 3:30528546-30528568 AAGAATTCTGAGAAGGAGATAGG - Intergenic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
954843196 3:53531146-53531168 TACAAAAATGAGGAGGAGGCTGG - Intronic
954853554 3:53623890-53623912 ATCAATAAGTAGAAGGAGATTGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955678032 3:61469847-61469869 AGTGATAATGAGGAGGAGGTGGG - Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956475769 3:69618718-69618740 GACAACAATGTGAGGGAGGTTGG - Intergenic
956677007 3:71744833-71744855 AACAAGAAAGAGAAAGATGTGGG + Intronic
956823814 3:72978353-72978375 AAGAATACTGGGAAGAAGGTGGG + Intronic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957749502 3:84394972-84394994 AACATTAAGAAGAAAGAGGTGGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
959090289 3:101895359-101895381 AACAGTGTTGAGAGGGAGGTAGG + Intergenic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960585060 3:119313536-119313558 AACTATAATTAGAAGTATGTGGG - Intronic
960647351 3:119902330-119902352 AGCAATAATAGGAAGGAGGGAGG + Intronic
962130236 3:132665067-132665089 AACAATATTGGGAAGTTGGTGGG + Intronic
962336587 3:134537286-134537308 TAAAATAATGAGAAGCAGATAGG + Intronic
962959847 3:140300616-140300638 AAGAATAATAAGTAGGAGCTAGG + Intronic
963388755 3:144631115-144631137 GATAATATTGAGAAGAAGGTAGG - Intergenic
963750898 3:149178804-149178826 AACAATGGTGAGTAGTAGGTAGG + Intronic
963837470 3:150071559-150071581 ACCAATAATGAGCAGGGGGGCGG + Intergenic
964676972 3:159294112-159294134 CACAAACATGATAAGGAGGTTGG + Intronic
964745923 3:160012433-160012455 AGCAAAAATGATGAGGAGGTTGG - Intergenic
965764526 3:172115937-172115959 AACAGAAATCAGAAGGAGGAGGG - Intronic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
967131959 3:186478732-186478754 AACAAAAATGTGGAGGAGGTGGG - Intergenic
967865139 3:194183902-194183924 ACCAAGCAGGAGAAGGAGGTGGG + Intergenic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
969063059 4:4454564-4454586 GACATTACGGAGAAGGAGGTAGG - Intronic
969630580 4:8333505-8333527 AACAATAATGAGATGCGGTTTGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970760926 4:19485452-19485474 AACAATGATGATAACAAGGTAGG + Intergenic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
972910164 4:43805785-43805807 CACAACAATGTGAAAGAGGTTGG - Intergenic
974517898 4:62940772-62940794 AACAATATTGGGAAGGAGGAGGG - Intergenic
974666037 4:64962842-64962864 AGCAATAATCAGAAAGTGGTTGG - Intergenic
974869710 4:67625665-67625687 AACAATAATTAGAAGGATCTTGG - Intronic
974938084 4:68431627-68431649 AAAAAAAAAAAGAAGGAGGTGGG + Intergenic
975598574 4:76075236-76075258 AACAAGAATAAGAAGGAACTGGG - Intronic
976691054 4:87867586-87867608 GGCAATAATGAAAAGAAGGTTGG - Intergenic
978336179 4:107672063-107672085 AATAAAAATGAGATGGAGGTGGG + Intronic
978532423 4:109729021-109729043 ACCAACAATGAGGAGGAGGCGGG + Intronic
978872307 4:113594125-113594147 AACAAGAGAGAGAAGGAGGAAGG + Intronic
978944630 4:114480750-114480772 AACAATTATTTGTAGGAGGTGGG + Intergenic
979124242 4:116947338-116947360 AACAATAATAATAAGGCAGTTGG - Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
979799596 4:124892202-124892224 AACAAGAATGAGAGAGAGATGGG - Intergenic
980093070 4:128462372-128462394 TACAATGATGTGCAGGAGGTGGG + Intergenic
980697153 4:136373455-136373477 AACAATTTTGAAAAAGAGGTTGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981092269 4:140744107-140744129 AATAATAATGGGATGGAGGTGGG + Intronic
981363903 4:143879005-143879027 AAAAATAATGAGAAGAAAGGAGG + Intronic
981374631 4:143999780-143999802 AAAAATAATGAGAAGAAAGGAGG + Intronic
982471174 4:155791853-155791875 AACCAGACTGAGAAAGAGGTAGG + Intronic
982578003 4:157141665-157141687 AACATTTATGAGAGGCAGGTGGG - Intronic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983818100 4:172157366-172157388 GAAAATAATTAGAAAGAGGTAGG - Intronic
986052579 5:4104047-4104069 AAGAATAATGTGAGGGAGTTGGG - Intergenic
986398136 5:7351074-7351096 AACAATTGAGAGAAGGAGGGAGG - Intergenic
986854925 5:11857376-11857398 AACAAAAATGACAATGAGGCTGG + Intronic
987764076 5:22202350-22202372 AACAATAAGGAGAAAGAGATAGG + Intronic
988041843 5:25899842-25899864 AACAAATATGAGATAGAGGTTGG + Intergenic
988650521 5:33144312-33144334 AACAGTATAGAGGAGGAGGTAGG + Intergenic
988799107 5:34679698-34679720 AGCAGTAATGAGAAGGAAGGGGG + Intronic
988848078 5:35150229-35150251 AAGAATAAAGAGAAAGAAGTGGG - Intronic
989198343 5:38737880-38737902 AACAATAGTGAGAAAGGGATAGG - Intergenic
990411293 5:55543724-55543746 AACAACAACAAAAAGGAGGTGGG - Intergenic
990686360 5:58306117-58306139 AACAAAAATGAGAAGGTTATTGG - Intergenic
991043042 5:62195045-62195067 GGCAGTAATGAGAAGGAAGTGGG + Intergenic
991644315 5:68786427-68786449 AACATTTATGATAAGGAGGGGGG + Intergenic
991898803 5:71435434-71435456 AACAATAAGGAGAAAGAGATAGG + Intergenic
992446323 5:76837498-76837520 AAAAATAATGAGAAACAGGCAGG - Intergenic
992560095 5:77942981-77943003 AACTATAATGAGCAGGAGCTCGG + Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994259880 5:97644789-97644811 AACAATTTTGGGAAAGAGGTAGG + Intergenic
994569311 5:101494226-101494248 AACAAAACTGACAAGGAAGTAGG + Intergenic
994839222 5:104900279-104900301 AACAAAATTGGGCAGGAGGTGGG - Intergenic
996038954 5:118789134-118789156 TACCATAAGGAGAAGGATGTGGG + Intergenic
998036009 5:138916681-138916703 AACAATAAAGAAAATGAGCTGGG - Intronic
998080332 5:139269930-139269952 AACAACAATGAAAAGCATGTGGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999481965 5:151956832-151956854 AAAAATAATAGGTAGGAGGTGGG + Intergenic
1000725754 5:164768832-164768854 AAAAATAGTGAGGAAGAGGTTGG + Intergenic
1001186127 5:169574601-169574623 AAAAAAAATGTGAAGGGGGTTGG + Intergenic
1001204269 5:169747283-169747305 AACAAAAAGGAGTGGGAGGTGGG - Intronic
1001216935 5:169865169-169865191 AACAACAACGAAAAAGAGGTTGG - Intronic
1001290495 5:170454664-170454686 AAGAAAAATGAGTAGGAAGTTGG + Intronic
1001299175 5:170521734-170521756 AACCATAATCTCAAGGAGGTAGG + Intronic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1004528386 6:16430292-16430314 AACAACAATGAAAAGAAGGCAGG + Intronic
1004727994 6:18329365-18329387 AAAAATAATGAGCATGAGGCAGG + Intergenic
1004798494 6:19116728-19116750 AACCAAAATTAGAAGGAGGAAGG + Intergenic
1004973217 6:20935369-20935391 AACAAAAATGAGAAGAATGAGGG - Intronic
1005437957 6:25835605-25835627 AACAAAAATAGTAAGGAGGTTGG + Intronic
1006081402 6:31569494-31569516 TAAAAGAATGAGAAGAAGGTTGG + Intergenic
1007048946 6:38806237-38806259 AAAAAGAATGAAAAGAAGGTGGG - Intronic
1007271423 6:40640436-40640458 AGAAAGAATGAGAAGGAGGGAGG - Intergenic
1007514305 6:42399218-42399240 AACAAAAATCAGAAGGAAGTAGG + Intronic
1007914021 6:45543923-45543945 AATAATCATGATAAGGTGGTGGG - Intronic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008794676 6:55288480-55288502 AACACTAATGAGAAGGTCTTTGG - Intergenic
1009050755 6:58273449-58273471 AAAACTAATGAGGAGTAGGTAGG + Intergenic
1009292915 6:61906539-61906561 AAGAATAGTGGGAAGGAGGGGGG - Intronic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1012040214 6:94194765-94194787 AGGAAGATTGAGAAGGAGGTAGG - Intergenic
1012210664 6:96514615-96514637 AACATTAATGAGAAATAAGTGGG + Intergenic
1014026708 6:116656378-116656400 AACAAAAGTGAAAAGGAGGCTGG - Intronic
1014155174 6:118101584-118101606 AAAAATAATGAGAAGTGGGATGG + Intronic
1015027898 6:128559013-128559035 AACAAGAATGAGCAGAAGGCTGG - Intergenic
1015507979 6:134008857-134008879 AACAGCCATGAGGAGGAGGTGGG + Intronic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017415104 6:154211958-154211980 AACAAACATGAGAAGGTGCTTGG + Intronic
1017646932 6:156547877-156547899 TACAATAAGAAGTAGGAGGTTGG + Intergenic
1018219781 6:161566397-161566419 AATAATAATGATAATAAGGTGGG - Intronic
1020126150 7:5533404-5533426 AATAATAATAAAAAGGAGGTTGG - Intronic
1020522472 7:9209652-9209674 AAGAATAATCAGAATGAGATAGG - Intergenic
1020673358 7:11147983-11148005 AAAAATGATGAGACTGAGGTAGG - Intronic
1021565071 7:22008760-22008782 ATCAATAAAAAGAAGGAAGTGGG + Intergenic
1021659426 7:22905037-22905059 AACAAGAGAGAGAAGGAGGGAGG + Intergenic
1022918373 7:34984921-34984943 AACAATCATGTGAATGAAGTGGG - Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023279900 7:38558571-38558593 AATAATGATGGGAAGGAGGGAGG + Intronic
1023372896 7:39529770-39529792 TTCACTAATGTGAAGGAGGTTGG + Intergenic
1024375719 7:48636125-48636147 TACAATAATGAGAAGAAAGCAGG - Intronic
1024635710 7:51288454-51288476 AACAATAATGAAAATGGGGCTGG + Intronic
1025562304 7:62382692-62382714 AAGAAAAATGGGAAGCAGGTAGG - Intergenic
1026411788 7:70130626-70130648 CAATATAATGAGATGGAGGTGGG + Intronic
1027941696 7:84690641-84690663 AAAAATAATGAAAAGGATCTGGG + Intergenic
1028057540 7:86265506-86265528 GACAATATTTAGAAGCAGGTAGG + Intergenic
1028256658 7:88607305-88607327 AACATTACTGACAAGGAGCTGGG + Intergenic
1029089303 7:98035614-98035636 AAAAAGAAAGAGAAGGGGGTTGG + Intergenic
1029787898 7:102810879-102810901 AAAATTAATGAAAAGGAGGCTGG - Intergenic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030758199 7:113316235-113316257 AACATTCTTGAGAAGGAGGTGGG + Intergenic
1031543802 7:123027876-123027898 AACAATAATAACAAGAAGGCTGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032709803 7:134451653-134451675 TACCAGAATGAGAATGAGGTGGG - Exonic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033771459 7:144557263-144557285 AATATTAATGAAAAGCAGGTAGG + Intronic
1035052864 7:156012976-156012998 AACAATAATGTAAAGGAGGTGGG - Intergenic
1037021546 8:13977427-13977449 AGAAAAAATGAGAAAGAGGTTGG + Intergenic
1037691919 8:21188628-21188650 TACAATAATTAGAAGAATGTGGG - Intergenic
1038836065 8:31125371-31125393 AACATTAATCAAAAGGAAGTTGG + Intronic
1039310136 8:36308754-36308776 GACTGTAATGAGAAGGTGGTGGG + Intergenic
1039659290 8:39445862-39445884 AGAAATCATGAGAAAGAGGTAGG + Intergenic
1040603490 8:48907743-48907765 AACAATGATGAAGAGCAGGTAGG + Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041781636 8:61583687-61583709 AACTAGAATGTGATGGAGGTAGG + Intronic
1042433334 8:68734600-68734622 TACAATAATGGCAATGAGGTGGG - Intronic
1042500354 8:69502106-69502128 AACAAGAATGAGAATGTGATGGG - Intronic
1042532958 8:69833346-69833368 AACAATAAGCAGCAGGCGGTCGG + Intronic
1043822924 8:84890810-84890832 AACAATAAATAAAAGGAGTTAGG + Intronic
1043839092 8:85080703-85080725 AACACTAATCATAAGAAGGTAGG - Intergenic
1044784035 8:95775839-95775861 AAAAATAATAATGAGGAGGTTGG + Intergenic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046797360 8:118387464-118387486 TACAATTATGAGGAGGAGGAGGG - Intronic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047629371 8:126690323-126690345 GACAATAATGATAATGAGGATGG + Intergenic
1047935932 8:129778159-129778181 AACAATAATGTAGAGGAGGCAGG + Intronic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1048994102 8:139779809-139779831 AGCAATAATTAGAAGGATGCAGG + Intronic
1050251227 9:3747015-3747037 TACAATAATGGGAATGAGGGTGG + Intergenic
1050464148 9:5903811-5903833 AACACTAATGAAAAGAAAGTAGG - Intronic
1050802127 9:9628674-9628696 AAGATTACTAAGAAGGAGGTTGG - Intronic
1050931395 9:11331273-11331295 AATAATAATCAGAAGCAGTTTGG - Intergenic
1050978933 9:11982474-11982496 AACAAACGTGAGGAGGAGGTTGG + Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051116701 9:13703126-13703148 AACACTAATGAAAAGAAAGTAGG - Intergenic
1052372178 9:27677479-27677501 AAAAATAATGAGTAGGAGATTGG - Intergenic
1052733384 9:32315585-32315607 AGCAAGAATGAGAAGGTGGGTGG + Intergenic
1053111434 9:35463577-35463599 AACAAAAATGGGAAGCAGATTGG + Intergenic
1055249575 9:74286938-74286960 AAAAATAATGAGGGGGAGGATGG - Intergenic
1055489841 9:76793718-76793740 AACAATAATGGGCAGGGTGTAGG - Intronic
1055694342 9:78867387-78867409 ATCAATAGAGAAAAGGAGGTTGG - Intergenic
1056633250 9:88310842-88310864 AACAAGTATGAAAGGGAGGTAGG - Intergenic
1056652637 9:88481105-88481127 GAAAATAATGAGAAAGAGGATGG - Intergenic
1057003230 9:91532084-91532106 AACAGCTATGAGAAGGAGATTGG + Intergenic
1057858694 9:98623072-98623094 AACAAAAATGAGAGGAAAGTAGG - Intronic
1058849290 9:108994938-108994960 AACAACCATGAGAGGGAGGCTGG + Intronic
1059649064 9:116297795-116297817 AACAATGATGATAATGAGGTTGG - Intronic
1059738521 9:117126908-117126930 AAGAATAATGAAAGTGAGGTTGG + Intronic
1059913730 9:119075764-119075786 AAAAAAAAAGAGCAGGAGGTGGG - Intergenic
1059918316 9:119129117-119129139 AATAAGAATGAGGAGGAGGAGGG + Intergenic
1060364673 9:122998909-122998931 AATAAAAATGACAAGTAGGTGGG - Intronic
1060707301 9:125815848-125815870 ATCTACAATGAGAAGGAGGTAGG - Intronic
1060975879 9:127764682-127764704 AACAACAAAGAGCAGGAGGGAGG - Intronic
1061209894 9:129185056-129185078 AACAGGAATGAAAAGGAGCTTGG - Intergenic
1061764229 9:132871318-132871340 AGCAAAAATGGGAAGGAGGAAGG - Intronic
1062307211 9:135914755-135914777 CACGATCATGAGAGGGAGGTAGG + Intergenic
1202629276 M:3317-3339 TACAATGAGGAGTAGGAGGTTGG - Intergenic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1187264589 X:17719162-17719184 AGGAATAATGAGAAGGAAGGAGG + Intronic
1187477763 X:19627034-19627056 AACAATGAAGACAGGGAGGTTGG + Intronic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1189844834 X:45125878-45125900 AACAATAATGAGTAGAAATTTGG - Intergenic
1190061863 X:47216806-47216828 TAAAATGATCAGAAGGAGGTGGG - Intergenic
1191667457 X:63718073-63718095 AACAATACTCAGAAGTGGGTTGG - Intronic
1192202941 X:69078425-69078447 AAGAAAGAAGAGAAGGAGGTGGG - Intergenic
1192372500 X:70526121-70526143 AACCAAAATGAGTAGGAGATTGG + Intergenic
1193209155 X:78785515-78785537 ATCAATTATGAGAAGGTGGCGGG + Intergenic
1193367958 X:80657680-80657702 AATAATGATGAGAACAAGGTGGG + Intergenic
1193578034 X:83227991-83228013 AAAAATAATAAGAAGAAGGAGGG - Intergenic
1195263622 X:103158936-103158958 TACAATAATGGGCAGAAGGTGGG - Intergenic
1195701115 X:107706543-107706565 AACTAGAATGGGAGGGAGGTGGG - Intergenic
1195797205 X:108663888-108663910 AACAATATTGAAAACGAGGCCGG + Intronic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1197641414 X:128972307-128972329 AACAAAATTGAGAAGATGGTTGG + Intergenic
1198006495 X:132499852-132499874 AGCCATTATGAGAAGGAGGCAGG + Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198721317 X:139624087-139624109 ATCAACAATAAGAGGGAGGTAGG + Intronic
1198737356 X:139801399-139801421 AAAAGTGATGAGAAGGAGGGAGG + Intronic
1198840109 X:140847299-140847321 ACCAGTAATGAGTAAGAGGTGGG - Intergenic
1198910750 X:141611184-141611206 AATAATAATAATAAGGAGGTAGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200836255 Y:7734661-7734683 AGCAGAAATGAGAAGAAGGTGGG - Intergenic
1201171978 Y:11275858-11275880 AAAAAAAAAAAGAAGGAGGTTGG + Intergenic
1201432756 Y:13921912-13921934 TAAAATAATGTGAAGGAAGTTGG - Intergenic
1201461748 Y:14233042-14233064 AAGAAGAATGAGGAGGAGGAGGG - Intergenic
1201586838 Y:15570282-15570304 AACAATGATGAGATGGAGCAAGG - Intergenic