ID: 1017227809

View in Genome Browser
Species Human (GRCh38)
Location 6:152041120-152041142
Sequence AGTTATCTGCAGGAGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017227804_1017227809 22 Left 1017227804 6:152041075-152041097 CCAAAGCACAGTAACAGGCCAAG 0: 1
1: 179
2: 172
3: 114
4: 283
Right 1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG No data
1017227806_1017227809 4 Left 1017227806 6:152041093-152041115 CCAAGAGTTGTCTCTCACAAGGA 0: 1
1: 17
2: 205
3: 208
4: 288
Right 1017227809 6:152041120-152041142 AGTTATCTGCAGGAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017227809 Original CRISPR AGTTATCTGCAGGAGATGCA GGG Intronic
No off target data available for this crispr