ID: 1017229081

View in Genome Browser
Species Human (GRCh38)
Location 6:152052798-152052820
Sequence GACAGCACGGGCAAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017229068_1017229081 29 Left 1017229068 6:152052746-152052768 CCTCCAAAGGCAGGATGGGGGTG 0: 1
1: 0
2: 1
3: 26
4: 269
Right 1017229081 6:152052798-152052820 GACAGCACGGGCAAGTGTTCTGG No data
1017229069_1017229081 26 Left 1017229069 6:152052749-152052771 CCAAAGGCAGGATGGGGGTGAGG 0: 1
1: 0
2: 2
3: 45
4: 450
Right 1017229081 6:152052798-152052820 GACAGCACGGGCAAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017229081 Original CRISPR GACAGCACGGGCAAGTGTTC TGG Intronic
No off target data available for this crispr