ID: 1017235154

View in Genome Browser
Species Human (GRCh38)
Location 6:152111153-152111175
Sequence TGTGGGCTGTGGTCCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017235154_1017235159 17 Left 1017235154 6:152111153-152111175 CCAGGAAGGGACCACAGCCCACA 0: 1
1: 0
2: 4
3: 20
4: 245
Right 1017235159 6:152111193-152111215 CTATGTAGAACTGACAAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1017235154_1017235156 -9 Left 1017235154 6:152111153-152111175 CCAGGAAGGGACCACAGCCCACA 0: 1
1: 0
2: 4
3: 20
4: 245
Right 1017235156 6:152111167-152111189 CAGCCCACAGTGAAAGCACTTGG 0: 1
1: 0
2: 2
3: 32
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017235154 Original CRISPR TGTGGGCTGTGGTCCCTTCC TGG (reversed) Intronic
900807029 1:4774272-4774294 TGTGGGGGGTGGTCCCTTCCTGG + Intronic
900997608 1:6130830-6130852 TGGGGGCTGTGGTCAGTCCCAGG - Intronic
901049263 1:6418362-6418384 TAAGGGCTCTGGTCACTTCCAGG - Exonic
901188658 1:7390632-7390654 TGTAGGGTGGGGTCCCTTCCAGG - Intronic
902724476 1:18325697-18325719 GGTGGGGTGGGGTCCCTTACAGG - Intronic
904268913 1:29335760-29335782 TGTGTACTGTTGGCCCTTCCAGG - Intergenic
906436401 1:45800542-45800564 TGTGGGCTGTGTTCCCATCTGGG + Intronic
906747293 1:48231074-48231096 GGTGGGTTGTGGTCTCTGCCTGG - Intronic
912979044 1:114354076-114354098 TGAGGCCTGTGATCCCTACCTGG - Intergenic
914240611 1:145850337-145850359 TGTGGACTGTGGCCCCTTGCAGG + Intronic
914355667 1:146882206-146882228 TGTGGGCCAAGGTCACTTCCTGG - Intergenic
914698724 1:150110595-150110617 TGTGCACTGTGGTGCCTCCCAGG - Exonic
914867830 1:151447475-151447497 TGTGAGATGTGGTCTCATCCAGG + Intronic
917740916 1:177961372-177961394 TAGGGGCAGTGTTCCCTTCCAGG + Intronic
918211797 1:182357948-182357970 TGAGGGCTGTGGCTCCTTCTGGG - Intergenic
919791056 1:201291285-201291307 TGTGGCCTGCAGGCCCTTCCAGG - Intronic
920434505 1:205939410-205939432 TGAGGGCTCTGGTTCCCTCCTGG + Intronic
922785822 1:228281803-228281825 TGTGGGCTCTGATCCCTCCTAGG + Intronic
922823505 1:228501362-228501384 TCTGGGCTGTGCTACCTTCCGGG + Intergenic
923052511 1:230398717-230398739 TGTGGGGTGGGGTCACTGCCAGG - Intronic
923440657 1:234016924-234016946 TGTGGGCTCTGGAGTCTTCCTGG + Intronic
1064450785 10:15440473-15440495 GTGGGGCTGTGGTCCCATCCTGG - Intergenic
1067068221 10:43115371-43115393 TGTGGGATATGGCCCCTCCCAGG - Intronic
1067427955 10:46223597-46223619 TGTGGGTTGTGGACCCGTCATGG - Intergenic
1067720772 10:48726091-48726113 TGTGGGCTGTGGGCCATGCAAGG + Intronic
1067778974 10:49185022-49185044 GGTTGGCTGTGCTTCCTTCCTGG - Intronic
1068680786 10:59817816-59817838 TGATGCCTGTGGTCCCTTTCTGG + Intronic
1069577909 10:69543922-69543944 TGAGGGCTTTGTTCCTTTCCTGG - Intergenic
1071070557 10:81687592-81687614 TGTGGGCTGTGAGCCTTTCGAGG + Intergenic
1072685602 10:97534826-97534848 TGTGGGCTGGAGTCTCTGCCAGG - Intronic
1075104447 10:119529088-119529110 TATGGCATGTGATCCCTTCCTGG + Intronic
1075699374 10:124459165-124459187 TGGGAGCTGTTGTCCCATCCAGG + Intergenic
1076514274 10:131034373-131034395 TGTGTGCTGTGCTCCCTACGTGG - Intergenic
1076857639 10:133124992-133125014 TGTGTGCTGTGGGTCCATCCTGG + Intronic
1076991926 11:279959-279981 CGTGGGCTGTGGTCCCGTAGAGG + Intronic
1077118805 11:897490-897512 CGTGGGCAGTGGACCCTGCCGGG - Intronic
1077370813 11:2180827-2180849 TGTGGGGTCCGGTCCCCTCCTGG + Intergenic
1077433114 11:2525874-2525896 TGTGGGCTGCAGTCCATGCCCGG - Intronic
1077499963 11:2904873-2904895 GGTGGGGTGTGGTCCCATTCTGG - Intronic
1079097575 11:17520747-17520769 TCTGGGCTGTGGTTCCTTCATGG - Intronic
1079366469 11:19814362-19814384 AGAGGGCAGTGGGCCCTTCCCGG - Intronic
1080900267 11:36483232-36483254 TGTGGGCTGTGGTTTCTGCCCGG - Intergenic
1082924196 11:58528616-58528638 TGTGGGCTGTCTCCCCTTACAGG + Intronic
1084269311 11:68020681-68020703 TGGGCTCTGTGGTTCCTTCCAGG - Intronic
1084617178 11:70244285-70244307 TGAGGGCTGTGTTAGCTTCCTGG + Intergenic
1084992564 11:72941199-72941221 TGTGGCCTCTGGTCCCTTGAAGG - Intronic
1085182041 11:74544075-74544097 TCTGGGCACTTGTCCCTTCCTGG + Intronic
1085350930 11:75797539-75797561 TGTGGCCTGTGGGCCCTTGCAGG + Intronic
1087198622 11:95323047-95323069 GGAGGGATGTGGTTCCTTCCTGG + Intergenic
1089010728 11:115129616-115129638 CGTGGGCTGTAGTCACCTCCAGG + Intergenic
1089948758 11:122505952-122505974 TGTGGGCAGTGGTTGCCTCCTGG - Intergenic
1090240449 11:125177746-125177768 TGTGGGCTGTGGGCCTCTCTGGG + Intronic
1090333765 11:125949783-125949805 CCTGGGCTGTGGGCACTTCCTGG - Intergenic
1090425679 11:126605505-126605527 TGTGGGCTGTGCCTCCCTCCTGG - Intronic
1091129658 11:133134694-133134716 TGTGGGCTGGGCTCCTTTGCAGG - Intronic
1091486242 12:891686-891708 TGTGGGCTGAGGACCCTTTTGGG + Intronic
1092521957 12:9284562-9284584 TTGGGGCTGTGGTGCTTTCCAGG + Intergenic
1092545325 12:9447294-9447316 TTGGGGCTGTGGTGCTTTCCAGG - Intergenic
1094507626 12:31074756-31074778 TTGGGGCTGTGGTGCTTTCCAGG + Intronic
1095874540 12:47066317-47066339 TGTGGGGTCAGGTCCCATCCTGG + Intergenic
1096193671 12:49635397-49635419 TCTGGGCTGTGGTCCCTGAGAGG + Exonic
1096235222 12:49921841-49921863 TGTGGGACCTGGCCCCTTCCTGG - Intergenic
1096573774 12:52540188-52540210 TGTGGCCTGTTGTCACTTCCAGG - Intergenic
1098464549 12:70771434-70771456 TGTGTGCTGTGCTCACTGCCTGG + Intronic
1101573026 12:105972494-105972516 TGTGGGCTGTGTTCCTTTCTAGG - Intergenic
1102231924 12:111268595-111268617 TGCAGGCTGTGGTCCCTGCGAGG + Intronic
1103894383 12:124263571-124263593 TGGGGGGTGGGGTCTCTTCCTGG - Intronic
1103930875 12:124450137-124450159 TCTGGGCTGTGGCCCCTTCCAGG - Intronic
1104948689 12:132429020-132429042 TGTTGGCTCTGCTCCCTTCTGGG - Intergenic
1105823366 13:24099596-24099618 GGGGGGCTGTGGGCCCTCCCCGG - Intronic
1106551784 13:30778144-30778166 TGTGCTATGGGGTCCCTTCCTGG + Intergenic
1106606577 13:31234584-31234606 TGTGGGCTGTGATGCTGTCCTGG + Intronic
1108525298 13:51280994-51281016 AGTGGGCAGTGGTCCCTCCCTGG - Exonic
1114797456 14:25732521-25732543 TAAGGACTTTGGTCCCTTCCAGG - Intergenic
1115202516 14:30869990-30870012 TGGGGGCTGTGCTGTCTTCCAGG - Intergenic
1115397664 14:32927072-32927094 TGTGGGCTGAGGACCCTTTTGGG + Intergenic
1116577111 14:46588368-46588390 AGTCGGCTGGGGTCCCTACCTGG - Intergenic
1119777282 14:77257010-77257032 TGAACGCTGGGGTCCCTTCCTGG + Exonic
1120979806 14:90279791-90279813 TGTGGGCTGTGATTCCTTGGAGG - Intronic
1121921773 14:97888569-97888591 TGTGGGCTGTGGGCCACCCCAGG - Intergenic
1121977452 14:98418767-98418789 TGCTGGATGTGGTCGCTTCCTGG + Intergenic
1122119369 14:99543753-99543775 CGAGAGCTGTGATCCCTTCCAGG - Intronic
1122268599 14:100558236-100558258 GGTGGGCATTGGTCCCATCCCGG - Intronic
1122641813 14:103164489-103164511 TGTTGGCTCTGTTCCCTTCATGG + Intergenic
1122665417 14:103326518-103326540 TGTGGGCTCTGTCCCCCTCCAGG - Intergenic
1122665545 14:103327027-103327049 CGTGTGCTGTGTTCCCCTCCAGG - Intergenic
1123499371 15:20866418-20866440 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1123556623 15:21440148-21440170 GGTGGGCTGGGCTCCCTTGCTGG - Exonic
1123592845 15:21877383-21877405 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1124366716 15:29077217-29077239 TGGGGAGTGTGGTCTCTTCCAGG - Intronic
1124375246 15:29125452-29125474 TGCGGGCTCTGGTTCCTTTCAGG + Intronic
1124866897 15:33501022-33501044 TCTGGTGTGTGGTCCCTGCCTGG - Intronic
1125409848 15:39394527-39394549 TGTGAGGTGTGGTCCCTCCTAGG - Intergenic
1125755950 15:42065191-42065213 TGCAGCCTGTGGGCCCTTCCTGG - Intergenic
1125921479 15:43528124-43528146 TGGGGGCCTTGGTCACTTCCAGG - Exonic
1126429219 15:48562775-48562797 TGTGGGCTGTTCTCCTTGCCTGG - Intronic
1126870460 15:52981516-52981538 TGTGAGCTGGGCTCTCTTCCAGG - Intergenic
1127669245 15:61179196-61179218 TGTGGTCCGTGGTCCCTTGCAGG + Intronic
1128673241 15:69590273-69590295 TGTGGGCTGAGGTCCCTCAGTGG - Intergenic
1129453269 15:75662610-75662632 TGTGGCCTGTGGCCCCCTCTGGG + Intergenic
1129471571 15:75758470-75758492 TGCGGGCTGTGGTCCGCTTCCGG + Intergenic
1131131562 15:89903777-89903799 TCGGGGCGATGGTCCCTTCCTGG - Exonic
1202964962 15_KI270727v1_random:167337-167359 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1132686905 16:1165984-1166006 TCTGGGCTGAGGTCCCTTCTCGG + Intronic
1132992705 16:2805204-2805226 TCTGGGCTGTGGGCGCTTCAGGG + Intergenic
1133181081 16:4055168-4055190 TGAGGCCTGGGGGCCCTTCCCGG - Intronic
1137560704 16:49500337-49500359 TGTGGCCTTTGGCCCCCTCCTGG + Intronic
1137613798 16:49835493-49835515 TGTGGCCTGGCTTCCCTTCCTGG - Intronic
1139431424 16:66912910-66912932 GCTGGGCTGTGGTCCTATCCAGG - Intronic
1139978350 16:70833237-70833259 TGTGGGCCAAGGTCACTTCCTGG + Intronic
1141601050 16:85126721-85126743 TGGGGGCTGTGGCCTCTTCTAGG - Intergenic
1141701388 16:85643793-85643815 GGTGGGCTGTGGGTCCTCCCTGG - Intronic
1141841132 16:86574816-86574838 CGTGGGCTGTGGTCCCTGTGCGG + Intergenic
1142395748 16:89830219-89830241 TGGGTGGTGTGGCCCCTTCCTGG + Intronic
1143011720 17:3869672-3869694 TGTGGACTTTGGACCCCTCCAGG - Intronic
1144739959 17:17576265-17576287 AGTGGGCTCTGGGCCCTTCGAGG - Intronic
1147191787 17:38742180-38742202 GGAGGGCTGCTGTCCCTTCCAGG - Intronic
1147966821 17:44198669-44198691 TGTGGGCTCTGCTCCCCTCGTGG - Intronic
1147969386 17:44211434-44211456 TGTGGGCTGGACTCCCTGCCTGG + Intronic
1148694632 17:49551555-49551577 TCTGGGCTGGGTTCCCTTCCTGG + Intergenic
1151277687 17:73048135-73048157 TGGGTGCTGTGGTCACTACCTGG - Intronic
1151942917 17:77304161-77304183 CGTGGCCAGAGGTCCCTTCCTGG + Intronic
1152685579 17:81692247-81692269 TGTGGGCCGTGCTCCCTGCTTGG + Intronic
1153406850 18:4750426-4750448 TGTGGGCAGTGGTCTATTTCAGG - Intergenic
1154499636 18:14988949-14988971 TCTTGGCTGTGATCCCTTCTAGG + Intergenic
1155903733 18:31424049-31424071 TGTTTCCTGTGGTTCCTTCCAGG - Intergenic
1157285815 18:46376508-46376530 TGTGGTCTGAGGTCCCATCAGGG - Intronic
1157479885 18:48046985-48047007 TGTGGCCTTTGTTCCATTCCTGG + Intronic
1157701185 18:49762360-49762382 CGCCGGCAGTGGTCCCTTCCGGG - Intergenic
1160291734 18:77600929-77600951 TGTGGGCTGTGCTCTCTAACAGG + Intergenic
1160874732 19:1291686-1291708 GGTGGGCTGGGCTGCCTTCCAGG - Intronic
1162526316 19:11208910-11208932 CGTGGGCTGCGTTTCCTTCCAGG - Exonic
1162964642 19:14150134-14150156 TGTGGGCTGGGGGCCCTGCGGGG + Exonic
1163311736 19:16519101-16519123 TGCCGGCTGTGGGACCTTCCTGG - Exonic
1163767360 19:19170973-19170995 TCTGGGCTGGGGTCCAATCCTGG - Intronic
1163909753 19:20178292-20178314 AGTGTGCTGTGGTGCCTTCTCGG + Intronic
1164797093 19:31042104-31042126 TGTGAGGTGTGGTTTCTTCCTGG + Intergenic
1165314006 19:35043904-35043926 AGTGGGCTCTGGTGCCTCCCTGG + Intronic
1165800783 19:38548348-38548370 TGTGGGCTCTGAAGCCTTCCAGG + Exonic
1167486972 19:49768196-49768218 TGGGGACGGTGGTCCCTGCCAGG + Intronic
1168125528 19:54280409-54280431 TGTGGGGTGAGGTCCCTCCTAGG + Intronic
1168161886 19:54515911-54515933 TGTTGGCTGTGGTGTCCTCCTGG - Intergenic
1168168951 19:54573944-54573966 TGTGGGGTGAGGTCCCTCCTAGG - Intronic
1168171724 19:54594310-54594332 TGTGGGGTGAGGTCCCTCCTAGG - Intronic
926112416 2:10191803-10191825 TGGGAGCTGTGGGCCTTTCCAGG + Intronic
926377238 2:12244132-12244154 TACTGGCTGTGTTCCCTTCCTGG - Intergenic
928231804 2:29505021-29505043 TGTGGCCTGTGGTCACTCCAAGG + Intronic
928365316 2:30695967-30695989 TTTGGGGTGGGGACCCTTCCTGG + Intergenic
929941916 2:46340569-46340591 GATGGGCTGTGGTCTCTTTCAGG + Intronic
934730359 2:96652685-96652707 TGTGGGCTGGGGTCCCATCCTGG + Intergenic
936092606 2:109510874-109510896 TATGGGGAGTGGGCCCTTCCAGG + Intergenic
937250074 2:120518109-120518131 TGTGGGCTATGCTCACATCCTGG + Intergenic
937329297 2:121015888-121015910 TCTGGGCTGTGCTCCCTGCAGGG + Intergenic
943990958 2:194692011-194692033 TGTTGGCTTTTATCCCTTCCTGG + Intergenic
945552139 2:211233509-211233531 TGTGTGCTGTGCTACCTTCCAGG + Intergenic
946007025 2:216533927-216533949 TGTGGCCTGTTGTCTCTGCCCGG + Intronic
947175660 2:227364817-227364839 TGTGGGCTGTTGTCATTCCCTGG + Intronic
947677587 2:231997290-231997312 GCTGGGCTGTTGTCCCTTTCAGG + Intronic
948301429 2:236909967-236909989 TATGGGCTGTGGTCACTCTCGGG - Intergenic
948771763 2:240254906-240254928 TGGGGCCTGAGGTTCCTTCCAGG - Intergenic
948894191 2:240920691-240920713 TGGTGGCTGTAGTGCCTTCCAGG + Intronic
1169542475 20:6615010-6615032 TGTGGGCTGTGGTCACAGACTGG + Intergenic
1170367662 20:15615617-15615639 TGTGGCCTGTGGTCACTTCTTGG - Intronic
1171189357 20:23148081-23148103 TGAGGGCTGTGGCAACTTCCCGG - Intergenic
1171339574 20:24416781-24416803 TGTTGGCTTTGGGCCCCTCCTGG - Intergenic
1174147997 20:48465540-48465562 TGGGGGCTTTAGTCCCTTGCAGG + Intergenic
1175820546 20:61906736-61906758 TGTGTGCTGTGGGCCCTGGCAGG + Intronic
1176816727 21:13610070-13610092 GGTGGGCTGGGCTCCCTTGCTGG + Intronic
1177640658 21:23840394-23840416 AGTGGGCTCAGGTCCATTCCTGG - Intergenic
1179594079 21:42430621-42430643 GGTGGGCTGTGGGGCCTTCTGGG - Intronic
1179728476 21:43354033-43354055 TCTGTGCTGGGGGCCCTTCCTGG - Intergenic
1179898483 21:44376757-44376779 GGTGGGCTGGGGTCCCTTGCAGG + Intronic
1179944732 21:44665408-44665430 TCTGGGCTGTATTCCCCTCCTGG - Intronic
1180117821 21:45723701-45723723 TGCGGGCTGTGCTCCCTTGCTGG - Intronic
1180866282 22:19121884-19121906 TGTTGCCTCTGGGCCCTTCCCGG - Intronic
1180955458 22:19739373-19739395 TGAGGGCTGCCGTCCCTTCTTGG - Intergenic
1181425573 22:22835468-22835490 TGTGCCCTGTGCTCCCTTACCGG + Intronic
1182357952 22:29730686-29730708 TGGGGGCTGTGGATTCTTCCAGG + Exonic
1184796714 22:46737482-46737504 TGTGGGGTGTGCTCCCTGCTCGG - Intronic
1185092570 22:48784317-48784339 CCTGGGCTGCTGTCCCTTCCTGG - Intronic
1185154362 22:49184170-49184192 AGGGGGCCGTGGTCCCTGCCGGG + Intergenic
950101173 3:10357877-10357899 TGTGGTCTGTGGTGCTTCCCAGG - Intronic
954422114 3:50424295-50424317 TGTGGGATGTGGTCCCTGGATGG + Intronic
954683004 3:52355934-52355956 AGTGGGCTGTGGGCCCCTCGAGG + Intronic
958937052 3:100267043-100267065 TGTGCATTGTGGTGCCTTCCTGG + Intronic
961586619 3:127933433-127933455 TGTGGGCTGTTGTACCAACCAGG - Intronic
962301767 3:134250238-134250260 TGGGAGGTGTGGTCCCTGCCCGG - Intronic
964075213 3:152684626-152684648 TCTGGGCTGTGGACTCTACCTGG + Intergenic
964655764 3:159064449-159064471 TATGCCCTGTGGTCCCTCCCTGG + Intronic
968360109 3:198140752-198140774 TGTGGGCCGGGATCCCATCCAGG + Intergenic
968472195 4:787244-787266 CCTGGGCTGCGGTCACTTCCAGG + Intronic
968811413 4:2801164-2801186 TGGGGGCTGGGCTCCTTTCCCGG + Intronic
968974310 4:3813124-3813146 CTTGGGTTGTGGCCCCTTCCTGG - Intergenic
972358357 4:38303582-38303604 GGTGGGGTGTGGGTCCTTCCTGG + Intergenic
972367026 4:38385615-38385637 TGTAGGCTGAGGCCCCTCCCAGG - Intergenic
975176178 4:71291679-71291701 TGTGGGCTGAGGACCCTTTTGGG - Intronic
976123240 4:81805568-81805590 TGTGGGGTGTGTTGGCTTCCTGG - Intronic
980896569 4:138866192-138866214 TGTGGTCTGTGGTTCATGCCAGG - Intergenic
981652166 4:147072626-147072648 TGTGAGCTGGGGTCCCCCCCAGG - Intergenic
985336847 4:188905390-188905412 TCTGGGCTGTGGGACCTTCAGGG + Intergenic
985644858 5:1080087-1080109 TGTGGGCTCTGCTGCCTCCCAGG - Intronic
986774686 5:11003144-11003166 TGTGGGCTGTAGAGCCTTCAAGG - Intronic
992141886 5:73805821-73805843 TCTGGGGTGTGGTTCCTTCTAGG - Intronic
996771846 5:127094631-127094653 TGTGAGGTGTGGGCCCCTCCAGG + Intergenic
999223700 5:150002015-150002037 TGTAGACTGTGTTCTCTTCCTGG + Intronic
1000137662 5:158368361-158368383 TGGGAGCTGTGGTCCCTTTAGGG + Intergenic
1001246697 5:170110250-170110272 TGAGGGCTGTGGGCAGTTCCTGG + Intergenic
1001542367 5:172548568-172548590 TGTTGGCTGTGTTTGCTTCCTGG - Intergenic
1002163822 5:177332607-177332629 TGTGGTCTGAGGGCCCTTTCTGG + Intronic
1002316699 5:178348612-178348634 TCTGGGCTGAGCTCCCTGCCTGG + Intronic
1002407155 5:179043998-179044020 TGGGGTCGGTGGTTCCTTCCAGG + Intergenic
1002845294 6:939870-939892 AGCTGGCTTTGGTCCCTTCCTGG - Intergenic
1006641567 6:35492125-35492147 TGGGGGCTGGGGTCCCTGCAGGG - Intronic
1006644871 6:35509168-35509190 AGGGGGCTGAGGTCCCTTCAGGG - Intronic
1007412150 6:41671151-41671173 ACTGGGCTGTGTGCCCTTCCTGG - Intergenic
1007715284 6:43852091-43852113 TGTGGCCTGGGGTCTATTCCAGG + Intergenic
1008056700 6:46952984-46953006 TGTGTGCTGTCCTCCCTGCCTGG - Intronic
1016528457 6:145030983-145031005 TTTCAGCTGTTGTCCCTTCCAGG - Intergenic
1017010150 6:150057941-150057963 GCTGGGCTGAGGCCCCTTCCAGG + Intergenic
1017235154 6:152111153-152111175 TGTGGGCTGTGGTCCCTTCCTGG - Intronic
1018172949 6:161155881-161155903 TTTAGTCTGTGGCCCCTTCCTGG - Intronic
1019289900 7:245360-245382 TGGGGGCTGAGTTCCCTCCCTGG + Intronic
1020107218 7:5427742-5427764 TGGGGGCTTTGGTCCCCACCTGG - Intergenic
1024262560 7:47582934-47582956 TTTGTCCTGTGGTCCTTTCCAGG + Intergenic
1026868955 7:73839357-73839379 TGTGCTCTCTGGCCCCTTCCTGG + Intronic
1027525115 7:79259087-79259109 TTTGGTCTGTGGTCCCTATCTGG - Intronic
1028856246 7:95596839-95596861 CGTGGGCTGGGGTCCCGCCCAGG + Intergenic
1029577125 7:101411114-101411136 TCTGGGCTGTGGTCTGTGCCAGG - Intronic
1033277397 7:139982727-139982749 TGTGGGCTGTGATCCTTTAGGGG - Intronic
1034258901 7:149741884-149741906 GGGGGCCTGTGGTCCCTGCCTGG - Intergenic
1035482893 7:159201840-159201862 TGTGCGCTGTGTTCCCTGCAAGG + Intergenic
1035534158 8:378455-378477 TGTGGTACGTGGTTCCTTCCTGG - Intergenic
1035782455 8:2239331-2239353 TGTGGTCTGTGGTCACATTCAGG + Intergenic
1035809664 8:2480257-2480279 TGTGGTCTGTGGTCACATTCAGG - Intergenic
1037835695 8:22213656-22213678 TGTGGGCTGAAGCCCCTGCCTGG - Intergenic
1039365841 8:36927097-36927119 TGTGGGCTTTGTTGCCTTCTTGG - Intronic
1039791008 8:40875589-40875611 TGTGGGGTGTGGTATCTTCATGG + Intronic
1040548750 8:48422429-48422451 TGTGGGCTGCGCTGCCTTCGGGG + Intergenic
1042844723 8:73158536-73158558 TGTGGGCTTTTGTCCCCTTCAGG + Intergenic
1044466344 8:92511254-92511276 TGTTGGTTGTGGACCCATCCTGG - Intergenic
1044841146 8:96338163-96338185 TGTAGGGTGTGGCCCCTTTCTGG + Intergenic
1045438431 8:102187214-102187236 TGTGGGCTGGGGACTCCTCCAGG + Intergenic
1046711746 8:117518546-117518568 GGCGGGCTGTGTTCCCTTCTGGG - Intergenic
1048936740 8:139363899-139363921 TGGGGGCTGGGGAGCCTTCCAGG - Intergenic
1049010379 8:139883471-139883493 TGTGGGCAGAGGTGCCTGCCGGG - Intronic
1049244408 8:141554198-141554220 TGTGTGATGTAATCCCTTCCTGG - Intergenic
1049380070 8:142308180-142308202 TGTGGGCTGCACTCTCTTCCTGG + Intronic
1049725155 8:144142363-144142385 TGTGGGGTGTGGGCCCCTGCAGG + Intergenic
1049729768 8:144170396-144170418 TGTGGGCTGTGACCCTTCCCAGG + Intronic
1050363421 9:4852703-4852725 TGGGTGCTGTGGTTCCTGCCTGG + Intronic
1057356824 9:94338991-94339013 TGTGGGCTTTGTTCCCTCCCTGG - Intergenic
1057650927 9:96918649-96918671 TGTGGGCTTTGTTCCCTCCCTGG + Intronic
1058914879 9:109556143-109556165 TGTGGTCTGTGTTACATTCCTGG + Intergenic
1060265922 9:122111407-122111429 AGTGGGCTGTGGTCCAGGCCTGG + Intergenic
1060941600 9:127545891-127545913 TGTGGGCTGGGGCCGCTGCCAGG - Intronic
1062153524 9:135033638-135033660 TGTGGGCAGGGGGGCCTTCCCGG - Intergenic
1062725843 9:138073044-138073066 CCTGGGCGGGGGTCCCTTCCGGG + Intronic
1062744816 9:138204592-138204614 TGTGGGCCGGGATCCCGTCCGGG + Intergenic
1203530634 Un_GL000213v1:139424-139446 GGTGGGCTGGGCTCCCTTGCTGG - Intergenic
1185749236 X:2597342-2597364 TGTTGGCTGAGGTTGCTTCCAGG + Intergenic
1186700673 X:12086839-12086861 TCTGGGCTGTGTTCCTTTCCTGG + Intergenic
1189912450 X:45824727-45824749 GGTGGGCTGTGAGCCCTTCATGG - Intergenic
1191776717 X:64822450-64822472 TGAGGGCTGTGGTCTCTTCCAGG - Intergenic
1191908090 X:66117069-66117091 TGGGGGCTCAGTTCCCTTCCAGG + Intergenic
1192209363 X:69117834-69117856 TCTGGGCTGAGGGGCCTTCCTGG + Intergenic
1192259585 X:69496631-69496653 TGAGGGCTGGGTTCCCTCCCTGG + Intergenic
1195379041 X:104254252-104254274 TGGGGGCTGTGGTCCCTCAGCGG + Exonic
1198275767 X:135096145-135096167 TGAGGGCGAGGGTCCCTTCCTGG + Intergenic
1201059843 Y:10036111-10036133 GGTGGGCTGTGGGCCCTGCGGGG + Intergenic
1202148873 Y:21827000-21827022 TGTGGGTTGTGGTCTCGTCTTGG + Intergenic