ID: 1017237771

View in Genome Browser
Species Human (GRCh38)
Location 6:152135138-152135160
Sequence GCATCAAGGTTAGAATCAAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017237769_1017237771 -9 Left 1017237769 6:152135124-152135146 CCTGAAGTATCTCTGCATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1017237771 6:152135138-152135160 GCATCAAGGTTAGAATCAATAGG 0: 1
1: 1
2: 0
3: 6
4: 114
1017237768_1017237771 12 Left 1017237768 6:152135103-152135125 CCATAAGCTGTTTGTGATGGTCC 0: 1
1: 0
2: 1
3: 6
4: 101
Right 1017237771 6:152135138-152135160 GCATCAAGGTTAGAATCAATAGG 0: 1
1: 1
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017237771 Original CRISPR GCATCAAGGTTAGAATCAAT AGG Exonic
902699084 1:18159323-18159345 GAAGAAATGTTAGAATCAATGGG + Intronic
903109943 1:21123643-21123665 GCATTAAGGTTAAAATAAAAAGG + Intronic
912228018 1:107758193-107758215 GGATCAAAGTTAACATCAATAGG - Intronic
912644469 1:111379122-111379144 GCAACATGGATGGAATCAATGGG - Intergenic
913541687 1:119827124-119827146 GAAACATGGTGAGAATCAATGGG + Intergenic
917292152 1:173481475-173481497 GGAGCAAGGTTAGTATCAATTGG + Exonic
922181274 1:223234839-223234861 GCATCAAGGGAAGAACCAACTGG - Intronic
923949326 1:238929586-238929608 GCATCAATGTGAGAAGAAATAGG - Intergenic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1064551681 10:16507653-16507675 GCTTCAAGTTTAGTATCATTAGG + Intronic
1066702977 10:38149423-38149445 GCATCAAGGCTATGATCAAATGG + Intergenic
1067495146 10:46754901-46754923 GGATGAAGGTTAGAAGCACTTGG - Intergenic
1067599508 10:47585495-47585517 GGATGAAGGTTAGAAGCACTTGG + Intergenic
1068327761 10:55516650-55516672 CCATAAATTTTAGAATCAATTGG + Intronic
1070101431 10:73391290-73391312 GCAAGAAGGTTGGAATCAAATGG - Intronic
1070112302 10:73497389-73497411 CAATCAAGGTGGGAATCAATGGG - Intergenic
1071651038 10:87393377-87393399 GGATGAAGGTTAGAAGCACTTGG + Intergenic
1071931410 10:90475306-90475328 ACATAAAGGTTAGAAACCATGGG - Intergenic
1071958490 10:90784766-90784788 GGATCAAGGTGAGAATCATTAGG - Intronic
1073902399 10:108238337-108238359 ACATCAAGGGTAGCAGCAATGGG - Intergenic
1074692315 10:116017248-116017270 ACATAAAGCTTAGAAGCAATAGG - Intergenic
1078415240 11:11159465-11159487 GCATCAAGGTTAGTATAAGGAGG + Intergenic
1079081387 11:17415678-17415700 GCATTCAGGTTGGAATGAATAGG + Intronic
1079391175 11:20023347-20023369 CCATCAAGGTTAGAATCAATGGG - Intronic
1080002128 11:27362254-27362276 GTATCAATGTTAGGACCAATGGG - Intronic
1086814823 11:91356835-91356857 GAATAAAGGTCAGAATCAAGTGG - Intergenic
1090906381 11:131078204-131078226 GCATTAATGTTAGAACCTATTGG + Intergenic
1090989070 11:131799924-131799946 TCATCAAAGTTAGAAAAAATAGG - Intronic
1096763883 12:53867247-53867269 GCATCAGGGATAGACTCAAAGGG + Intergenic
1104223535 12:126809583-126809605 GCTGCAAGGTTACAATAAATTGG - Intergenic
1106334002 13:28766128-28766150 GCCTGAAGGTTGGAATCAACTGG + Intergenic
1109066670 13:57702904-57702926 GCAGAAAGGTCAGAATCAGTTGG - Intronic
1109866432 13:68271115-68271137 GCTTCAAGGTTATAAATAATGGG + Intergenic
1112099316 13:96169664-96169686 GCACTAAGTTTAGCATCAATAGG + Intronic
1120434185 14:84459268-84459290 GAATCAAGGTTACTATCAGTTGG + Intergenic
1120750054 14:88188872-88188894 GTAGGAAGGTTAGAATAAATAGG - Intronic
1125814392 15:42572119-42572141 GCATCAAGGTATGCATCAGTGGG - Intergenic
1127769545 15:62219978-62220000 GCTTCAAAGTTTGAATGAATTGG + Intergenic
1127988333 15:64092905-64092927 GCATTACGGTTAGAACCAGTAGG + Intronic
1138345451 16:56317484-56317506 GGATCAAGGAGAGAATGAATGGG + Intronic
1148075156 17:44931554-44931576 GAATCAAGGTGGGAAGCAATGGG - Intronic
1153266641 18:3277261-3277283 GCATCAAGGTATGCATCAGTGGG - Exonic
1156940275 18:42758891-42758913 GAATCAAGGACAGAATCAATGGG - Intronic
1158072344 18:53487734-53487756 ACAGCAAGGTTAGAATTAAAAGG + Intronic
1165224257 19:34343102-34343124 TAATCAAGCTTAGAATAAATTGG - Intronic
1167241056 19:48343263-48343285 GGAGCAAGGTTAGAGTCAAGAGG - Intronic
927639441 2:24837462-24837484 ACATCGAGGTTAGAATCAGCGGG + Intronic
930153399 2:48080587-48080609 GCATTAATGTTTGAATTAATTGG - Intergenic
930901015 2:56507846-56507868 GCATGAAGCTTAAAATGAATGGG + Intergenic
935016938 2:99191750-99191772 TAATGAAGGTTAGAACCAATAGG - Intronic
937230168 2:120393735-120393757 TCATTAAGGTTAGGCTCAATGGG - Intergenic
941828279 2:169924448-169924470 GCACCAAGGCTAGAATCTTTTGG - Intronic
943191993 2:184689122-184689144 CCATCAAGCTTTGAATCGATGGG + Intronic
944503973 2:200390738-200390760 GGATCGCGGTTAGAATCCATGGG + Intronic
945295825 2:208170505-208170527 GGATCAAGGATAGAAACATTTGG + Intronic
1168936098 20:1666453-1666475 GCACTAAGTTCAGAATCAATGGG + Intergenic
1169332164 20:4724634-4724656 GCATCAAGCACAGAATCAAGTGG + Exonic
1173903111 20:46605434-46605456 GCATCAAGCTTCTAATCAACTGG - Intronic
1177610129 21:23435476-23435498 GCATCATGGGAAGAATCAAATGG + Intergenic
1179630266 21:42673611-42673633 GCACCAAGGAGAGAATTAATGGG + Intronic
953002315 3:38947350-38947372 TCATCAAGGTTAGAATTGACTGG - Intronic
956490121 3:69762409-69762431 GAATCAGGGTTAGAATCACTGGG - Intronic
958736690 3:98017474-98017496 TAATCAAGGTTAGAATGAAGAGG + Intronic
963492037 3:146014297-146014319 GCATCAAGGGTGGTATAAATTGG + Intergenic
965193632 3:165564415-165564437 GAATCAAGGGTTGAATCAAGGGG + Intergenic
967415124 3:189208326-189208348 GCTTAGAGGTTACAATCAATTGG + Intronic
967688413 3:192444466-192444488 GAAGCAATGTTAGGATCAATTGG - Intronic
972638275 4:40903518-40903540 GCATCAAGGGTAATATCAAGGGG - Intronic
975087773 4:70364280-70364302 GCGGCAAGATTAGAATCAAGAGG + Intronic
976060553 4:81123329-81123351 GCACAAAGGTTAGAATTAAAAGG - Intronic
976131798 4:81892403-81892425 GCATCAAGGTTAGAATACGATGG - Intronic
977612638 4:99051940-99051962 GCTTCTATGTTTGAATCAATGGG + Intronic
978907009 4:114017388-114017410 GCATCACTGTTAGAATCACTTGG + Intergenic
978913536 4:114095468-114095490 GCATGAAGGTTTTGATCAATTGG + Intergenic
981141410 4:141273784-141273806 GCATCTAAATGAGAATCAATAGG - Intergenic
982722700 4:158875667-158875689 GCAACAACCTTAAAATCAATAGG + Intronic
984264146 4:177476276-177476298 GAATCAAGGTTAGTAGCTATAGG + Intergenic
984540585 4:181032479-181032501 GCATCAAGGTTAGGAAGAAATGG - Intergenic
985306993 4:188554430-188554452 GCATCGAGTTTAGAAACAGTGGG + Intergenic
992092631 5:73332033-73332055 CCATCAAGGCTAGAATGAAATGG - Intergenic
993616698 5:90121785-90121807 GAGTCAAGGTTAGAATCCACAGG + Intergenic
996907144 5:128613846-128613868 AAACCAAGGTTAGAAGCAATTGG + Intronic
998726273 5:145018505-145018527 GCATCAAGGCTGGAATCAGGAGG - Intergenic
1004057364 6:12153640-12153662 GTATCTAGGTTAGAGTGAATTGG + Intronic
1004672415 6:17810167-17810189 GCTTCAAAGGAAGAATCAATAGG - Intronic
1008912274 6:56748065-56748087 GCATAAAGGTAAGAAGAAATAGG - Intronic
1012669629 6:102026636-102026658 GCAGCAAGTTTAGTATCATTTGG - Intronic
1015823427 6:137287073-137287095 GCATCACTGTTAGCATAAATAGG + Intergenic
1017237771 6:152135138-152135160 GCATCAAGGTTAGAATCAATAGG + Exonic
1022288399 7:28977173-28977195 GCTTTAAGGTGAGAATCATTGGG + Intergenic
1022975407 7:35551343-35551365 TCATCAAGGTTACATCCAATGGG - Intergenic
1025118941 7:56282895-56282917 GCATAAAGCATAGAATCATTGGG + Intergenic
1025215617 7:57053535-57053557 GCAGCAAGGTCAGAGTCCATGGG - Intergenic
1025626360 7:63225960-63225982 GCAGCAAGGTCAGAGTCCATGGG - Intergenic
1025655760 7:63517166-63517188 GCAGCAAGGTCAGAGTCCATGGG + Intergenic
1026190180 7:68118497-68118519 GCAGCAAGGTCAGAATCCATGGG - Intergenic
1028138832 7:87249444-87249466 GTATCAAGGTTTGAGGCAATCGG - Intergenic
1033920427 7:146385219-146385241 GCAACAAGATTACAAGCAATAGG - Intronic
1039749639 8:40465251-40465273 GCATCTAGGTTAAGGTCAATGGG - Intergenic
1039917889 8:41873209-41873231 GCATGAAGGTTCGAGGCAATCGG - Intronic
1041544748 8:59030091-59030113 GCCTCAAAGTTATAATCAAGAGG + Intronic
1041777187 8:61536395-61536417 GTAGCAAGCTTAGAATAAATAGG - Intronic
1043576253 8:81661265-81661287 GAATCAATGTTAAAATTAATGGG + Intronic
1045456846 8:102388846-102388868 GCATCTAGGTCAGAATCACAAGG - Intronic
1045679089 8:104639808-104639830 TTAACAAGGTGAGAATCAATGGG + Intronic
1047513367 8:125532336-125532358 CCATCAAGGTCATAATCTATGGG + Intergenic
1048434728 8:134405559-134405581 GCCTGAAGATTTGAATCAATAGG - Intergenic
1050705724 9:8394776-8394798 ACATCAAAGGTAGAAGCAATAGG - Intronic
1051344428 9:16139598-16139620 TCTACATGGTTAGAATCAATTGG - Intergenic
1057983815 9:99689136-99689158 GCATCAGAGTTAGAAACAACTGG + Intergenic
1186162042 X:6787570-6787592 GCATTAAGGATTGTATCAATTGG - Intergenic
1186564281 X:10645789-10645811 GCCTCAAGGTAGGAATCAAGAGG - Intronic
1187793279 X:22974224-22974246 GCAACAAGGTTACAATTATTGGG + Intergenic
1188198923 X:27275879-27275901 GCATTAGGCTTAGAATCCATTGG - Intergenic
1189937649 X:46086799-46086821 TCATCAAAATTAGAAGCAATGGG + Intergenic
1195651865 X:107293167-107293189 GGATCTAGGTTTGAATCAAGAGG - Intergenic
1196326617 X:114413035-114413057 GCATCAAGGATGGAATGGATTGG + Intergenic
1196961972 X:121013670-121013692 TCATGAAGATTAAAATCAATAGG - Intergenic
1197464766 X:126789636-126789658 AGATCAAGGTAAAAATCAATAGG - Intergenic
1198414508 X:136406406-136406428 GAATGAAGGTTAAAATCAAAGGG + Intronic
1199061212 X:143357192-143357214 GCCTCAATGTGAGAATCACTGGG + Intergenic
1200977475 Y:9228269-9228291 GCATTATGGTTATAATTAATGGG - Intergenic