ID: 1017237847

View in Genome Browser
Species Human (GRCh38)
Location 6:152135914-152135936
Sequence CATTGTGACCAGAGTGTAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017237847_1017237852 24 Left 1017237847 6:152135914-152135936 CCGACTACACTCTGGTCACAATG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1017237852 6:152135961-152135983 CTAAGTCCTTTCCTGCTTCTGGG 0: 1
1: 0
2: 0
3: 34
4: 299
1017237847_1017237851 23 Left 1017237847 6:152135914-152135936 CCGACTACACTCTGGTCACAATG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1017237851 6:152135960-152135982 ACTAAGTCCTTTCCTGCTTCTGG 0: 1
1: 0
2: 1
3: 33
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017237847 Original CRISPR CATTGTGACCAGAGTGTAGT CGG (reversed) Intronic
908896097 1:68901545-68901567 CTTTGTTACCAGAGTGATGTTGG - Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
912173828 1:107134092-107134114 CATTGTGACCAGAAAGCAGGTGG - Intergenic
917929101 1:179811717-179811739 CTTTGTGAGCACAGTGCAGTTGG + Intronic
919011928 1:191975811-191975833 CCTAGTGACCTGAGAGTAGTTGG + Intergenic
921780121 1:219153091-219153113 AATTGTGACTGGAGTGTAGAGGG - Intergenic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG + Intronic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
1066319845 10:34291215-34291237 CATATGGACAAGAGTGTAGTAGG - Intronic
1066413755 10:35199647-35199669 CAGTCTGACCTGGGTGTAGTTGG - Intronic
1067016560 10:42760222-42760244 CTTTGTGACCAGAGCCCAGTTGG - Intergenic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1077727644 11:4691454-4691476 CATGGTGACCAGAGTGGATATGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1086699392 11:89882802-89882824 CATTGTTTCCAGGGTGAAGTTGG - Intergenic
1086706779 11:89961712-89961734 CATTGTTTCCAGGGTGAAGTTGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1089305465 11:117523722-117523744 CATTGTGAGCATAGGGCAGTAGG - Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090974959 11:131672647-131672669 TATTGGCACCAGAGTCTAGTGGG - Intronic
1092674070 12:10897005-10897027 CATTGTGACCTCAGAGTAGTTGG - Intronic
1095187580 12:39219032-39219054 CATTATGCCCAGAGTTTACTTGG - Intergenic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102607581 12:114080511-114080533 CATTCTCACCAGAGAGTGGTGGG - Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103070303 12:117935799-117935821 TTGTGTGACCAGAGTGGAGTGGG - Intronic
1108766342 13:53634780-53634802 CATTGTGAACATAGTGCATTGGG + Intergenic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1110592525 13:77280780-77280802 CATTGTGACCAAAGTTTTATGGG - Intronic
1113295319 13:108953414-108953436 CATTGCAACCTGAGTGTAGGAGG + Intronic
1113336435 13:109380899-109380921 TATTGTGACCAGAGTCTTGAAGG + Intergenic
1115764131 14:36605268-36605290 CATTATGACCAGATTGTTTTAGG + Intergenic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1119477297 14:74938389-74938411 CATGGTGACCTCAGGGTAGTTGG + Intergenic
1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG + Intronic
1119844469 14:77818146-77818168 ACTTTTGACCTGAGTGTAGTGGG + Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121026139 14:90617670-90617692 CATTGTGAACTGAGTCCAGTGGG + Intronic
1121169390 14:91840833-91840855 CATTGTTACCTTAGTTTAGTGGG - Intronic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1135515797 16:23132446-23132468 CATTGTGACGAGTGTATAGATGG + Intronic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG + Intergenic
1146731100 17:35194370-35194392 CATTGTGACCTCATTGGAGTGGG + Exonic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG + Intergenic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1152128303 17:78460633-78460655 CATTCTGACCTGAGCGTTGTGGG - Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155265198 18:24085676-24085698 AATTGTGATCAGAGTGCAGAGGG + Intronic
1155489845 18:26389742-26389764 CCCAGTGACCAGAGGGTAGTGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156204449 18:34870913-34870935 CATTGTGTATAGAGTGTTGTGGG - Intronic
924968509 2:100953-100975 CATTCTGACCAGGATGGAGTTGG - Intergenic
925591875 2:5517857-5517879 CATTGTCAAGAGAGGGTAGTGGG - Intergenic
926998250 2:18763017-18763039 CACTGTGACCAAAGATTAGTTGG - Intergenic
930910941 2:56628898-56628920 AATTATAATCAGAGTGTAGTGGG + Intergenic
930990933 2:57653617-57653639 CATAGAGACCAGAAGGTAGTGGG - Intergenic
932099612 2:68885942-68885964 CATTCTGACGGGAGTGTATTAGG + Intergenic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
935315563 2:101830281-101830303 CATTGTGACTTCATTGTAGTAGG + Intronic
936490025 2:112961952-112961974 CATGGTGGCCACGGTGTAGTTGG + Intergenic
939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG + Intronic
944596480 2:201265924-201265946 GGTTGTGACCAGAGTGTGGTAGG - Intronic
1169003665 20:2189032-2189054 TATTGTGAACAGAGTGTAGAGGG - Intergenic
1172216388 20:33238602-33238624 CAAAATGACCACAGTGTAGTGGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1181064983 22:20301244-20301266 CCTTGTGGCCAGGATGTAGTGGG + Intergenic
951910794 3:27748412-27748434 CAGTGTTACCAGTGTGTTGTGGG - Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
953990142 3:47477141-47477163 CATTGTGACAATAGTGTGGTGGG - Intergenic
954497221 3:50976294-50976316 CATTGAAAGCAGTGTGTAGTGGG - Intronic
955685273 3:61543139-61543161 CATTGTGAACAGAGTGTACAAGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958069030 3:88585355-88585377 CATGGTGAGCAGAGAGTACTTGG - Intergenic
958821764 3:98982662-98982684 CTTTGTGACCAGTATGTAGAAGG + Intergenic
959236220 3:103726107-103726129 GATTGTGACCAGATTCTAGAAGG - Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
964205441 3:154169838-154169860 TATTGTGACCAGAGGCTTGTAGG + Intronic
964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG + Intergenic
976871491 4:89799365-89799387 CATTGTCACCAGAGCATAGCAGG - Intronic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
983068848 4:163245314-163245336 CATTGTGACAATAGTCTATTTGG - Intergenic
984998518 4:185461799-185461821 TATTGTGAGCAAAGTGTAGCCGG + Intronic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989669662 5:43900892-43900914 CAGTGTGAGCAGAGTGTTCTAGG - Intergenic
989786534 5:45338740-45338762 CACTGTGACTTGAATGTAGTAGG + Intronic
994357718 5:98812729-98812751 CATAGTGAACATAGTGTTGTTGG - Intergenic
995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG + Intergenic
996842030 5:127857494-127857516 CATTGAAACCAGAGCGTATTAGG + Intergenic
1001957735 5:175859754-175859776 CATGGGGACCAGCTTGTAGTAGG + Intronic
1002113280 5:176936200-176936222 CATTGTGACTAGCATGTAATAGG - Intronic
1005193079 6:23250120-23250142 TCTTGTGACCACTGTGTAGTGGG + Intergenic
1005366044 6:25078101-25078123 AATGGTTGCCAGAGTGTAGTGGG - Intergenic
1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG + Intergenic
1006926048 6:37655691-37655713 CATCCTGACCTGAGTGTAGAGGG + Exonic
1010701683 6:79056575-79056597 AATTGTGACAAGGGGGTAGTGGG + Intronic
1015438541 6:133219762-133219784 TATTGTGACCAGAGACTTGTAGG + Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017788143 6:157773302-157773324 CACTGTGTCCACAGTGTAGCTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1025067963 7:55874170-55874192 CATTGTTACCAGAGCGTAATTGG + Intergenic
1031832614 7:126646054-126646076 GATGATGACCAGAGTGCAGTGGG - Intronic
1037699380 8:21260782-21260804 CATTGTAATAAGTGTGTAGTGGG - Intergenic
1040360503 8:46659753-46659775 CATTGTTACCACAGCATAGTTGG - Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1044080326 8:87874669-87874691 TATTTTGACAAGAGTGTAATTGG - Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1045653754 8:104366494-104366516 TATTGTGATCACACTGTAGTTGG + Intronic
1046137916 8:110054489-110054511 CATTGTAACCAGAGGGTATGAGG - Intergenic
1046694285 8:117321272-117321294 TATTGTGCTCAGAGTGTACTGGG - Intergenic
1047800189 8:128301221-128301243 CAGTGTAGCCAGACTGTAGTTGG + Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG + Intergenic
1052620630 9:30904679-30904701 TGTTGTGACCAGAGTCTTGTAGG + Intergenic
1055852422 9:80648361-80648383 CATTGTAACCAGAGTTTTGTAGG + Intergenic
1057926877 9:99160191-99160213 CATTGGAAACAGAGTGTGGTGGG - Intergenic
1060289193 9:122284733-122284755 CAATGTGACAAGAGTGTACAAGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1186995825 X:15121052-15121074 CATTTCTACCAGAGTGTACTTGG - Intergenic
1189282920 X:39831869-39831891 CATTGTGCCCTGCCTGTAGTAGG - Intergenic
1189739022 X:44099896-44099918 CATTATGACCAGAATGTGGCAGG + Intergenic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1193297629 X:79851485-79851507 CATTGGGTCCAGTGTGTACTAGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic