ID: 1017237851

View in Genome Browser
Species Human (GRCh38)
Location 6:152135960-152135982
Sequence ACTAAGTCCTTTCCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017237847_1017237851 23 Left 1017237847 6:152135914-152135936 CCGACTACACTCTGGTCACAATG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1017237851 6:152135960-152135982 ACTAAGTCCTTTCCTGCTTCTGG 0: 1
1: 0
2: 1
3: 33
4: 361
1017237849_1017237851 -1 Left 1017237849 6:152135938-152135960 CCTGTTTTCTGTTCCTAAAGACA 0: 1
1: 0
2: 0
3: 26
4: 353
Right 1017237851 6:152135960-152135982 ACTAAGTCCTTTCCTGCTTCTGG 0: 1
1: 0
2: 1
3: 33
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017237851 Original CRISPR ACTAAGTCCTTTCCTGCTTC TGG Intronic
901438005 1:9261335-9261357 ACCAAGTTCCTTCCTGCCTCGGG + Intronic
904022173 1:27475392-27475414 ACTAAGGATTTTCCTGATTCAGG + Intronic
904356404 1:29942883-29942905 ACCAAGTACATTCCTGCCTCAGG - Intergenic
905062985 1:35155374-35155396 AGTATCTCTTTTCCTGCTTCGGG - Intergenic
905208923 1:36359865-36359887 GGTAAGCCCTTTCCTGCTGCTGG + Intronic
905283680 1:36865510-36865532 CCTCAGTCATATCCTGCTTCCGG - Intronic
906876865 1:49548745-49548767 GTTAAGTCCTTTCCTGGTTTTGG + Intronic
907831728 1:58070753-58070775 CCTCACTCCTGTCCTGCTTCTGG - Intronic
908227152 1:62067481-62067503 ACTAACCCCTTTCTTGCTTAGGG - Intronic
908342192 1:63193036-63193058 ACCAAGTATTTTCCTGCCTCAGG - Intergenic
908982092 1:69970801-69970823 ATTATGTCCTTTCCTGGTTTTGG - Intronic
909284784 1:73802046-73802068 ATTATGTCCTTGCCTGCCTCTGG + Intergenic
910786905 1:91008905-91008927 ATGAAGTCCTTTCCAGCTTTGGG - Intronic
910902334 1:92134436-92134458 AATAAGTTCATTCCTGCATCAGG + Intronic
911528642 1:99016906-99016928 ACTAAGTTCTCTCCAGCTACTGG - Intergenic
911829330 1:102530945-102530967 ACTAAGTACAATCCTGCTTTTGG + Intergenic
912537991 1:110390142-110390164 ACTAAGTCCTTAGTTGCATCAGG - Intronic
913097061 1:115528597-115528619 ACTCACTCATTTCCTGCCTCAGG - Intergenic
915821371 1:159027498-159027520 GTTATGTCCTTTCCTGCTTTTGG + Intronic
917154187 1:171978419-171978441 ACCAAGTCCCTTCCTACCTCAGG - Intronic
918189804 1:182163262-182163284 ACTTAGCCATTTTCTGCTTCAGG - Intergenic
921127371 1:212189552-212189574 TCTGCTTCCTTTCCTGCTTCTGG - Intergenic
921409649 1:214822164-214822186 GCTACGTCCTTTCCTGGTTTTGG + Intergenic
921640892 1:217552443-217552465 ACTACTACCTTTACTGCTTCTGG - Intronic
921690491 1:218143359-218143381 GTTAAGTCCTTTCCTGGTTTTGG - Intergenic
922945516 1:229510563-229510585 ACCAAGTCCTTTGCTGCTTCAGG - Intergenic
922995642 1:229957114-229957136 GATATGTCCTTTCCTGCTTTTGG + Intergenic
923459076 1:234192128-234192150 ATTATGTCCTTTCCTGGTTTTGG - Intronic
923691643 1:236199358-236199380 GCTATGTCCTTTCCTGGTTTTGG + Intronic
924328767 1:242921755-242921777 GCCAAGTGCTTTCCTGCCTCAGG - Intergenic
924805218 1:247356478-247356500 ACTAGGTTAGTTCCTGCTTCAGG - Intergenic
1063257198 10:4341074-4341096 ACAAATTCCTTTTCTGCTTAGGG + Intergenic
1063972906 10:11393788-11393810 ACTCACTCATTTCCTGCTTCAGG + Intergenic
1065422868 10:25566371-25566393 ACTCACTCATTTCCTGCATCAGG - Intronic
1065660843 10:28002870-28002892 TCTTAGTCCTTTCCTGATTGAGG - Intergenic
1065709356 10:28500605-28500627 ACTCACTCATTTCCTGCATCAGG - Intergenic
1066066493 10:31765044-31765066 CCCAAGTCCTTTGCTCCTTCAGG + Intergenic
1067460468 10:46454515-46454537 GCTAAGACCTTTCCCGCCTCAGG - Intergenic
1068142487 10:53025809-53025831 ACTCACTCATTTCCTGCATCAGG - Intergenic
1068143170 10:53030582-53030604 ACTCACTCATTTCCTGCATCAGG - Intergenic
1068398246 10:56492674-56492696 TGTAAGTCCATTTCTGCTTCAGG - Intergenic
1069325688 10:67228990-67229012 TTTATGTCCTTTCCTGGTTCTGG - Intronic
1072624785 10:97104260-97104282 ACTAAGCATATTCCTGCTTCTGG - Intronic
1072846117 10:98832219-98832241 TCTAAGTCCTTTACAGTTTCTGG - Intronic
1073399037 10:103241789-103241811 ACCAAGTCCTCTCCAGCCTCAGG - Intergenic
1073882178 10:107995705-107995727 AGCAAGTCCTTTCCTCCTGCTGG - Intergenic
1076822969 10:132950701-132950723 ACTAGGTCCTTTCCTGATCCGGG - Intergenic
1077572864 11:3354653-3354675 ACTAAATCCTTTCCTTCCTAGGG - Intronic
1078407418 11:11082500-11082522 TCCTTGTCCTTTCCTGCTTCTGG - Intergenic
1078471705 11:11592824-11592846 ACCAAGTCATTTCCTTCTTAAGG + Intronic
1079279710 11:19076313-19076335 TCTAATCTCTTTCCTGCTTCAGG - Intergenic
1080762660 11:35267398-35267420 ACAAAGTGCTTACATGCTTCCGG + Intronic
1080820244 11:35799048-35799070 ACTGAGTCCTTTACTGCTGCTGG - Intronic
1081181449 11:39990304-39990326 ACTCACTCATTTCCTGCATCAGG + Intergenic
1081184799 11:40029039-40029061 ACTCACTCATTTCCTGCATCAGG + Intergenic
1083046373 11:59739518-59739540 GCTATGTCCTTTCCTGGTTTTGG + Intronic
1083497068 11:63064787-63064809 GTTATGTCCTTTCCTGGTTCTGG + Intergenic
1084059367 11:66660104-66660126 ACTGAGCTCTTTCCTGCCTCAGG + Intronic
1086832890 11:91587289-91587311 ACTGAGTCAGTTCCTGCGTCTGG - Intergenic
1086844520 11:91731608-91731630 ACTCATTCATTTCCTGCCTCAGG - Intergenic
1087690234 11:101312526-101312548 GCTATGTCCTTTCCTGGTTTAGG + Intergenic
1087797852 11:102473181-102473203 ACTAAGTCCATTCCTGGGTGGGG + Intronic
1088206739 11:107400737-107400759 GCTATGTCCTTTCCTGGTTTTGG - Intronic
1090266849 11:125358797-125358819 ACTCAGTCATTGCCTCCTTCTGG + Intronic
1092317180 12:7430016-7430038 ACCAAGTCCTTTCTTACTTCAGG + Intronic
1092783421 12:12007631-12007653 ACCAAGTCCTGTCCAGCTTCTGG + Intergenic
1093175621 12:15910869-15910891 CCTAAGCCCTTGCCTTCTTCAGG + Intergenic
1093408907 12:18841708-18841730 GCTATGTCCTTTCCTGGTTTTGG + Intergenic
1093575013 12:20716948-20716970 AATAAGTCCTTCACTGCTTTGGG - Intronic
1096357749 12:50956457-50956479 ACTATGTATTTTCCTGCTACAGG + Intronic
1097620705 12:61936026-61936048 ATTATGTCCTTTCCTGGTTTTGG - Intronic
1098134905 12:67391854-67391876 TCCAAGCCCTTTCCTGCCTCAGG - Intergenic
1098956266 12:76693052-76693074 ACTCATTCATTTCCTGCATCAGG - Intergenic
1098957003 12:76697955-76697977 ACTCACTCATTTCCTGCATCAGG - Intergenic
1099971693 12:89506840-89506862 ACTCACTCATTTCCTGCATCAGG + Intronic
1100788741 12:98107432-98107454 ACAAAGTCCTTTATTCCTTCTGG - Intergenic
1101554958 12:105800329-105800351 GCCAAGTACTTTCCTGCCTCAGG - Intergenic
1101668886 12:106848218-106848240 GCCAAGTACTTTCCTGCCTCAGG - Intronic
1102346425 12:112163866-112163888 TCCCAGTCCTTTCCTGCCTCTGG + Intronic
1104332855 12:127863537-127863559 ATTATGTCCTTTCCTGGTTTTGG - Intergenic
1104851496 12:131877180-131877202 CCTCAGTCCTGTCCTGCTGCTGG + Intergenic
1105915642 13:24913428-24913450 ACTAAGCACTTTCTTGCTTCTGG + Intronic
1106619215 13:31357350-31357372 ACCCTGTCCTTTGCTGCTTCCGG + Intergenic
1106929422 13:34647800-34647822 ACCAGGTCCTTTCCTGCCTCAGG - Intergenic
1107961040 13:45558901-45558923 AGTATGTCCTTTCCTGGTTTTGG + Intronic
1108867738 13:54942062-54942084 ACTCACTCATTTCCTGCATCAGG - Intergenic
1109105285 13:58242022-58242044 CCTCAATCCTTTCCAGCTTCTGG - Intergenic
1109211828 13:59544304-59544326 ACCAAGGTCTTTCCTGCTTCAGG - Intergenic
1109504650 13:63284697-63284719 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1109678883 13:65719589-65719611 ATTATGTCCTTTCCTGCTTTTGG - Intergenic
1109975914 13:69831621-69831643 ATTATGTCCTTTCCTGGTTTTGG - Intronic
1111157289 13:84344619-84344641 GCTATGTCCTTTCCTGGTTTTGG + Intergenic
1111165461 13:84452284-84452306 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1111337115 13:86839003-86839025 ACTCACTCATTTCCTGCATCAGG + Intergenic
1111805083 13:93030900-93030922 ATTCACTCCTTTCCTGCATCAGG + Intergenic
1112712250 13:102142993-102143015 CCTGTTTCCTTTCCTGCTTCAGG + Intronic
1112945623 13:104923321-104923343 GCTATGTCCTTTCCCGCTTTGGG - Intergenic
1113543109 13:111124101-111124123 AGTCAGTCCCTTCCTGTTTCTGG + Intronic
1116049235 14:39782613-39782635 ACAAACTCCTTTCCTATTTCTGG - Intergenic
1116326638 14:43538825-43538847 ACTCACTCATTTCCTGCATCAGG + Intergenic
1117636314 14:57747583-57747605 GCTAACTACTTCCCTGCTTCTGG + Intronic
1118200312 14:63665101-63665123 ACTAGTTCTTTTCCTACTTCTGG + Intergenic
1119054482 14:71405280-71405302 GCCAAGTTCTTTCCTGCCTCAGG - Intronic
1120352933 14:83386476-83386498 ACTCACTCATTTCCTGCATCAGG - Intergenic
1120998269 14:90433383-90433405 ACTAAGTCAGTTCCTGGTGCGGG - Intergenic
1122885586 14:104708993-104709015 CCCGAGTCCTTTCCTGCTGCGGG + Intronic
1123187583 14:106535223-106535245 ACTCACTCATTTCCTGCATCAGG - Intergenic
1125236295 15:37517689-37517711 ACTAATTCCATTCATGCTTTGGG - Intergenic
1126797081 15:52268205-52268227 ACTAAGTGCTTTCATTCTTGTGG - Intronic
1127032639 15:54880818-54880840 CCTAACTTCTTTCCTGCTTGGGG - Intergenic
1129319624 15:74767329-74767351 AGTAACCCCTTTCCTGCCTCAGG - Intergenic
1129613097 15:77075856-77075878 AATAAATCCTTTCCTGCTCAAGG + Intronic
1131065457 15:89432476-89432498 ACAAAGTACTTGCCTGCTCCTGG + Intergenic
1131824693 15:96309410-96309432 ACCAACTCCCTTCCTACTTCTGG + Intergenic
1132033704 15:98461149-98461171 GCTATGTCCTTTCCTGGTTTTGG - Intronic
1132582457 16:691239-691261 ACCAAGCCCTTTCCTGCCTCAGG + Intronic
1133544040 16:6787764-6787786 ACTAAGTCCTTTACAACTCCAGG - Intronic
1133567049 16:7005856-7005878 ACTAAATTCTTCCCTTCTTCTGG + Intronic
1135503626 16:23017854-23017876 ACCAAGTCTGTTCTTGCTTCAGG - Intergenic
1137099317 16:36356294-36356316 AATATGTCCTTTTCTGCTTTTGG - Intergenic
1138856581 16:60700912-60700934 ACTAAGTGCCTGGCTGCTTCGGG - Intergenic
1139314840 16:66059351-66059373 ACAAAGTCCGTTTCTGCTCCAGG + Intergenic
1141781458 16:86164632-86164654 TCAATGTCCTTTCCTGCTTCAGG - Intergenic
1141802348 16:86319368-86319390 TCTCACTCTTTTCCTGCTTCTGG - Intergenic
1143956400 17:10673460-10673482 ACAAAGGCCTGCCCTGCTTCGGG + Exonic
1144755884 17:17680591-17680613 ACCAAGTTCTCTCCTGCCTCAGG + Intergenic
1146407937 17:32555818-32555840 ACTAAGTTCTTTTCTGCCTCAGG + Intronic
1146743504 17:35306754-35306776 ACTCACTCATTTCCTGCATCAGG + Intergenic
1146745655 17:35326628-35326650 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1147979053 17:44263517-44263539 ACTAAGCCCTTTCCTGTCCCAGG + Intronic
1149327592 17:55548018-55548040 ACAAAGCTCTTTCCTGCCTCAGG - Intergenic
1149663102 17:58346313-58346335 ACTGTTTCTTTTCCTGCTTCAGG - Exonic
1150199198 17:63335725-63335747 ACTATGTCTTTTCCTGTTCCTGG - Intronic
1151635798 17:75347047-75347069 AGTAAGTCCTTTCCTTCTCCAGG + Intronic
1152720054 17:81918988-81919010 ACTAATGCCTGTCCTGCCTCTGG - Exonic
1153174180 18:2351927-2351949 ACTCACTCCTTTCCTGCATCAGG - Intergenic
1156410847 18:36827480-36827502 ACTAAGCGGGTTCCTGCTTCAGG - Intronic
1156498501 18:37541720-37541742 ACAAAGCCCATTCCTGCCTCCGG + Intronic
1156503598 18:37575313-37575335 ACTGAGGCATTTCCTGCCTCGGG + Intergenic
1157045235 18:44094828-44094850 ACTCAGTCATTTCCTGCATCAGG + Intergenic
1157207364 18:45711982-45712004 TCTCAGTACTGTCCTGCTTCAGG + Intergenic
1157776170 18:50398038-50398060 ACTCACTCATTTCCTGCATCAGG + Intergenic
1157933413 18:51848144-51848166 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1162377652 19:10314769-10314791 ACCAAGCTCATTCCTGCTTCGGG - Intronic
1164732646 19:30517918-30517940 CCCAAGTCCTTTCCTATTTCGGG - Intronic
1165396303 19:35565520-35565542 ACCAAGGTCGTTCCTGCTTCAGG + Intergenic
1166960025 19:46491700-46491722 ACACTGTCCTTTGCTGCTTCGGG - Exonic
1168637105 19:58004700-58004722 GGTAAGTCCATTCCTGCTTCAGG + Intronic
924992565 2:325530-325552 GCTATGTCATTTCCTGCTTTTGG + Intergenic
925952683 2:8929828-8929850 ACTCACTCATTTCCTGCATCAGG + Intronic
926322466 2:11758844-11758866 GCTAAGTCACTTCCTGTTTCTGG + Intronic
928772212 2:34716434-34716456 ATTATGTCCATTCCTGCTTTTGG + Intergenic
930055495 2:47248963-47248985 ACTTAGTGGTTTCCAGCTTCAGG + Intergenic
930574016 2:53124073-53124095 GTTATGTCCTTTCCTGCTTTAGG + Intergenic
930608383 2:53515654-53515676 ACAAACTCACTTCCTGCTTCTGG + Intergenic
930824570 2:55683200-55683222 ATTAATTTCTTTCCTGCCTCTGG + Intronic
934020574 2:87947427-87947449 ACTCACTCATTTCCTGCATCAGG + Intergenic
936283014 2:111159203-111159225 TTTAACTTCTTTCCTGCTTCTGG + Intronic
937324479 2:120982167-120982189 ACTAAGTTCTTTCTGGCTTGGGG - Intronic
937529620 2:122812183-122812205 ATTACGTCCTTTCCTGGTTTTGG - Intergenic
939085300 2:137711085-137711107 ACTCACTCATTTCCTGCGTCAGG - Intergenic
939320560 2:140615018-140615040 ACTAACTCCTTCCTTGCTTGGGG + Intronic
940431641 2:153598310-153598332 AGCAAGTTCTTTCCTGCCTCAGG + Intergenic
940996943 2:160159660-160159682 ACTGAGTCCTTTGCTGCCTCAGG + Intronic
941631317 2:167887922-167887944 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
942636851 2:178016767-178016789 ATTAAGCTTTTTCCTGCTTCAGG - Intronic
943638967 2:190338481-190338503 ACCACCTCTTTTCCTGCTTCTGG - Intronic
943952113 2:194144068-194144090 ACGAAGTCCTTCCCTACTTTTGG - Intergenic
944515924 2:200511499-200511521 GCTGAGTCCTTTCCTGCCTGAGG - Intronic
945600978 2:211864346-211864368 AGTGACTGCTTTCCTGCTTCTGG + Intronic
945798863 2:214399396-214399418 ACTTCATCCTTTCCTACTTCAGG - Intronic
945806430 2:214495587-214495609 CCTTAGTCTATTCCTGCTTCAGG + Intronic
945809194 2:214527550-214527572 AGCAAGTTCTTTCCTGCCTCAGG + Intronic
947226204 2:227842855-227842877 ACAAAGCCCTTTCTTGCTTGGGG + Intergenic
948375713 2:237519045-237519067 TCTAAGACCTTTTCTCCTTCTGG + Intronic
1169397633 20:5247784-5247806 TCTATGTCCTTTCCTGGTTTTGG + Intergenic
1173683867 20:44909473-44909495 ACTAAGGCCTTTCTTGGTACTGG - Intergenic
1174259699 20:49284964-49284986 AATAAGTTCGTTCCTGCCTCAGG + Intergenic
1174572491 20:51512008-51512030 ACACAGTCCTTCCCTGCCTCAGG + Intronic
1174576263 20:51539858-51539880 AGTAAGTGCTTTCCAGATTCTGG + Intronic
1175395449 20:58656069-58656091 CCTAAGTCCTGTTCTGCTGCAGG + Intronic
1175399044 20:58689591-58689613 ACCATGTCCTTTACTACTTCAGG + Intronic
1177054301 21:16280794-16280816 AATGAGTCCTTTCCAGCTTTGGG + Intergenic
1177574550 21:22935024-22935046 TCTAAGTCTTTTCATGTTTCTGG + Intergenic
1178523178 21:33303141-33303163 ACTCAGTTCTTTCCTACTCCTGG + Intergenic
1180945749 22:19692209-19692231 AGTGAGTCCTTTCATGCTCCTGG - Intergenic
949507968 3:4744542-4744564 CCTAACTGCTTTCCTGCTTCAGG + Intronic
949643495 3:6066797-6066819 ACTCACTCATTTCCTGCATCAGG + Intergenic
949939557 3:9144357-9144379 ACCAAGTTCTTTTCTGCCTCAGG + Intronic
950379510 3:12599600-12599622 ACTCAGTCCTCTCCTCCTCCTGG + Intronic
951491343 3:23272895-23272917 TATCAGTCTTTTCCTGCTTCGGG - Intronic
952461918 3:33536475-33536497 ACTATGCACGTTCCTGCTTCAGG - Intronic
953102672 3:39844934-39844956 ACTCAGCCTTTTCTTGCTTCAGG + Intronic
953195484 3:40728565-40728587 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
953866783 3:46590570-46590592 ATTACGTCCTTTCCTGGTTTTGG - Intronic
957445114 3:80307033-80307055 ACTCACTCATTTCCTGCATCAGG + Intergenic
957673599 3:83338650-83338672 ACTCAGTCTTTTCCTGGGTCTGG + Intergenic
957875882 3:86146217-86146239 TCCAAGTTCTTTCCTGCTCCAGG - Intergenic
957916269 3:86692180-86692202 ACTCACTCATTTCCTGCATCAGG - Intergenic
958796231 3:98709241-98709263 ACTCACTCATTTCCTGCATCAGG - Intergenic
958969616 3:100597458-100597480 ATTAAGTCCTTTCTTGGTTTTGG + Intergenic
959223725 3:103554910-103554932 ACTCACTCATTTCCTGCATCAGG - Intergenic
959566209 3:107835202-107835224 ACAAAGTCCTTGCCTCCTACAGG - Intergenic
959609280 3:108276209-108276231 ACTTACTCATTTCCTGCATCAGG - Intergenic
959747184 3:109790413-109790435 GCTAAGTCCTTTAATACTTCTGG + Intergenic
960379543 3:116942884-116942906 ATTAAGCCCTTTCCTGATTTTGG - Intronic
961584692 3:127912640-127912662 ACTATTTTCTTTCCTGCTTCTGG - Intergenic
962061348 3:131930800-131930822 AATAAGTCCTTTGCTACTTAAGG - Intronic
962147143 3:132852025-132852047 GTTATGTCCTTTCCTGGTTCTGG + Intergenic
962731949 3:138291797-138291819 ACCAAGTTCACTCCTGCTTCAGG - Intronic
962861897 3:139411176-139411198 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
962999680 3:140667386-140667408 GTTAAGTCCTTTCCTGGTTTTGG - Intergenic
963455728 3:145544201-145544223 GTTATGTCCTTTCCTGCTTATGG + Intergenic
963492380 3:146017656-146017678 ACTCACTCATTTCCTGCATCAGG + Intergenic
963862856 3:150328801-150328823 GCTAAGTCCTTTTCTGCCTAAGG + Intergenic
963928835 3:150980478-150980500 ACTAAGGTCTTTGTTGCTTCTGG + Intergenic
964063814 3:152557595-152557617 AAAAAGTCATTTCCTGCTTTTGG + Intergenic
964210180 3:154217895-154217917 TCTCAGTCCTTTCCATCTTCCGG - Exonic
964222901 3:154367161-154367183 ACTCACTCCTTTCCTGCATCAGG + Intronic
964223639 3:154372200-154372222 ACTCACTCCTTTCCTGCATCAGG + Intronic
964635681 3:158856136-158856158 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
964917386 3:161853959-161853981 ACTCACTCATTTCCTGCATCCGG - Intergenic
965330580 3:167369803-167369825 GCTAAGTCCTTTCATCCTTTAGG - Intronic
965345449 3:167543312-167543334 ATTATGTCCTTTCCTGTTTTTGG - Intronic
965874078 3:173296240-173296262 ATTATGTCCTTTCCTGGTTTGGG + Intergenic
966692589 3:182756857-182756879 TTTAAGTGCTTTGCTGCTTCTGG - Intergenic
967622368 3:191649475-191649497 ACTCACTCATTTCCTGCATCAGG + Intergenic
967692918 3:192497625-192497647 GCCAAGTTTTTTCCTGCTTCAGG + Intronic
967741280 3:193005201-193005223 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
968804070 4:2761429-2761451 ACCAAGTTCTCTCCTGCCTCAGG + Intergenic
968804080 4:2761506-2761528 ACCAAGTTCTCTCCTGCCTCAGG + Intergenic
968804090 4:2761583-2761605 ACCAAGTTCTCTCCTGCCTCAGG + Intergenic
969898101 4:10323629-10323651 ACTAAGTCATCTCCTGCTATAGG + Intergenic
970062731 4:12053198-12053220 ACTAAGTCCTTTCTTTCATTCGG - Intergenic
970159622 4:13175752-13175774 TCTAAGCCCTTTCCTGCCTGAGG + Intergenic
970247497 4:14078685-14078707 ACTAAGTCATTTTCTGACTCTGG + Intergenic
971260779 4:25054740-25054762 ACCAAGCCCTTTCCTGCCCCAGG - Intergenic
971980074 4:33740741-33740763 ACTCACTCATTTCCTGCATCAGG + Intergenic
972487515 4:39556356-39556378 ACCAAGTCCTTCCCTGCCCCAGG + Intronic
974195266 4:58566102-58566124 CCCAAGTTCTTTCCTACTTCAGG + Intergenic
974520283 4:62973761-62973783 ACTCACTCGTTTCCTGCATCTGG + Intergenic
974994682 4:69140153-69140175 ACTCACTCATTTCCTGCATCAGG + Intronic
975072868 4:70163959-70163981 ACTAACTGCTTTTCTACTTCGGG + Exonic
975185100 4:71392686-71392708 ATTATGTCCTTTCCTGGTTTGGG - Intronic
976363752 4:84210123-84210145 GTTAAGTCCTTTCCTGGTTTTGG - Intergenic
976634227 4:87271779-87271801 ACTAATTTCTTTCCTCCTTGTGG + Intergenic
978231854 4:106409452-106409474 ACTCACTCATTTCCTGCATCAGG + Intergenic
978524613 4:109652927-109652949 ACCAAGTCCCTGCCTGCTCCTGG + Intronic
980186025 4:129462318-129462340 ACTCACTCATTTCCTGCATCAGG - Intergenic
980392313 4:132162711-132162733 ACTCACTCATTTCCTGCATCAGG + Intergenic
980571279 4:134623296-134623318 ACTCAGTCATTTCCTGCATCAGG - Intergenic
981901178 4:149865650-149865672 ACTAAGTCCTTTAGTCCTTAAGG + Intergenic
982189455 4:152839249-152839271 ATTATGTCCTTTCCTGGTTTTGG + Intronic
982439683 4:155421344-155421366 ACTCACTCATTTCCTGCATCGGG + Intergenic
982675717 4:158373721-158373743 TTTAAGTCCTTTCCTGCTAGTGG + Intronic
984290563 4:177788958-177788980 ACTTACTCATTTCCTGCATCAGG + Intronic
984323837 4:178226864-178226886 ACTTACTCATTTCCTGCATCAGG - Intergenic
984722027 4:182981929-182981951 ATTATGTCCTTTCCTGGTTTTGG - Intergenic
985090001 4:186352825-186352847 CCTAAGTCCTGACCTGTTTCAGG + Intergenic
987130448 5:14855183-14855205 ACTAAAACCTTCCCTGATTCTGG + Intronic
987987197 5:25162600-25162622 ACTTACTCATTTCCTGCATCAGG + Intergenic
988216900 5:28286851-28286873 ACTCACTGATTTCCTGCTTCAGG + Intergenic
988719763 5:33865143-33865165 ATTATGTCCTTTCCTGGTTTTGG - Intronic
991141444 5:63248826-63248848 ACCATGTTCTTTCCTACTTCTGG - Intergenic
992190114 5:74283943-74283965 CCTAAGGCCTTTCCAGCCTCTGG + Intergenic
993416523 5:87639768-87639790 ACTAAGTCCCTTTTTGCTTAGGG - Intergenic
993607005 5:90003758-90003780 ATTATGTCCTTTCCTGGTTTTGG - Intergenic
994563396 5:101407883-101407905 ATTATGCCCTTTCCTGCTTTCGG - Intergenic
994908601 5:105872531-105872553 ACTCACTCATTTCCTGCATCAGG + Intergenic
996011060 5:118482357-118482379 ATTATGTCCTTTCCTGGTTTTGG - Intergenic
996992727 5:129655396-129655418 ATTTATTTCTTTCCTGCTTCTGG - Intronic
998118949 5:139560947-139560969 GCCAAGTCCCTTCCTCCTTCAGG + Intronic
998549298 5:143061842-143061864 AATAATGCCTTTTCTGCTTCTGG - Intronic
998883951 5:146674829-146674851 ACTAAGTCTTGTGCTTCTTCTGG - Intronic
999203924 5:149834996-149835018 AGCAAGTCCGTTCCTCCTTCTGG + Intronic
999365576 5:151021352-151021374 CCTGAGTCCTTACCTGCTCCTGG + Intronic
1000287020 5:159835656-159835678 GCTGATTCCTTTCCTTCTTCAGG - Intergenic
1001176870 5:169477794-169477816 CCTATGTCCTTTCCTGGTTTTGG + Intergenic
1001615713 5:173041996-173042018 ACTAAGTCAGTTCCTGGGTCGGG + Intergenic
1001733419 5:173977976-173977998 ATTATGTCCTTTCCTGGTTTTGG + Intronic
1002295547 5:178229022-178229044 ACCATATCCTTTCCTGCTACAGG + Intronic
1002630645 5:180573619-180573641 ACCAAGTTCTTTCCTGCCCCAGG - Intronic
1003511568 6:6785558-6785580 TTTAATTCCTTTCCTGCCTCTGG - Intergenic
1003966081 6:11253688-11253710 CCAAAGTCCATTCCTTCTTCTGG + Intronic
1006234468 6:32616486-32616508 ACTCACTCATTTCCTGCATCAGG + Intergenic
1006286551 6:33100129-33100151 ATTATGTCCTTTCCTGGTTTTGG - Intergenic
1006397726 6:33797971-33797993 ACCAGGCCCTCTCCTGCTTCAGG + Intronic
1008706155 6:54162299-54162321 ACTAAGCTCTTTCATGCTTCAGG - Intronic
1009424507 6:63499574-63499596 AGATAGTTCTTTCCTGCTTCAGG + Intergenic
1009870981 6:69451708-69451730 ACTCACTCATTTCCTGCATCAGG + Intergenic
1010181595 6:73092880-73092902 ATTATGTCCTTTCCTGGTTTTGG + Intronic
1010623576 6:78107165-78107187 ACTAAGGCCATTTCTTCTTCAGG + Intergenic
1011327450 6:86165109-86165131 GCTATGTCCTTTCCTGGTTTTGG - Intergenic
1012739748 6:103001107-103001129 ACTCACTCATTTCCTGCATCAGG - Intergenic
1013067157 6:106694852-106694874 ACTAAGGGTTTTACTGCTTCAGG + Intergenic
1013246189 6:108289684-108289706 ACTAGGTCCTTTCCTCCCTAGGG + Intergenic
1013431298 6:110057519-110057541 AAAAAGTCTTTCCCTGCTTCTGG + Intergenic
1013610744 6:111792766-111792788 GCTAGGTCCTCTCCTGCTTCTGG + Intronic
1013610841 6:111793738-111793760 GCTAGGTCCTCTCCTGCTTCTGG + Intronic
1013946151 6:115725045-115725067 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1014201819 6:118617159-118617181 ACTCACTCATTTCCTGCATCAGG + Intronic
1014203154 6:118626162-118626184 ACTCACTCATTTCCTGCATCAGG + Intronic
1014604203 6:123451769-123451791 ATTATGTCCTTTCCTGATTTTGG - Intronic
1015645182 6:135379793-135379815 ACCAAGTACATTCCTGTTTCAGG + Intronic
1015666121 6:135631051-135631073 ACCAAATCCTTTCCCGCTTTAGG - Intergenic
1016248345 6:142014716-142014738 ACTCATTCATTTCCTGCATCAGG + Intergenic
1016337190 6:143019420-143019442 ACTAAGTCCCTTCACTCTTCGGG - Intergenic
1016350268 6:143159190-143159212 ATTAAGCTCTTTCCTGATTCAGG - Intronic
1016382601 6:143500093-143500115 ACTTATTCCATGCCTGCTTCTGG - Intronic
1016471419 6:144378593-144378615 ACCCAGCCCTTTCCTGCCTCGGG - Intronic
1016833657 6:148456093-148456115 AGAAAGTCCTGACCTGCTTCCGG + Intronic
1017237851 6:152135960-152135982 ACTAAGTCCTTTCCTGCTTCTGG + Intronic
1017868382 6:158464812-158464834 TCTAGGTCTTTTCCTGATTCAGG - Intronic
1018168455 6:161123696-161123718 GTTATGTCCTTTCCTGCTTTTGG + Intergenic
1018559725 6:165089159-165089181 TCTAGGCCCTTTCCTGCTCCTGG + Intergenic
1020492923 7:8811505-8811527 AGAAAGTTCTTCCCTGCTTCCGG + Intergenic
1021262520 7:18475712-18475734 ACAAAGCCCTTTTGTGCTTCTGG - Intronic
1021388022 7:20056054-20056076 GTTAAGTCCTTTCCTGGTTTTGG - Intergenic
1021466281 7:20947353-20947375 ACTATGTCCTTTCCTGGTTTTGG - Intergenic
1021908380 7:25359297-25359319 ACTTGGTCCGTTCCTGCTTTGGG + Intergenic
1022599319 7:31742039-31742061 TCAAATTCCTTTCCTGTTTCAGG - Intergenic
1023520563 7:41046346-41046368 AGTGAGTCATTTCCTCCTTCTGG + Intergenic
1023657346 7:42437655-42437677 ATTAAGTCCTTCCCTGGTTTTGG + Intergenic
1023748623 7:43347988-43348010 GTTAAGTCCTTTCCTGGTTTTGG + Intronic
1024790111 7:52956390-52956412 ACTCACTCATTTCCTGCATCAGG + Intergenic
1026082312 7:67232731-67232753 ACTATTTCCTTTCCTGTTTCTGG - Intronic
1026694761 7:72581263-72581285 ACTATTTCCTTTCCTGTTTCTGG + Intronic
1028023082 7:85802907-85802929 ATAAAATCCTTTCCTGCTTCTGG + Intergenic
1028182721 7:87745286-87745308 ATTATGTCCTTTCCTGGTTTTGG + Intronic
1029274680 7:99397104-99397126 GTGAAGTCCTTTCCTGCTTGGGG + Intronic
1029526988 7:101100743-101100765 ACGGCGTCCTTCCCTGCTTCTGG + Intergenic
1030136173 7:106251878-106251900 ACTAAGGAGTTACCTGCTTCTGG + Intronic
1031148100 7:118019810-118019832 GCTATGTCCTTTCCTGGTTTTGG - Intergenic
1031351949 7:120743687-120743709 GCTGAGTTCTTTCCTTCTTCAGG - Intronic
1032512999 7:132486842-132486864 ACTCTGTCCTTACCTGCCTCAGG + Intronic
1032524739 7:132571462-132571484 ACTGATTTCTTCCCTGCTTCTGG + Intronic
1033399950 7:141013211-141013233 ACTGAGTCCCTTCCTCCTCCTGG - Intronic
1033400848 7:141023139-141023161 GGTAAGTCCTTTCCTGGTTTTGG + Intergenic
1033854098 7:145535455-145535477 CATAAGTCCTTGCCTACTTCTGG - Intergenic
1034376820 7:150652936-150652958 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1036978389 8:13441123-13441145 TCAAAGTCCTTTTCTGCATCTGG - Intronic
1037504288 8:19515179-19515201 GCCATGTCCTTTCCTGCCTCTGG + Intronic
1040783592 8:51139836-51139858 ACTCAGCCCTTTCCAGCTCCAGG + Intergenic
1042808062 8:72793441-72793463 ACTAAGCCCATTCCTGCTTAGGG - Intronic
1043496355 8:80805092-80805114 ACCTAGTCCTTGCCTACTTCAGG - Intronic
1044188216 8:89281884-89281906 TCCAAGTCCTTTCCTGATCCAGG + Intergenic
1044479521 8:92668873-92668895 ACCAAGCCCTTTGCTGCTTATGG - Intergenic
1045634572 8:104169124-104169146 GTTAAGTCCTTTCCTGGTTTTGG + Intronic
1045878216 8:107007649-107007671 GTTAGGTCCTTTCCTGCTTTTGG - Intergenic
1045882004 8:107051863-107051885 ACTGTGTCCCTTCCTGCCTCTGG - Intergenic
1046337868 8:112813707-112813729 ACTCACTCATTTCCTGCATCAGG - Intronic
1046448916 8:114361717-114361739 GTTATGTCCTTTCCTGGTTCTGG - Intergenic
1046814215 8:118566205-118566227 GCTATATCCTTTCCTACTTCAGG + Intronic
1047522497 8:125605968-125605990 TCTAAGTCTTTTCCTGATCCAGG - Intergenic
1047842650 8:128770230-128770252 GTTAAGTCCTTTCCTGGTTTTGG + Intergenic
1049188682 8:141273751-141273773 ACTATGTTCTTTTCTGCTTGAGG - Intronic
1049246344 8:141564800-141564822 AATAACTGCTTTCCTGCTCCTGG - Intergenic
1051095654 9:13462781-13462803 ATTTAGACCTTTCCTGCATCTGG + Intergenic
1052624609 9:30959160-30959182 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1055875170 9:80933503-80933525 ACTAATTCCTTTACTCCTTGTGG + Intergenic
1055905503 9:81289228-81289250 GCTATGTCCTTTCCTGGTTTTGG + Intergenic
1056110736 9:83392132-83392154 AATCAGTCCTTTCCTGCCTTGGG + Intronic
1056416821 9:86385359-86385381 TCTGAGGCCTTTCCTGCTTGGGG + Intergenic
1057981183 9:99665426-99665448 CCCAAGTACTTTCCTGCCTCGGG - Intergenic
1058540393 9:106006100-106006122 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1058662582 9:107280580-107280602 ACTAACTCCTTTTCATCTTCAGG - Intergenic
1059566758 9:115390225-115390247 ACCAAATTCTTTCCTGCCTCTGG - Intronic
1060476023 9:123987370-123987392 ACTAAGTTCATTCTTGCGTCAGG + Intergenic
1060809836 9:126605258-126605280 ATCAAGTTCTTTCCTGCTTCAGG + Intergenic
1061212325 9:129201086-129201108 ACCAAGGCCTTCCCTCCTTCGGG - Intergenic
1186027225 X:5326495-5326517 GCTAAGTCCGTTCCTGGTTGGGG + Intergenic
1187218854 X:17304272-17304294 ATTATGTCCTTTCCTGGTTTTGG + Intergenic
1188433613 X:30135253-30135275 GCAAAGACCTTTCCTGCATCAGG + Intergenic
1188939467 X:36219091-36219113 TCTAAGGCCTTTCCTGATCCAGG - Intergenic
1189088393 X:38051112-38051134 ACCAAGTTCTTTCCCACTTCAGG - Intronic
1191892041 X:65954160-65954182 ATTATGTCCTTTCCTGGTTTGGG + Intergenic
1191964984 X:66747980-66748002 ATTATGTCCTTTCCTGATTTTGG + Intergenic
1192169607 X:68846111-68846133 GATAAGTCCTTTCCTGTCTCTGG - Intergenic
1192543029 X:71991091-71991113 AATAAGTCCCTTCCTCTTTCTGG + Intergenic
1192820539 X:74640357-74640379 GCTATGTCCTTTCCTGGTTTTGG - Intergenic
1193405248 X:81092860-81092882 GTTAAGTCCTTTCCTGGTTTTGG - Intergenic
1193703093 X:84787810-84787832 ACTATGTCCTTTCCTTGTTTTGG + Intergenic
1194157126 X:90404785-90404807 AAGAAGTCCTTATCTGCTTCAGG + Intergenic
1194354132 X:92859875-92859897 ATTAAGTCCTTTCCTGGTTTTGG - Intergenic
1194615137 X:96091366-96091388 ATTATGTCCTTTCCTGGTTGTGG - Intergenic
1195013649 X:100756960-100756982 ATTATGTCCTTTCCTGGTTTTGG - Intergenic
1196542929 X:116930775-116930797 ACTCACTCATTTCCTGCATCAGG - Intergenic
1197575862 X:128210660-128210682 ACTCACTCATTTCCTGCGTCAGG + Intergenic
1198406829 X:136321455-136321477 AGTAAATACTTCCCTGCTTCTGG - Intronic
1199123947 X:144091702-144091724 ACTCACTCATTTCCTGCATCAGG - Intergenic
1200331105 X:155298884-155298906 GCTAAGTCCTTTAGTTCTTCAGG + Exonic
1200376716 X:155788582-155788604 ACAAAGTTTTATCCTGCTTCAGG + Intergenic
1200503456 Y:3981767-3981789 AAGAAGTCCTTATCTGCTTCAGG + Intergenic
1200662486 Y:5976896-5976918 ATTAAGTCCTTTCCTGGTTTTGG - Intergenic
1201226147 Y:11820800-11820822 GCCAAGTGCTTTCCTGCCTCAGG - Intergenic
1201583765 Y:15538008-15538030 ACTCACTTATTTCCTGCTTCAGG - Intergenic