ID: 1017237852

View in Genome Browser
Species Human (GRCh38)
Location 6:152135961-152135983
Sequence CTAAGTCCTTTCCTGCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017237849_1017237852 0 Left 1017237849 6:152135938-152135960 CCTGTTTTCTGTTCCTAAAGACA 0: 1
1: 0
2: 0
3: 26
4: 353
Right 1017237852 6:152135961-152135983 CTAAGTCCTTTCCTGCTTCTGGG 0: 1
1: 0
2: 0
3: 34
4: 299
1017237847_1017237852 24 Left 1017237847 6:152135914-152135936 CCGACTACACTCTGGTCACAATG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1017237852 6:152135961-152135983 CTAAGTCCTTTCCTGCTTCTGGG 0: 1
1: 0
2: 0
3: 34
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017237852 Original CRISPR CTAAGTCCTTTCCTGCTTCT GGG Intronic
901460809 1:9390450-9390472 CTAAGTTTTTACCTCCTTCTAGG + Intergenic
904033036 1:27544999-27545021 CTGAGTCCCTTCCTGCCTCCAGG + Intronic
905208924 1:36359866-36359888 GTAAGCCCTTTCCTGCTGCTGGG + Intronic
906168174 1:43703416-43703438 CTCTGCCCTCTCCTGCTTCTAGG - Intronic
907134649 1:52128519-52128541 CTATGTGTTCTCCTGCTTCTAGG + Intergenic
907264650 1:53250138-53250160 CTAACTCCCTACCAGCTTCTTGG + Intronic
907831727 1:58070752-58070774 CTCACTCCTGTCCTGCTTCTGGG - Intronic
908951350 1:69567163-69567185 TTAAGTCCTCTCCTCATTCTGGG - Intergenic
909018824 1:70409109-70409131 CTCAATCTCTTCCTGCTTCTTGG + Intergenic
910524201 1:88158757-88158779 GTAACTCCTTTCCTGCTTTTTGG + Intergenic
911257995 1:95654236-95654258 CTAATTGCTTTCCTGCATTTTGG + Intergenic
911543396 1:99185906-99185928 CTAAGGCCATTCCAGCTTCCAGG + Intergenic
911552303 1:99297980-99298002 GTAAGTCTTTGCATGCTTCTAGG + Intronic
912217409 1:107630839-107630861 CAAAGACCTTTCCTCCTTATTGG - Intronic
912757932 1:112340139-112340161 CCAAGCCCATTCCTGCTTCTAGG - Intergenic
913113429 1:115676170-115676192 ATAAGTCATTTCCCCCTTCTTGG - Intronic
913655868 1:120959052-120959074 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
914910667 1:151783375-151783397 CTAAGTCCTTTTATGCCTCCAGG + Intronic
915041778 1:152973833-152973855 CTAAGCCCTATCCAGTTTCTTGG + Intergenic
916988623 1:170218339-170218361 CCAAGTCCTAACCGGCTTCTTGG - Intergenic
917118104 1:171622733-171622755 CTAATTCCTCTTCTGTTTCTTGG + Intergenic
918029808 1:180795678-180795700 CTAAGTTCTTTCTTGGTTCACGG - Intronic
918127727 1:181598885-181598907 CTAGGCTCTTTCCTGCTTCCTGG + Intronic
918210025 1:182342310-182342332 ATAAGTCCATGCCTGCCTCTTGG + Intergenic
918404147 1:184194830-184194852 TTAACTCATTTCCTGCTTTTTGG + Intergenic
918488310 1:185053055-185053077 CTATGTCATTTCCTGTGTCTTGG - Intronic
919057347 1:192587585-192587607 CTTATTCTTTTCCTGCTTCTTGG - Intergenic
920164367 1:204025263-204025285 CTATGTCTTTTCCAGCTTCCAGG - Intergenic
920361785 1:205423129-205423151 TTCAGTCCTTTCCAGATTCTGGG + Intronic
921830671 1:219724573-219724595 CTAGGGCCTCTCCTGCTTGTGGG - Intronic
921958790 1:221012510-221012532 CTAACTTTTTTCCTGCTCCTCGG + Intergenic
922673082 1:227529142-227529164 TTATGTCCTTTCCTGGTTTTGGG + Intergenic
1066066495 10:31765045-31765067 CCAAGTCCTTTGCTCCTTCAGGG + Intergenic
1066528875 10:36314300-36314322 CTAAGTCATTTACTCTTTCTAGG + Intergenic
1070334113 10:75439395-75439417 CCAAGCACTTTCCTGCTTCTAGG + Intronic
1070590361 10:77796522-77796544 CTGAGGCCTGTCCTGATTCTGGG - Exonic
1070621925 10:78019493-78019515 CCAATTCCTTTCCTGGTGCTTGG + Intronic
1071611187 10:87032683-87032705 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1075177426 10:120178670-120178692 CTAAATCCTTTCCTATATCTTGG - Intergenic
1075479310 10:122766326-122766348 CTGAGTCATTTGCTGCTCCTGGG + Intergenic
1075567584 10:123515796-123515818 CTGAGTCCATCCCTGCCTCTGGG + Intergenic
1077274175 11:1695770-1695792 CTGAGTCCTGTCCTGATCCTGGG + Intergenic
1077274214 11:1695933-1695955 CTGAGTCCTGTCCTGATCCTGGG + Intergenic
1077274250 11:1696117-1696139 CTGAGTCCTGTCCTGATCCTGGG + Intergenic
1078846773 11:15125680-15125702 ATAAGTCTTTACCTGCTACTTGG + Intronic
1079478244 11:20854251-20854273 CCAAGTCCTTTACTGTCTCTGGG + Intronic
1081090923 11:38865757-38865779 CCAAGTCCCTTCCAGCTTGTAGG + Intergenic
1081784406 11:45736737-45736759 CAATGTCCTTTTCTGATTCTGGG - Intergenic
1081795723 11:45818024-45818046 CTACCTCCTTTCCTATTTCTGGG - Intergenic
1083601993 11:63954516-63954538 CTAAGGCCTTTCCTCTTTCCTGG + Exonic
1085748220 11:79133522-79133544 TTATGTCCTTTCCTGATTTTGGG - Intronic
1086733032 11:90271951-90271973 CTAATTCCTTTCTTTCTTCTTGG + Intergenic
1086832889 11:91587288-91587310 CTGAGTCAGTTCCTGCGTCTGGG - Intergenic
1086885456 11:92200389-92200411 CTTTGTCTTTTCCAGCTTCTAGG - Intergenic
1087505767 11:99019722-99019744 ATTAGTCTTTTCCTGTTTCTTGG - Intergenic
1088088985 11:106015343-106015365 CTAAGTCCTTTAATCCTTATAGG - Intronic
1088817915 11:113433989-113434011 CTAAGCCCCTTCCTGCCACTTGG + Intronic
1089000800 11:115050614-115050636 CTAAGTCCAGGGCTGCTTCTTGG - Intergenic
1092361743 12:7842459-7842481 AGAAGTCTTTTCCCGCTTCTCGG - Intronic
1092645502 12:10566675-10566697 CAAAGGCCTTTTCTGCATCTAGG - Intergenic
1092783423 12:12007632-12007654 CCAAGTCCTGTCCAGCTTCTGGG + Intergenic
1093278730 12:17163066-17163088 GTATGTGGTTTCCTGCTTCTGGG - Intergenic
1094195743 12:27748147-27748169 TTAAGCCCTTTCCGGCTTCAAGG + Intronic
1094424685 12:30305687-30305709 CTATCTCCTCTCCTGATTCTGGG + Intergenic
1094480987 12:30881296-30881318 CTAAGTCCTTTCTAGCTCTTAGG + Intergenic
1095224146 12:39659381-39659403 CTGACTCCTTTCCTTCTCCTTGG + Intronic
1096351572 12:50905226-50905248 ATAATTCCTTTCCCTCTTCTCGG + Intergenic
1098134903 12:67391853-67391875 CCAAGCCCTTTCCTGCCTCAGGG - Intergenic
1101877360 12:108604586-108604608 CCAAGCCCTTTCCTGCCTCACGG - Intergenic
1104282402 12:127389995-127390017 AGAAGTCTTTTCCTGCCTCTGGG + Intergenic
1104971146 12:132531174-132531196 CTGGGTCCTGTCCTGCTCCTGGG - Intronic
1104971151 12:132531192-132531214 CTGGGTCCTGTCCTGCTCCTGGG - Intronic
1104971156 12:132531210-132531232 CTGGGTCCTGTCCTGCTCCTGGG - Intronic
1105627233 13:22124663-22124685 CTAGGTTTTTTCCTACTTCTAGG + Intergenic
1106397242 13:29393060-29393082 CTACCTTCATTCCTGCTTCTTGG - Intronic
1106525962 13:30541636-30541658 CTAAGTAGTCTTCTGCTTCTTGG + Intronic
1107223456 13:38016439-38016461 CTCCTTCCTCTCCTGCTTCTTGG + Intergenic
1109105284 13:58242021-58242043 CTCAATCCTTTCCAGCTTCTGGG - Intergenic
1109145056 13:58769147-58769169 CAGTGTCCTTGCCTGCTTCTTGG + Intergenic
1110524124 13:76515995-76516017 CTCACTCCATTCCTCCTTCTAGG - Intergenic
1112945622 13:104923320-104923342 CTATGTCCTTTCCCGCTTTGGGG - Intergenic
1113543110 13:111124102-111124124 GTCAGTCCCTTCCTGTTTCTGGG + Intronic
1116049234 14:39782612-39782634 CAAACTCCTTTCCTATTTCTGGG - Intergenic
1116114602 14:40630536-40630558 CTAAGTCATTTCTTGCACCTCGG - Intergenic
1117106706 14:52404776-52404798 CAAAGTTCTTTCCTGCCTCAAGG + Intergenic
1118589680 14:67392238-67392260 CTCAGCCCTTCCCTTCTTCTGGG + Intronic
1119078673 14:71671379-71671401 CTTAGACTTTTCCTTCTTCTTGG - Exonic
1119116524 14:72027015-72027037 TTAAGACCTTTCCTTCTTTTTGG - Intronic
1119175614 14:72565863-72565885 CTTAATCCTTTCCCTCTTCTGGG - Intronic
1121255028 14:92524930-92524952 CTGAGCTCTTTCCTGCCTCTGGG + Intronic
1121526342 14:94621898-94621920 CTAGCTCCTTTCCTGCCTTTGGG + Intronic
1121576623 14:94994186-94994208 CTAGGTCCTTTCCTGCTTTGAGG + Intergenic
1121887214 14:97554463-97554485 CGAAAGCCTTTCCTGTTTCTTGG + Intergenic
1122260148 14:100513503-100513525 CTTAGTGCATTCCTGCTGCTAGG - Intronic
1122434387 14:101684418-101684440 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1123463571 15:20496389-20496411 CTCACTCCCTTGCTGCTTCTAGG - Intergenic
1123654491 15:22504036-22504058 CTCACTCCCTTGCTGCTTCTAGG + Intergenic
1124308401 15:28599232-28599254 CTCACTCCCTTGCTGCTTCTAGG + Intergenic
1125345766 15:38717131-38717153 CCAAGTCCTTTCCAGCCCCTAGG - Intergenic
1125830006 15:42708609-42708631 CTCAGTCTTTTCTTGCTTCGTGG + Intronic
1126190090 15:45870126-45870148 CTAAATGCATTCCTGCTTCTAGG + Intergenic
1126351666 15:47750756-47750778 CTGAGACCCTTCCTCCTTCTAGG - Intronic
1126748384 15:51850322-51850344 CTAAGGCCAATCCTGCCTCTTGG - Intronic
1127200861 15:56648439-56648461 CTTAGTCCTATCCAGTTTCTTGG + Intronic
1128289910 15:66470407-66470429 TTGAGTCTTTTCCTGCTTCTAGG - Intronic
1128666201 15:69539977-69539999 TCAGGTCCTTTCCTGCCTCTCGG + Intergenic
1128707721 15:69850050-69850072 GTAGGTCCTTTCCTGCTGATTGG + Intergenic
1128891103 15:71332481-71332503 CAGAGTCCTTTTCTCCTTCTAGG - Intronic
1129113544 15:73352356-73352378 CTAAGTTCTTCCCTGATTGTCGG - Intronic
1130880994 15:88055849-88055871 CTAAGTCTGTTCCAGCTGCTAGG - Intronic
1131000796 15:88938355-88938377 TTGAGTCTTCTCCTGCTTCTAGG + Intergenic
1131040262 15:89258108-89258130 CCAAGTTCTTTGCTGCTTCTTGG + Intronic
1131209560 15:90482143-90482165 CTAAGTGCCTTTCTGCTCCTTGG + Intronic
1131296695 15:91155527-91155549 GAAAGTCCTCTCCTGCATCTTGG - Intronic
1131824695 15:96309411-96309433 CCAACTCCCTTCCTACTTCTGGG + Intergenic
1132582459 16:691240-691262 CCAAGCCCTTTCCTGCCTCAGGG + Intronic
1133342642 16:5046682-5046704 CAAAGTCCTCTCTTTCTTCTTGG + Intronic
1138224814 16:55283834-55283856 CTGAGTCCCACCCTGCTTCTTGG + Intergenic
1140624143 16:76771339-76771361 CTGAGTTCCTCCCTGCTTCTTGG + Intergenic
1141046296 16:80718880-80718902 CTAAGTCCTTCCCTCCTTAGTGG - Intronic
1141533554 16:84663188-84663210 CTAAGTAGTTTCGTGCTGCTGGG + Intronic
1144854635 17:18261070-18261092 CCGTGCCCTTTCCTGCTTCTCGG + Intronic
1146407938 17:32555819-32555841 CTAAGTTCTTTTCTGCCTCAGGG + Intronic
1149007765 17:51823194-51823216 CTAACTCCTTTCCTGGCTGTTGG - Intronic
1149152026 17:53577990-53578012 CTCATTCCTTTACTTCTTCTAGG - Intergenic
1149676556 17:58469158-58469180 CTAAGTCTTTCTCTACTTCTGGG - Intronic
1153008630 18:518214-518236 TGGAGTCATTTCCTGCTTCTCGG + Intergenic
1153770370 18:8410482-8410504 CTAATTTGTTTCCTGTTTCTTGG - Intergenic
1154292795 18:13125117-13125139 TTAAGTATTTTCCAGCTTCTGGG + Intergenic
1155055431 18:22177733-22177755 CTTTGTCCTTTCCACCTTCTTGG + Intronic
1155145432 18:23079360-23079382 CCAAGTCTCTTGCTGCTTCTGGG + Intergenic
1155434388 18:25796278-25796300 CTCTGTCCTTTTCTTCTTCTAGG + Intergenic
1155673643 18:28402942-28402964 CAAAGTCCTTTCCTGCCTAAAGG - Intergenic
1157599112 18:48882656-48882678 CTAATCTCTTTCCTGCTTCAAGG + Intergenic
1157748430 18:50157518-50157540 TCAAGCCCTTTCCTGCCTCTGGG + Intronic
1157861120 18:51141076-51141098 CTAAGTACTTTTCTGCAACTTGG + Intergenic
1158165183 18:54532120-54532142 CTCAGTTCTTTCCCACTTCTAGG - Intergenic
1158339532 18:56450382-56450404 CTAAGTCATTTCCCACTTCAAGG - Intergenic
1159185499 18:64966873-64966895 CTAAGTGCTTTACTGGCTCTTGG - Intergenic
1159797282 18:72860218-72860240 CTGAGTGCTTCCCTGCTACTTGG + Intronic
1160281760 18:77497950-77497972 TTAAGCCCTTTCTTGCTTCCTGG + Intergenic
1160679446 19:406080-406102 CTATGGCCTTTCCTGCTGTTAGG - Exonic
1161111354 19:2472411-2472433 CTGAGTGCTTACCTGATTCTGGG + Intergenic
1161364576 19:3870920-3870942 CTCAGCCATCTCCTGCTTCTCGG + Intergenic
1161550176 19:4908527-4908549 CTAAGCCTTTTCCGGCCTCTGGG + Intronic
1163536235 19:17878197-17878219 CTCAGCTCTTTCCTACTTCTTGG - Intronic
1164732644 19:30517917-30517939 CCAAGTCCTTTCCTATTTCGGGG - Intronic
1168504755 19:56923929-56923951 CTAAGTGCTTTCTTACTTCCAGG + Intergenic
1168637106 19:58004701-58004723 GTAAGTCCATTCCTGCTTCAGGG + Intronic
926030870 2:9586945-9586967 CTTACTCCTTCTCTGCTTCTAGG - Intronic
926322467 2:11758845-11758867 CTAAGTCACTTCCTGTTTCTGGG + Intronic
926648062 2:15311603-15311625 TTAAGTCTGTTCTTGCTTCTTGG - Intronic
926867511 2:17375913-17375935 CCAAGTCTTTTCCTACTTCAAGG + Intergenic
929040956 2:37743930-37743952 GGGATTCCTTTCCTGCTTCTGGG - Intergenic
929283696 2:40111909-40111931 CTACATCCTTTCCTGCATCCAGG - Intronic
930824571 2:55683201-55683223 TTAATTTCTTTCCTGCCTCTGGG + Intronic
931546738 2:63396616-63396638 ATAAGCCCTTTCCTGCCACTTGG - Intronic
931815503 2:65896730-65896752 CTAATTTCTTTCCTGCTGGTAGG + Intergenic
933178313 2:79201416-79201438 TTGAGTTTTTTCCTGCTTCTAGG - Intronic
936671312 2:114660152-114660174 CTATTTCCTTCCCTGTTTCTTGG - Intronic
937175881 2:119934538-119934560 CTAAGTGCCTTCATGTTTCTAGG - Intronic
938175301 2:129120812-129120834 TTATGTCCTTTCCTGATTTTGGG + Intergenic
938739663 2:134219191-134219213 CTCAGCCATTTCCTGCTCCTGGG - Intronic
939026127 2:137015518-137015540 CTAGGTACTTTCAGGCTTCTGGG + Intronic
939343311 2:140928852-140928874 TTAAGCTCTTTCCTGCTTTTAGG - Intronic
939391890 2:141578782-141578804 CTAAGTTCCTTCCTGTCTCTAGG - Intronic
940996944 2:160159661-160159683 CTGAGTCCTTTGCTGCCTCAGGG + Intronic
941982480 2:171474304-171474326 CTACTTCCTTTCCTGTGTCTAGG - Intronic
942520072 2:176794551-176794573 CCAAGTGCATTCCTGCCTCTAGG + Intergenic
942892213 2:181004821-181004843 CTAAGGCCTTTATTGTTTCTTGG + Intronic
942999691 2:182310784-182310806 CAAACTCATTTCCTTCTTCTAGG + Intronic
943178442 2:184509465-184509487 CTTCTTCCTTTCCTGCTTTTGGG + Intergenic
944515923 2:200511498-200511520 CTGAGTCCTTTCCTGCCTGAGGG - Intronic
945600979 2:211864347-211864369 GTGACTGCTTTCCTGCTTCTGGG + Intronic
945879490 2:215311741-215311763 TTACGTACTTTCCAGCTTCTGGG + Intergenic
946169402 2:217885664-217885686 CTTACTCCTTTCCTGCCTCTTGG - Intronic
948303786 2:236931553-236931575 CTCATTCCTTTCCTGTCTCTAGG - Intergenic
948375714 2:237519046-237519068 CTAAGACCTTTTCTCCTTCTGGG + Intronic
948668864 2:239553620-239553642 CTGGGTCCTCTCCTGCCTCTGGG + Intergenic
1170916895 20:20635051-20635073 CTAAGTGCCTTCCAGCTACTGGG + Intronic
1172359200 20:34300600-34300622 CTAGGTTCTTTCCTGTTTCCAGG - Intronic
1172404715 20:34679390-34679412 CTCAGTCCGTTCCTTCTGCTTGG - Intergenic
1178823368 21:35994861-35994883 CTATCTGCTTTCCTGCATCTGGG + Intronic
1180964859 22:19782755-19782777 CTAGCTCCTTCCCTGTTTCTGGG + Intronic
1182167507 22:28191120-28191142 CCACCTCATTTCCTGCTTCTAGG + Intronic
1183484664 22:38082534-38082556 CGAAGTCCCTTCCTGCCTGTGGG - Intronic
1184717745 22:46291453-46291475 CCAAGTCCTGTCCTGCTACCAGG + Intronic
1185016566 22:48346633-48346655 CAAAGTCGTCTCCTGCCTCTGGG - Intergenic
949507969 3:4744543-4744565 CTAACTGCTTTCCTGCTTCAGGG + Intronic
953057953 3:39403347-39403369 CTAAGTTCTTCTCTGCTCCTGGG + Intergenic
953866782 3:46590569-46590591 TTACGTCCTTTCCTGGTTTTGGG - Intronic
955254432 3:57315671-57315693 CCTACTCCTTTCCTGCTTCCTGG - Intronic
955497271 3:59547066-59547088 TTAAGCCCTTTCCTACTTCTTGG + Intergenic
957875880 3:86146216-86146238 CCAAGTTCTTTCCTGCTCCAGGG - Intergenic
958262573 3:91399097-91399119 TTAAGTCATTTCATTCTTCTTGG - Intergenic
958540061 3:95459667-95459689 CTAATTTCTTTAATGCTTCTGGG - Intergenic
959588351 3:108048034-108048056 CTATGTCCTTTCCTTTTCCTTGG - Intronic
959741791 3:109729200-109729222 CTAAGTGCTTTCATTTTTCTTGG + Intergenic
960915225 3:122688180-122688202 CTAAATCCTTATCTTCTTCTTGG + Intronic
961028564 3:123582912-123582934 TTAAGTGCTTTCCTGTTTCGTGG - Intronic
962436950 3:135375502-135375524 CCAAGTTCCTTCCTGCTTCCAGG + Intergenic
962866737 3:139453474-139453496 CTAGGTCCTTTCCTTCCTCATGG - Intronic
964210179 3:154217894-154217916 CTCAGTCCTTTCCATCTTCCGGG - Exonic
964811351 3:160667963-160667985 TTTAGTCCTTTCTTGCTTCTAGG + Intergenic
965078861 3:164012175-164012197 CTATGTCCTTTTCTTCTTTTAGG - Intergenic
965386607 3:168053971-168053993 CGATGTCCTTCCCTACTTCTGGG - Intronic
965504254 3:169494995-169495017 CTAGATCCTTTTCTCCTTCTTGG + Intronic
967735572 3:192948317-192948339 CTCTGTCTTTTCCAGCTTCTGGG + Intergenic
968807131 4:2781594-2781616 GTGAGTTTTTTCCTGCTTCTAGG - Intergenic
970238266 4:13981065-13981087 CTAAGGCTTTTTCTGCTTTTTGG + Intergenic
971469601 4:27007511-27007533 CTCCTTCCTTTCCTTCTTCTAGG + Exonic
972599690 4:40561171-40561193 TTAAGTCCCATCCTGCCTCTTGG - Intronic
973573289 4:52261820-52261842 CTAAGTCCTAGGCTGCATCTTGG + Intergenic
974195268 4:58566103-58566125 CCAAGTTCTTTCCTACTTCAGGG + Intergenic
974697094 4:65390158-65390180 CTAAGTACTTTGCTACTTCTAGG - Intronic
975409511 4:74033018-74033040 CTGAGTCACTTGCTGCTTCTAGG - Intergenic
976333006 4:83853206-83853228 CTAAGCCCCACCCTGCTTCTTGG + Intergenic
978524615 4:109652928-109652950 CCAAGTCCCTGCCTGCTCCTGGG + Intronic
980239491 4:130155121-130155143 CTCAGTCCTTTACTTCCTCTTGG - Intergenic
984602619 4:181745815-181745837 CACAGTCCTTTTGTGCTTCTGGG - Intergenic
985925253 5:3011050-3011072 CTAAGCCATTTCCTCTTTCTAGG + Intergenic
987130449 5:14855184-14855206 CTAAAACCTTCCCTGATTCTGGG + Intronic
987369313 5:17178963-17178985 CTAAGACCTTTACTGCTCCCCGG + Intronic
988497667 5:31758622-31758644 CTAAGTCCCTTCCTGCTTGAAGG - Intronic
990504738 5:56433131-56433153 ATCAGTCCTTTACTCCTTCTGGG - Intergenic
993602828 5:89949829-89949851 CAAAGTCCTTTGATGTTTCTTGG - Intergenic
994535292 5:101022821-101022843 CTCAGACCTATTCTGCTTCTAGG - Intergenic
994551981 5:101246445-101246467 CTAAGTGTGTTCCTGCTTCAAGG + Intergenic
994927363 5:106134339-106134361 CTAGGCTCTTTCCTGTTTCTGGG - Intergenic
995418206 5:111933834-111933856 CTAAGTCCTCCCTAGCTTCTGGG - Intronic
995512635 5:112923657-112923679 GTAAGCCCATTCCTGCCTCTGGG + Intergenic
996678642 5:126205734-126205756 TTATGTCCTTTCCTGGTTTTGGG - Intergenic
997153552 5:131526500-131526522 CTAAGTTGTTTCCTGATACTTGG + Intronic
998423438 5:142007760-142007782 CAAGGTTCTTTCCTGATTCTAGG - Intronic
998883950 5:146674828-146674850 CTAAGTCTTGTGCTTCTTCTGGG - Intronic
999164331 5:149535121-149535143 CTCATTTCTTTCCTACTTCTTGG + Intronic
999203925 5:149834997-149835019 GCAAGTCCGTTCCTCCTTCTGGG + Intronic
999693719 5:154170345-154170367 CCATGTTCTTTCCTTCTTCTGGG - Intronic
999847282 5:155498218-155498240 CAAACTCCTTTCCTTTTTCTAGG - Intergenic
1000554655 5:162711365-162711387 GTAAGTTATTTCCTGCTACTAGG + Intergenic
1003599601 6:7504890-7504912 GTAAGTCATTTCCTGTCTCTAGG + Intergenic
1003796205 6:9607939-9607961 CTAAGTCATTTCCGAATTCTAGG + Intronic
1004290003 6:14358195-14358217 ATAATCCCTTTCCTGCTTGTTGG - Intergenic
1006079625 6:31557941-31557963 CTCTGTGCTTCCCTGCTTCTTGG + Intronic
1007422470 6:41728000-41728022 CTCAGCCCTTTCCACCTTCTGGG - Intronic
1008202195 6:48604210-48604232 CTAAGTCTTTTTCTGGTACTTGG - Intergenic
1009181462 6:60522898-60522920 TTAAGTCATTTCATTCTTCTTGG + Intergenic
1009495187 6:64337650-64337672 TTATGTCCTTTCCTGGTTTTGGG - Intronic
1010183945 6:73121270-73121292 CTTGGTTCTTGCCTGCTTCTAGG - Intronic
1011021277 6:82815879-82815901 TTAAGTTCTTTCCAGATTCTTGG - Intergenic
1011756158 6:90500354-90500376 CTAAGTTGTATTCTGCTTCTTGG + Intergenic
1013431299 6:110057520-110057542 AAAAGTCTTTCCCTGCTTCTGGG + Intergenic
1013563163 6:111327228-111327250 CTAATTTCTTCCCTGCCTCTCGG - Intronic
1014178621 6:118358372-118358394 CTATGTCCTTTTCTGCTTGTTGG - Intergenic
1015430360 6:133123587-133123609 CTGACTCCTTGCCTGCTTCCTGG + Intergenic
1015949132 6:138533704-138533726 CTAAGCACTTTCCTGGCTCTTGG - Intronic
1017237852 6:152135961-152135983 CTAAGTCCTTTCCTGCTTCTGGG + Intronic
1017673525 6:156791096-156791118 CTAAGTAGTTTCATGCTTCATGG + Intronic
1017872359 6:158497714-158497736 CTAGGGCCTTTCCTGCTATTGGG + Intronic
1018217534 6:161544581-161544603 CTAAGCCTTTTCATTCTTCTTGG - Intronic
1020258455 7:6516162-6516184 TTAAGCTCTTCCCTGCTTCTAGG - Intronic
1022159555 7:27695523-27695545 CTGAGCCCTACCCTGCTTCTTGG - Intergenic
1022457284 7:30568640-30568662 TTCAGTTTTTTCCTGCTTCTAGG + Intergenic
1023713229 7:43016699-43016721 CTCAGTCCTTTTCTGATTCCAGG + Intergenic
1024097761 7:45998115-45998137 CTCGGTCATCTCCTGCTTCTGGG - Intergenic
1024224221 7:47313451-47313473 CAAAGTTCTGTGCTGCTTCTTGG - Intronic
1024888110 7:54167887-54167909 TTCAGTTTTTTCCTGCTTCTAGG - Intergenic
1027616457 7:80430469-80430491 CTAGGCCCTTTCCTGGATCTAGG - Intronic
1028778035 7:94702688-94702710 CTATTTCTTTTCCTCCTTCTTGG - Intergenic
1028975176 7:96904797-96904819 CTAAGTTTCTTCCGGCTTCTAGG - Intergenic
1029526989 7:101100744-101100766 CGGCGTCCTTCCCTGCTTCTGGG + Intergenic
1031148099 7:118019809-118019831 CTATGTCCTTTCCTGGTTTTGGG - Intergenic
1032993314 7:137417987-137418009 CTTAGTCTGTTCCTGCTGCTAGG - Intronic
1034228542 7:149501189-149501211 CTACCTCCTTTCCTTCTGCTGGG + Intergenic
1034613547 7:152394422-152394444 CTAAGCACATTCCTGCCTCTGGG + Intronic
1034697819 7:153069620-153069642 CTAAGGCCATTCCTTCTTCTTGG - Intergenic
1034851236 7:154495847-154495869 CTGTGTCCCTTCCTGCATCTGGG - Intronic
1035221203 7:157407497-157407519 CTAAGCCCGTTCCTGCCTCCAGG - Intronic
1035964338 8:4173831-4173853 CTCAGTTCTTCCCTACTTCTTGG + Intronic
1036978388 8:13441122-13441144 CAAAGTCCTTTTCTGCATCTGGG - Intronic
1037552949 8:19992793-19992815 CCAGGTGCTTTCCTGCCTCTGGG - Intergenic
1037782500 8:21879963-21879985 CTAAATCCTTTCCTGATGCCAGG - Intergenic
1037960976 8:23098004-23098026 CTGAGACCTGTCCTGCTTTTAGG - Intronic
1038976343 8:32700923-32700945 CTATGTCCCCTCCTGCCTCTGGG + Intronic
1039583855 8:38688792-38688814 CTAATTCCTTTCCCACTTCATGG - Intergenic
1040675001 8:49738302-49738324 TTAAGTACTTTCTTGCTTCCTGG - Intergenic
1040809617 8:51437359-51437381 TTATGTCCTTTCCTGGTTTTTGG - Intronic
1045913367 8:107436449-107436471 CTTAGTTCTTTCCTCTTTCTGGG + Intronic
1045985893 8:108249412-108249434 CTAAGTCCCTTCCTGTCTCATGG - Intronic
1046415049 8:113902596-113902618 CTAATTCTTAGCCTGCTTCTAGG - Intergenic
1046814216 8:118566206-118566228 CTATATCCTTTCCTACTTCAGGG + Intronic
1047487724 8:125347357-125347379 CTGAGTCATTACCTTCTTCTAGG + Intronic
1048084975 8:131167564-131167586 CTAACCCATTTCCTGCTGCTTGG + Intergenic
1048527666 8:135218107-135218129 CTAATTCCACTCCTGCTCCTTGG + Intergenic
1048927569 8:139284429-139284451 CTCACTCCGTTCCTGATTCTTGG + Intergenic
1050142530 9:2531287-2531309 CTAATTACTTTGCTGCTTGTAGG + Intergenic
1053372525 9:37575024-37575046 CAAAGTCCTGTCGTCCTTCTGGG + Intronic
1056416822 9:86385360-86385382 CTGAGGCCTTTCCTGCTTGGGGG + Intergenic
1057910188 9:99014272-99014294 TTAAATTCTTTCCTGCTTCTAGG - Intronic
1057981181 9:99665425-99665447 CCAAGTACTTTCCTGCCTCGGGG - Intergenic
1059020508 9:110571413-110571435 CTCTGTCCTTTTCTCCTTCTTGG + Intronic
1059566756 9:115390224-115390246 CCAAATTCTTTCCTGCCTCTGGG - Intronic
1060044090 9:120326244-120326266 CTATCTCCTTTCCAGCCTCTTGG - Intergenic
1060159022 9:121343172-121343194 TTAATACCTTTCCTTCTTCTAGG - Intronic
1061043973 9:128154389-128154411 CTCAGGCCTGTCCTGCTCCTTGG - Intergenic
1061614512 9:131771083-131771105 CTAAGTCTTCCCCAGCTTCTAGG - Intergenic
1186027226 X:5326496-5326518 CTAAGTCCGTTCCTGGTTGGGGG + Intergenic
1186253172 X:7691119-7691141 CTAAGTTCTTCCCTGCTTCGTGG + Intergenic
1187171657 X:16858012-16858034 CTCAGTCCTTGCATGCCTCTAGG + Intronic
1191080816 X:56507754-56507776 TTATGTCCTTTCCTGGTTTTGGG - Intergenic
1191612800 X:63135007-63135029 TTAAGTTTTTTCCTGCTTCTAGG + Intergenic
1191623497 X:63243919-63243941 TTAAGTTTTTTCCTGCTTCTAGG - Intergenic
1192169606 X:68846110-68846132 ATAAGTCCTTTCCTGTCTCTGGG - Intergenic
1192452319 X:71252214-71252236 CTAAGACCTTTACAGCTTTTTGG - Intronic
1192543030 X:71991092-71991114 ATAAGTCCCTTCCTCTTTCTGGG + Intergenic
1192895213 X:75435811-75435833 CTATGTTCTTTCCTGGTTTTTGG + Intronic
1193255690 X:79346172-79346194 TTATGTCCTTTCCTGATTTTTGG - Intergenic
1193270131 X:79519048-79519070 CCAAGTCCTTTCTGGCTTGTAGG - Intergenic
1193318992 X:80098095-80098117 TTGAGTTTTTTCCTGCTTCTAGG + Intergenic
1193346891 X:80414062-80414084 TTGAGTTTTTTCCTGCTTCTAGG - Intronic
1193974350 X:88099145-88099167 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1194159353 X:90431918-90431940 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1194485483 X:94480593-94480615 CTGAGTTTTTTCCTGCTTCTAGG + Intergenic
1194840117 X:98729488-98729510 CAAAGTCCCTTTCTTCTTCTCGG - Intergenic
1196869827 X:120102110-120102132 TGAAGTTGTTTCCTGCTTCTAGG + Intergenic
1197874838 X:131091678-131091700 CCAAGTCCTGTCCTTATTCTGGG + Intergenic
1198406828 X:136321454-136321476 GTAAATACTTCCCTGCTTCTGGG - Intronic
1198607333 X:138356170-138356192 CTCAGACCTCTCCTTCTTCTGGG - Intergenic
1198854023 X:140996627-140996649 CTGAGTTTTTTCCTGCTTCTAGG + Intergenic
1198877990 X:141248478-141248500 CTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1199139912 X:144298207-144298229 CTAAGTCATATCCTGATTCGTGG - Intergenic
1200447651 Y:3284970-3284992 CCATGTCCTTTCCTGGTTTTTGG + Intergenic
1200505653 Y:4008887-4008909 TTGAGTTTTTTCCTGCTTCTAGG - Intergenic
1201469968 Y:14322362-14322384 CTAAGTTCTTCCCTGCTTTGTGG + Intergenic