ID: 1017238138

View in Genome Browser
Species Human (GRCh38)
Location 6:152138689-152138711
Sequence TAGGTGGCCACATTTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017238131_1017238138 -6 Left 1017238131 6:152138672-152138694 CCTGACCCCGGAGAGCCTAGGTG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1017238138 6:152138689-152138711 TAGGTGGCCACATTTTGAGGAGG No data
1017238129_1017238138 0 Left 1017238129 6:152138666-152138688 CCTTATCCTGACCCCGGAGAGCC 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1017238138 6:152138689-152138711 TAGGTGGCCACATTTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017238138 Original CRISPR TAGGTGGCCACATTTTGAGG AGG Intronic
No off target data available for this crispr