ID: 1017238586

View in Genome Browser
Species Human (GRCh38)
Location 6:152142655-152142677
Sequence GTAATCATACTGACATCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017238586_1017238588 -4 Left 1017238586 6:152142655-152142677 CCCAGTGATGTCAGTATGATTAC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1017238588 6:152142674-152142696 TTACCATAAAACTATATCATAGG No data
1017238586_1017238590 12 Left 1017238586 6:152142655-152142677 CCCAGTGATGTCAGTATGATTAC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1017238590 6:152142690-152142712 TCATAGGTATTTTTAAAAAGTGG 0: 1
1: 0
2: 8
3: 63
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017238586 Original CRISPR GTAATCATACTGACATCACT GGG (reversed) Intronic
902275083 1:15333783-15333805 GTAATCATACCTGCCTCACTGGG - Intronic
912445734 1:109734783-109734805 CTATTCCTCCTGACATCACTGGG + Exonic
913488367 1:119355067-119355089 CTTATGATACTGATATCACTTGG + Intergenic
915812853 1:158934176-158934198 GTAATGACACTGATAACACTGGG - Intronic
915888624 1:159749965-159749987 GTAATCATCATGACATGATTTGG + Intergenic
916084704 1:161259775-161259797 CTAACCAGACTGACTTCACTTGG - Intronic
919192972 1:194247186-194247208 GAAATCTTACTTATATCACTAGG - Intergenic
920837142 1:209521606-209521628 GTAGTCATCCAGACACCACTCGG + Intergenic
922090538 1:222391183-222391205 GTGATGATAATGAAATCACTGGG - Intergenic
922653480 1:227360656-227360678 GTCATCAGACTGACATCAATAGG + Intergenic
923807517 1:237274323-237274345 GAAATCATCCAGACATCACTAGG - Intronic
924439496 1:244074506-244074528 ATAATAATACTGAAATCACAGGG + Intergenic
1065079350 10:22112266-22112288 ATAATAATACTGACCTCACAGGG + Intergenic
1067916531 10:50405916-50405938 CTATTCATAGTGACATCACTAGG - Intronic
1067916674 10:50407290-50407312 CTATTCATAGTGACATCACTAGG - Intronic
1075354624 10:121759932-121759954 TTAATCATACTGAAAACACAAGG + Intronic
1075482201 10:122791451-122791473 GGAATTACAGTGACATCACTGGG - Intergenic
1075560269 10:123463073-123463095 GTAATCAAGCTGATTTCACTGGG + Intergenic
1076016064 10:127028437-127028459 GTAATAATACTGATACCACATGG - Intronic
1085912908 11:80849697-80849719 GTCTTCATATTGACATCTCTTGG - Intergenic
1091518492 12:1211525-1211547 GTGATCATAATGATATAACTTGG + Intronic
1095459908 12:42432434-42432456 GGAATCATACTGTCTTCTCTGGG + Intronic
1095693018 12:45111928-45111950 CTAATAATACAGACTTCACTAGG + Intergenic
1097535022 12:60857495-60857517 GTAATCATAATGAAAATACTAGG + Intergenic
1097797694 12:63881292-63881314 GTACACAGACTAACATCACTGGG + Intronic
1098323349 12:69274868-69274890 GAAATAATACTACCATCACTGGG + Intergenic
1098609648 12:72440079-72440101 TGAATCATACTTGCATCACTGGG + Intronic
1099171950 12:79375535-79375557 GGAATCAAACTGACATGATTAGG + Intronic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101796193 12:107976648-107976670 GTAATCATTCCTACCTCACTGGG - Intergenic
1103397724 12:120620836-120620858 GAAGACATACTCACATCACTGGG - Intergenic
1104240054 12:126979635-126979657 ATAATAATACTGATATCACAGGG + Intergenic
1106502051 13:30338330-30338352 GTAATCATACCAACCTCGCTGGG + Intergenic
1108178440 13:47818351-47818373 CTACTGTTACTGACATCACTGGG + Intergenic
1115436325 14:33378756-33378778 CTGATCATAATGAAATCACTGGG - Intronic
1118499237 14:66342723-66342745 GTAATTATTCTGATATCACTTGG - Intergenic
1120195293 14:81475545-81475567 ATAAACATACTGACATCAGTAGG + Exonic
1128579287 15:68797657-68797679 GCAAAAATAATGACATCACTTGG + Intronic
1128603351 15:69016107-69016129 GTAATAATACCTACCTCACTGGG + Intronic
1129930201 15:79404252-79404274 GTAATCATCCTGCCACCACATGG + Intronic
1131745286 15:95440852-95440874 TGAATTATAATGACATCACTGGG + Intergenic
1138324074 16:56147161-56147183 TTAATAAGACTGACATAACTTGG + Intergenic
1140678494 16:77359668-77359690 GTACTCATACTGACCTTACAGGG - Intronic
1141777141 16:86131853-86131875 TTAATAATACTGACTTCACAGGG - Intergenic
1149969365 17:61201239-61201261 GTAATCATACTTCCATCTCATGG + Intronic
1153756514 18:8288866-8288888 GTGTTCATACTCACATCACCAGG + Intronic
1155013600 18:21808661-21808683 GTAATCCTACTGAATTCAGTAGG - Intronic
1164041314 19:21494920-21494942 GTCATCAAAGTCACATCACTTGG - Intergenic
1168726474 19:58585341-58585363 GGAGTCACACTGACATCAGTTGG + Intergenic
927261150 2:21092275-21092297 GTAATAACACCCACATCACTGGG - Intergenic
936746500 2:115582736-115582758 TTACTTATACTAACATCACTGGG - Intronic
938653789 2:133410454-133410476 ATAATCATACTTACATCAAAGGG + Intronic
941008093 2:160268048-160268070 GAAATCAAAATGACATTACTTGG + Intronic
942212984 2:173690041-173690063 TTTATCACACTCACATCACTAGG + Intergenic
943479024 2:188395408-188395430 GTACTCATACTGACCTCCCATGG + Intronic
948955898 2:241290882-241290904 GTAACGATACTGACATTATTAGG - Intronic
1170379441 20:15740855-15740877 GTATTCATAATGTGATCACTCGG + Intronic
1171014694 20:21529644-21529666 GTAATCCTCTTAACATCACTTGG + Intergenic
1173868484 20:46327925-46327947 GTAATCATACTTAATGCACTGGG + Intergenic
1173904308 20:46614665-46614687 ATAATCATACCTACATCACTAGG - Intronic
1178443837 21:32620530-32620552 GAAAGCATAATGAAATCACTAGG + Intergenic
1179724126 21:43332333-43332355 GTAGACACAATGACATCACTCGG + Intergenic
955840072 3:63103167-63103189 GTAATAATGCTTACATTACTGGG + Intergenic
955902847 3:63775706-63775728 ATACTCATACTGACACCATTAGG + Intergenic
957200007 3:77121493-77121515 GCAATCTTACTGACCTCTCTTGG + Intronic
960210284 3:114956460-114956482 GAAGACATACTGAAATCACTAGG + Intronic
963282349 3:143397166-143397188 GCAAGCATACTGACATCCTTTGG + Intronic
963517502 3:146326654-146326676 GGAATCACACTGGCATCTCTTGG + Intergenic
963574819 3:147047004-147047026 ACAATCATTCTGACAGCACTGGG + Intergenic
964425222 3:156545948-156545970 GTAAGCAACCTGACTTCACTGGG - Intronic
966278584 3:178204900-178204922 GTTTTTATACTGACAGCACTGGG + Intergenic
970707247 4:18819349-18819371 GAAACCATACTGATATGACTGGG + Intergenic
973248442 4:48036009-48036031 TTAAAAATACTGACATTACTTGG + Exonic
977995558 4:103494892-103494914 TTAATCATACTGCCTTAACTTGG - Intergenic
980223829 4:129955276-129955298 GTAATCATTCTGACTTGTCTTGG - Intergenic
982018382 4:151178562-151178584 CTAATCATACCTACATCACAAGG - Intronic
982503822 4:156193788-156193810 ATAATCCTATTGACATCACTGGG + Intergenic
982549739 4:156782985-156783007 TTAATCACACTCACAGCACTTGG - Intronic
984023396 4:174514187-174514209 TGAATCATACTTACATCTCTTGG - Intronic
988290953 5:29285854-29285876 TTAATCCTAATGTCATCACTTGG - Intergenic
988428035 5:31086839-31086861 TCAATCATACTGAGATCAGTTGG - Intergenic
988871488 5:35395719-35395741 GTAATTATACTAACTGCACTAGG + Intergenic
990926865 5:61036037-61036059 TTTATCTTATTGACATCACTTGG + Intronic
991972184 5:72151807-72151829 ATAATCATTGTGTCATCACTGGG + Intronic
992957637 5:81926612-81926634 GTAAGCATCCTGACAACATTAGG + Intergenic
993413759 5:87601337-87601359 GGTATCATACTAACATCCCTTGG - Intergenic
994674872 5:102808102-102808124 GTATGCATACTGACATCATCAGG - Intronic
996229742 5:121047513-121047535 GTAATCATTTTGACATTAGTTGG + Intergenic
996307448 5:122065222-122065244 GTAATCATTCTGCACTCACTGGG - Exonic
996331470 5:122334230-122334252 GAAATCATTCTGACCTCACAGGG - Intronic
997247905 5:132366840-132366862 GTGATGATACTTATATCACTTGG - Intergenic
998607716 5:143652274-143652296 GTACTCATACTGAGGTCAGTGGG + Intergenic
1000750474 5:165089378-165089400 GTCATCATATTGATATCACCAGG + Intergenic
1001335505 5:170793190-170793212 GAGATCATACTGACATCACAGGG - Intronic
1006098651 6:31671963-31671985 ATAATCGTACTGACAGCACTGGG - Exonic
1011703494 6:89978198-89978220 TTAATCAAACTGACAGAACTGGG + Intronic
1012593788 6:101016660-101016682 GTAATCATTCTAACAGCAGTAGG + Intergenic
1013043934 6:106464680-106464702 TTAATGGTACTGTCATCACTAGG - Intergenic
1014904460 6:127009475-127009497 CTAATCATAGTGATATTACTTGG - Intergenic
1017238586 6:152142655-152142677 GTAATCATACTGACATCACTGGG - Intronic
1021461357 7:20890726-20890748 ATAATCATACTGTAATCAGTAGG - Intergenic
1023542606 7:41282506-41282528 ATAATCAGACTGACCTCACAAGG - Intergenic
1031433873 7:121708951-121708973 GTATTTATTTTGACATCACTAGG - Intergenic
1033879722 7:145865612-145865634 GGAATCATCCTTACATCCCTGGG + Intergenic
1038337187 8:26655107-26655129 GGAATCCTACTAACAGCACTTGG - Intronic
1038607981 8:29029291-29029313 GTAATCTTACTGACATTAAAAGG - Intronic
1040278839 8:46027373-46027395 ATTATCATACTCAGATCACTTGG + Intergenic
1043548979 8:81347457-81347479 GGAATCACAGTGAAATCACTAGG - Intergenic
1046235119 8:111414108-111414130 GAAAACATACTGAAATCTCTGGG - Intergenic
1048570502 8:135650883-135650905 ATAATGATACTGACTTGACTTGG - Intronic
1051228804 9:14931843-14931865 GTAATCATACAGATTTTACTAGG - Intergenic
1052362943 9:27579312-27579334 TTAATCCTCCTGACATCTCTAGG + Intergenic
1056263873 9:84876814-84876836 GTATACATTCTGACAGCACTTGG - Intronic
1060586732 9:124791110-124791132 CTGATCATACTGCCATTACTGGG - Intronic
1062446117 9:136595737-136595759 GAAATCATGCTCACAGCACTCGG + Intergenic
1187855854 X:23635906-23635928 GTGGTCATACTGACATCCCACGG - Intergenic
1189407388 X:40736804-40736826 ATATTCTTACTGTCATCACTTGG + Intergenic
1189639971 X:43058110-43058132 GTAATTATATTAACATTACTAGG - Intergenic
1194309487 X:92286893-92286915 ATAATCATACTTATCTCACTGGG + Intronic
1195934840 X:110115039-110115061 GTAATGATTCTGTCATTACTGGG + Intronic
1197374825 X:125669738-125669760 ATAATCACACTGACCTCACATGG - Intergenic
1200617779 Y:5401148-5401170 ATAATCATACTTATCTCACTGGG + Intronic
1201534913 Y:15036526-15036548 GTAAACATATTGACATAATTGGG - Intergenic