ID: 1017239150

View in Genome Browser
Species Human (GRCh38)
Location 6:152147761-152147783
Sequence CAGAGCTTCCACTCTAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017239150_1017239155 13 Left 1017239150 6:152147761-152147783 CCCACACTAGAGTGGAAGCTCTG 0: 1
1: 0
2: 6
3: 36
4: 264
Right 1017239155 6:152147797-152147819 AACTGTGTATCCCTAGAACCTGG No data
1017239150_1017239154 -10 Left 1017239150 6:152147761-152147783 CCCACACTAGAGTGGAAGCTCTG 0: 1
1: 0
2: 6
3: 36
4: 264
Right 1017239154 6:152147774-152147796 GGAAGCTCTGGGAGAAGAAGAGG 0: 1
1: 0
2: 3
3: 59
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017239150 Original CRISPR CAGAGCTTCCACTCTAGTGT GGG (reversed) Intronic
901127579 1:6940427-6940449 CAGGGCTTCCTCCCCAGTGTGGG - Intronic
901615728 1:10538083-10538105 CAGAGCTTAAATTCTAGTGGAGG + Intronic
902277501 1:15350238-15350260 CAGAGCTTCCATCCTAGCGCAGG + Intronic
902546295 1:17192809-17192831 CAGAGCTCCCAATCTAGGGCTGG - Intergenic
902592348 1:17484123-17484145 CAGGGCTTCCATTCTAATGTGGG + Intergenic
904449589 1:30602277-30602299 TTGACCTTCCACTCTATTGTAGG + Intergenic
905463673 1:38137252-38137274 GAGAGCTTCCCCTCTAGGGTTGG + Intergenic
905898983 1:41568141-41568163 CAGAGCTTACAGTCTGGTGGAGG + Intronic
908204592 1:61832692-61832714 CAGAGTTTCCATTCTAGCTTAGG + Intronic
908285852 1:62599559-62599581 CAGAGCTTACATTTTAGTGCAGG - Intronic
909350538 1:74647936-74647958 AGGAGCTTCCACTCTAGTTGGGG - Intronic
910183990 1:84515515-84515537 AAGAGCTTCAGCTCTTGTGTTGG + Intergenic
910836910 1:91523186-91523208 CAGAGCTTAAATTCTAGTGAGGG + Intronic
910903345 1:92146407-92146429 CAAAGGTACCACTCCAGTGTGGG - Intronic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
912755024 1:112317093-112317115 CAGAGCTTCCACCCTAAGGAGGG - Intergenic
915244277 1:154545101-154545123 CAAAGCTGCCTCTCAAGTGTTGG + Intronic
916052595 1:161046979-161047001 CACAGGTCCCACTCTAGTGAAGG - Exonic
917669368 1:177257639-177257661 CAGAGGTTGCACTCTGGTGGAGG + Intronic
917958432 1:180124060-180124082 AAGAGCTTACATTCCAGTGTAGG + Intergenic
918439717 1:184555080-184555102 CAGAGCTGCCACTCCAGTGAAGG - Intronic
920423904 1:205858050-205858072 CGCAGCCTCCAATCTAGTGTTGG + Intergenic
921693001 1:218174497-218174519 CGGAGCTTAGACTCTAGTGAAGG - Intergenic
923613468 1:235516417-235516439 CGGAGCTTCCATTCTAGTGGGGG + Intergenic
923806512 1:237263845-237263867 CAGAACTTGCATTCTAGTGGGGG + Intronic
1063256741 10:4336708-4336730 GAGAGTTTCCACTCTACCGTAGG - Intergenic
1064328557 10:14373102-14373124 CAGAGCTCCCAGTCTAGTGTGGG - Intronic
1064810995 10:19198011-19198033 GAAAGCTTAGACTCTAGTGTGGG - Intronic
1065353037 10:24812582-24812604 CAGAGCTTCCATCCTCATGTAGG + Intergenic
1067165779 10:43865572-43865594 CACAGTTTCCACTCGTGTGTAGG - Intergenic
1068246061 10:54370428-54370450 TTGAGCTTCCAGTCTAGTGAAGG - Intronic
1068494010 10:57762241-57762263 CAGAGCTTACATTTTAGTGAGGG - Intergenic
1068744582 10:60515943-60515965 CAGAGCTTGCAATCTAGTAAGGG + Intronic
1068984187 10:63091841-63091863 CAGAGCTTACATTATAGTGTGGG + Intergenic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1069938660 10:71937943-71937965 GAGAGCTTACAGTCTAGTGGGGG - Intergenic
1070733848 10:78850206-78850228 TAGAGCTTACACTCCAGTGGAGG - Intergenic
1071530806 10:86389404-86389426 TGGAGCTTACAGTCTAGTGTAGG - Intergenic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1072350016 10:94547783-94547805 CAGAGCTAACATTCCAGTGTAGG + Intronic
1072767336 10:98106151-98106173 CAGATCTTCCAGTCCAGTGAGGG + Intergenic
1073489378 10:103842755-103842777 TAGAGCTTACATTCTGGTGTGGG - Intronic
1073938239 10:108660996-108661018 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
1074350919 10:112736317-112736339 CATAGCTTACAATCTAGTGGTGG - Intronic
1075203147 10:120423004-120423026 TAGAGTTTCTATTCTAGTGTGGG + Intergenic
1076411187 10:130252224-130252246 CAGAGCTTCTCCTCTATTGTGGG - Intergenic
1078396734 11:10988118-10988140 CAGAGCTTACATTCTAGAGGAGG - Intergenic
1078447399 11:11414677-11414699 CAGAGCTCCCAGCGTAGTGTGGG - Intronic
1078596807 11:12694201-12694223 CAGAGCTTTCTGCCTAGTGTCGG - Intronic
1078987917 11:16612980-16613002 CAGAGCTTCCATTCAATCGTGGG - Intronic
1079023403 11:16926488-16926510 CAGTGCTTCTACTCTAGTCAGGG + Intronic
1079057354 11:17217859-17217881 TTGAGCTTACATTCTAGTGTGGG - Intronic
1079122912 11:17697831-17697853 CACAGCTCCCACGCTAATGTGGG - Intergenic
1079335022 11:19563707-19563729 CAGATCTTCCATTGTAGTGGCGG - Intronic
1079684273 11:23337428-23337450 ATGAGCTTCCACTATAGTGGTGG - Intergenic
1080685851 11:34514076-34514098 CAGAGATTCCACCCTGGTGCCGG + Intergenic
1083168653 11:60908421-60908443 TGGAGCTTACACTCTACTGTGGG + Intergenic
1084561505 11:69908072-69908094 CAGAGCTTCAACTTTAGGTTGGG + Intergenic
1085068435 11:73519426-73519448 CAGAGTTTACACTCTAGAGGAGG + Intronic
1085082679 11:73647283-73647305 CCCAGCTTCCAGTCTAGTGAGGG - Intronic
1085227752 11:74937818-74937840 CGGAGCTTCCACTCTAGAGAGGG - Intronic
1086235290 11:84622987-84623009 CATAGCCTCCAATCTAGTGCAGG + Intronic
1086284751 11:85234102-85234124 CAGAGCTTACCCTCTAGTAGGGG + Intronic
1088189782 11:107215687-107215709 CAGAGCTGCCCCTCTCATGTAGG - Intergenic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1089758408 11:120704578-120704600 CAGAGCTTACATTCTAGTAGAGG - Intronic
1092708837 12:11312537-11312559 CAGGGCTTCCACTCACGTCTAGG - Intergenic
1093521638 12:20057891-20057913 AAGAGCTTGCAGTCTAATGTTGG + Intergenic
1093997087 12:25654402-25654424 CAGAGCTTACACTGTAGGGTTGG + Intergenic
1097376042 12:58844223-58844245 CAGAGCTTACATGCTAGTGAAGG + Intergenic
1098874347 12:75851221-75851243 CAGTGCTTCCAGACTTGTGTTGG - Intergenic
1099154412 12:79156958-79156980 CAGAGCTTCACCTCTAGAATTGG + Intronic
1100360179 12:93870572-93870594 CAGAGCTTCCACCCTACTGGTGG - Intronic
1100521269 12:95378468-95378490 CAGAGCTTGCACTCCAGCCTGGG - Intronic
1101314264 12:103615022-103615044 CAAACCGTACACTCTAGTGTGGG + Intronic
1101656744 12:106728508-106728530 TAGAGCTTACAATCTAGTGGAGG + Intronic
1102744331 12:115237035-115237057 CAGAGTTTACAATCTAGTGATGG + Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1106801305 13:33259128-33259150 AGGAGCTTCCATTCTAGTGGGGG - Intronic
1106983112 13:35313649-35313671 TAGAGTTTACAGTCTAGTGTGGG + Intronic
1107531288 13:41284430-41284452 CAGAGATTGCACTCTAGCTTGGG + Intergenic
1107959129 13:45543265-45543287 CAGAGCTCCAACTGTAGTGGGGG - Intronic
1109408170 13:61927814-61927836 CAGAGCTTCCTCTCTAGTAAGGG + Intergenic
1111784735 13:92772112-92772134 CACAGCTGCCACCCTAGTCTCGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112493096 13:99884605-99884627 CAGGGCTTCCAGTCTAATGGCGG - Intronic
1114296703 14:21335762-21335784 CAGAGCTTGCACTCCAGCCTGGG + Intronic
1114688362 14:24556699-24556721 CAGAGTTTCCTCTCTAATGTGGG - Intergenic
1115813924 14:37142296-37142318 AAGAGCTACCACTCTGGAGTTGG - Intronic
1117491975 14:56257268-56257290 CAGAGCTTACAGTGTAATGTGGG + Intronic
1118056196 14:62081997-62082019 GAGAGCTTGCAGTCTAGTGGTGG + Intronic
1118131722 14:62973050-62973072 CAGATGTACCACTCTGGTGTGGG + Intronic
1118598564 14:67454914-67454936 CAGAGGTTGCACTCTAGCCTGGG - Intronic
1118783079 14:69023241-69023263 CAGAGTTCTCACTCTTGTGTTGG - Intergenic
1121220420 14:92280781-92280803 CGGAGCTTACATTCTAGTGGGGG + Intergenic
1202837344 14_GL000009v2_random:87912-87934 CAGAGCATCCATTCTGGTGGAGG + Intergenic
1124080740 15:26492649-26492671 TGGAGCTTGCATTCTAGTGTGGG - Intergenic
1125360650 15:38860977-38860999 TAGAGCTTACATTCTAGTGTGGG + Intergenic
1126994773 15:54428573-54428595 CAGAGCTTACAGTCTAAGGTGGG - Intronic
1127695559 15:61443234-61443256 CATAGCTTCCCCTCTTTTGTTGG + Intergenic
1129683245 15:77670464-77670486 CAGAGCTTCCACTCTTGTGAGGG - Intronic
1131140234 15:89971442-89971464 TTGGGCTTCCACTCTGGTGTAGG - Intergenic
1132326221 15:100973021-100973043 CCGAGCTTCCACTCTAGAAGGGG - Intronic
1134506107 16:14808457-14808479 CAGAGCTTCTATTCTAGTGAAGG - Intronic
1134574443 16:15320313-15320335 CAGAGCTTCTATTCTAGTGAAGG + Intergenic
1134727972 16:16435990-16436012 CAGAGCTTCTATTCTAGTGAAGG - Intergenic
1134939464 16:18275836-18275858 CAGAGCTTCTATTCTAGTGAAGG + Intergenic
1135643919 16:24144917-24144939 TGGAGCTTCCACTCTTGTGAGGG + Intronic
1135784813 16:25339381-25339403 CAGAGCTTTCAGTCTAGACTGGG + Intergenic
1136407815 16:30058938-30058960 CAGGGCTTCCATTCTGGTGATGG + Exonic
1137394119 16:48105005-48105027 TAGAGCTTGCAGTCTAGTCTGGG - Intronic
1137464087 16:48692206-48692228 CAGAGCTTGTATTCTAGTGGGGG - Intergenic
1138095446 16:54207532-54207554 TGGAGCTTCCAGTCTAGTGGGGG - Intergenic
1140128167 16:72134915-72134937 TAGAGCTTGCACTCCTGTGTAGG - Intronic
1140766383 16:78163314-78163336 CTGAGTTTCCACTCTTGTGAAGG + Intronic
1141281710 16:82635114-82635136 CAGAGCTTATAGTCTAGTGGAGG - Intronic
1143720946 17:8808919-8808941 CAGGGCTTCAGCTCTAGTGATGG + Intronic
1146208634 17:30924757-30924779 CAGAGCTTACATTCTAGTGTGGG + Intronic
1146281349 17:31546802-31546824 CAGATGTACCACTCTAGTGGAGG - Intergenic
1146387879 17:32393669-32393691 TAGAGCTTCCATTCTAGTTTTGG + Intergenic
1146895644 17:36539754-36539776 CAGAGCTTGCAATCTAGTGGAGG + Intronic
1147477275 17:40724168-40724190 TAGAGCTTACATTCTAGTGTAGG - Intergenic
1148746794 17:49922897-49922919 CAGAGCTTCTGCCTTAGTGTGGG - Intergenic
1149207799 17:54268515-54268537 CAAAACTTCCAATCTTGTGTTGG + Intergenic
1149355848 17:55838540-55838562 CAGAGCTTACAATCTAGTGAGGG - Intronic
1149497236 17:57126912-57126934 CAGGGCATCCAGTCTATTGTAGG - Intergenic
1151121349 17:71796676-71796698 CAGAGCTGACATTCTAGTGGTGG - Intergenic
1154280174 18:12995614-12995636 TAGAGCTTACATTCTAATGTGGG + Intronic
1155348449 18:24882256-24882278 AAGAGCTTACACTCTAGTGGTGG - Intergenic
1155630199 18:27884105-27884127 CAAATATACCACTCTAGTGTGGG + Intergenic
1157091660 18:44643881-44643903 CAGAGCTTACAGTCTACTGTTGG + Intergenic
1159141612 18:64402422-64402444 CAGAGCTTACCTTCTAGTGAGGG - Intergenic
1159271541 18:66159468-66159490 CAGAGCTTCTACTCCAGCCTTGG + Intergenic
1159563108 18:70016867-70016889 AAGAGCTTACCTTCTAGTGTGGG + Intronic
1163021060 19:14480932-14480954 CAGAGCTGACACGCTAATGTGGG - Intronic
1163082423 19:14953553-14953575 CAGAGCTTACATTCTAGTATGGG + Intronic
1164968555 19:32509827-32509849 TAGAGCCTCCACTCTATTGTGGG - Intergenic
1165547867 19:36556768-36556790 CAGAGCCACCATTCTAGTGCTGG - Intronic
1167289725 19:48617717-48617739 CAGATCCTCCATTCTAGTGCTGG - Intronic
1168357569 19:55711990-55712012 CAGAGAATCCACTCTAGCTTTGG + Intronic
927114929 2:19890349-19890371 CAGAGCTTGCCTTCCAGTGTGGG + Intergenic
927170582 2:20366261-20366283 GGGAGCTTACACTCTAGTGCAGG - Intergenic
930364574 2:50423677-50423699 AAGAGCTTCCATTCCTGTGTTGG + Intronic
931653740 2:64491278-64491300 CAGAACTTACATTCTAGTGGTGG + Intergenic
932120539 2:69095686-69095708 CAGACCATCCACTCCATTGTTGG - Intronic
932396422 2:71451963-71451985 AAGAGCTTCCACTTCAGTGAGGG - Intergenic
935722286 2:105990126-105990148 CACAGCCTCCATACTAGTGTTGG + Intergenic
935947534 2:108299965-108299987 AGGAGCTTCCACTCTAGTGTGGG - Intronic
936466270 2:112753968-112753990 TAGAGCTTACACTCTAGTGGAGG - Intronic
937097010 2:119242074-119242096 GAGGGCTTACAATCTAGTGTGGG - Intronic
938990490 2:136623331-136623353 TAGAACTTACACTCTAGTGGGGG - Intergenic
939427198 2:142054652-142054674 AGGAGCTTCCACTCTACTGAAGG - Intronic
939629091 2:144513408-144513430 CAGAGTTTCCACTAAAGGGTTGG - Intronic
939839829 2:147173461-147173483 GAGAGCTTGCAGTCTAGTGATGG + Intergenic
942620149 2:177836598-177836620 CAAAGCTTCCACACTGGGGTAGG - Intronic
942695006 2:178632181-178632203 CATAGCTTCTACTCTAATTTGGG + Exonic
944300052 2:198113428-198113450 CAGAGCTGACAGTCTAGTGGGGG + Intronic
947680078 2:232022681-232022703 CAGAGCTTACAGTCTCGTGAGGG - Intronic
1169358135 20:4924879-4924901 CAGGGCTTTCATTCTGGTGTGGG - Intronic
1169864228 20:10182898-10182920 TAGAGCTTACATTCTAGTGCAGG - Intergenic
1170843142 20:19940173-19940195 CAGAGCTTACCTTCTAGTGGTGG - Intronic
1172010063 20:31841414-31841436 CAGAGCTACCACACTTTTGTGGG + Intergenic
1172381431 20:34496029-34496051 CAGAGGTTGCACTCTAGCCTGGG + Intronic
1174711706 20:52713248-52713270 GAGAGCTTATATTCTAGTGTTGG + Intergenic
1174723628 20:52839106-52839128 TGGAGCTTACATTCTAGTGTGGG + Intergenic
1175322109 20:58095737-58095759 CAGGGCTTCAATTCTAGTGAGGG - Intergenic
1178373659 21:32048905-32048927 CAGAGCTTACATTCCAGTGACGG + Intergenic
1179181544 21:39049481-39049503 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
1182219851 22:28749513-28749535 CAGAACTTCCAGTCTAATGAGGG - Intronic
1183977051 22:41518305-41518327 CAGAGCTCACACCCTAGTGCAGG - Intronic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
954193903 3:48984648-48984670 CAATGCTTCCACTCTAGGGCAGG + Exonic
954886985 3:53883393-53883415 CGGAGCTTACATTCTAGTGTGGG - Intergenic
956294190 3:67694161-67694183 CAGAGCTTACAGTCTTGTGGAGG + Intergenic
956897954 3:73683057-73683079 GAGAGCTTGCATTCTAGTGAGGG + Intergenic
957311646 3:78527544-78527566 CAGAGCTCACAATCTAGTGGTGG + Intergenic
957740057 3:84253891-84253913 AAGAGCTTGCAATCTAGTGAAGG - Intergenic
958880518 3:99664182-99664204 GAGAGCTTCCATTCAAGTGAGGG - Intronic
959672136 3:108990657-108990679 CAGAGCTTCCATTCTAGTTGGGG - Intronic
960249687 3:115438220-115438242 CAGAGCATCCAATCCAGTATAGG - Intergenic
961724856 3:128921076-128921098 CACAGCCTCCATACTAGTGTTGG + Intronic
963747881 3:149143477-149143499 CAGAGCCTTCATTCTAGTGATGG - Intronic
965179843 3:165388354-165388376 CACAGACTCCAATCTAGTGTTGG - Intergenic
965580614 3:170263753-170263775 CACTACTTGCACTCTAGTGTGGG + Intronic
966268160 3:178071609-178071631 CGTAGCTTCCATTCTGGTGTGGG + Intergenic
966706943 3:182926448-182926470 TGGAGCTTACATTCTAGTGTTGG - Intergenic
967332706 3:188307715-188307737 GGGAGCTTACACTCTAGTGAGGG + Intronic
967687961 3:192439584-192439606 CTGAGCTTACAATCTAGTGGTGG + Intronic
970268968 4:14322250-14322272 AAGAGCTTATATTCTAGTGTAGG - Intergenic
970953866 4:21787876-21787898 CAGAGCTGACATTCTAGTGGGGG + Intronic
970988713 4:22188631-22188653 CAGACCTTACATTCTAATGTGGG - Intergenic
971054650 4:22898496-22898518 AAGAGCTTGGACTCTAGTGCTGG + Intergenic
971124839 4:23742194-23742216 AAAAGTTTCCAGTCTAGTGTGGG + Intergenic
971709883 4:30097308-30097330 CAAAGCTTACAATTTAGTGTGGG - Intergenic
971952380 4:33369985-33370007 TAGAGATTACATTCTAGTGTGGG - Intergenic
971963215 4:33516617-33516639 CGTAGCTTCCATACTAGTGTTGG - Intergenic
972092337 4:35302639-35302661 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
972256119 4:37357665-37357687 CGGAGCTTACATTCTAATGTGGG + Intronic
974827278 4:67147668-67147690 CAAAACATCCACTGTAGTGTGGG + Intergenic
974887054 4:67832607-67832629 AAGAGCTTACACTCGAATGTTGG - Intronic
975702885 4:77083439-77083461 TACAGCTTCCGCTCTAGTGATGG + Intergenic
977027131 4:91833941-91833963 CAGAGTTTCCACTGTGGTTTGGG + Intergenic
978243662 4:106547395-106547417 CATAGGTACCACTCTGGTGTGGG + Intergenic
978366695 4:107990105-107990127 CAGAGCTTCCACCTCAGGGTGGG - Intronic
981688457 4:147480988-147481010 CAGACCTTCCACTCCACTCTGGG - Exonic
981766267 4:148253806-148253828 TAGAGCTTACATTCTAGTGAGGG - Intronic
982741331 4:159060375-159060397 CAGGGCTGCCACTCTAGGCTGGG - Intergenic
983074793 4:163312780-163312802 CAAATGTTCCACTCTGGTGTGGG - Intergenic
983911440 4:173244034-173244056 CAGAACTTACAGTCTAGTGCAGG + Intronic
984168443 4:176332125-176332147 AAGAGCTTACAGTCTAGTATAGG - Exonic
984243752 4:177249584-177249606 AAGAGATGCCACTGTAGTGTTGG - Intergenic
985262175 4:188125152-188125174 CAGAACTTCATCTCTAGTTTAGG + Intergenic
985987738 5:3531524-3531546 CTGAGATTCCACTCTAGGGCTGG - Intergenic
986236183 5:5912964-5912986 CATAGCTTCCACTCTAGTGACGG + Intergenic
986691602 5:10317862-10317884 CACAGCTTCCCCTTGAGTGTGGG + Intergenic
986794605 5:11197129-11197151 CCAAGCTTCCACTCTAGTAAAGG - Intronic
986850606 5:11808345-11808367 CAGAGCTGACAGTCTAGAGTGGG + Intronic
987397139 5:17435409-17435431 CAGAGCTCACACTCTGGTGAGGG + Intergenic
987447525 5:18038633-18038655 CAGAGTTTCCAATCCAGTGCAGG - Intergenic
987762813 5:22187697-22187719 CAGAGCTTAGATTCTAGTCTGGG - Intronic
989164706 5:38422975-38422997 CAGAGTTTCCAAACCAGTGTGGG - Intronic
989228665 5:39061382-39061404 CAGACCTTCCACTCATGGGTAGG - Intronic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
990113625 5:52360418-52360440 GAGAGCTTCCATTCAAGTGAAGG - Intergenic
991897598 5:71421101-71421123 CAGAGCTTAGATTCTAGTCTGGG - Intergenic
993916823 5:93754314-93754336 CAGAGCTTACATTCTAGTAAGGG - Intronic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994104014 5:95925472-95925494 CAGAGCTTATATTCTAGTGAAGG - Intronic
994750799 5:103734517-103734539 CAAAGCTTGCATTCCAGTGTAGG - Intergenic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
995881872 5:116852285-116852307 CAGAGCTTGCACTCCAGCCTGGG + Intergenic
997326434 5:133025876-133025898 GAGAGCTTACATTCTAGTGATGG - Intronic
997503622 5:134398260-134398282 AAAAGCTCTCACTCTAGTGTAGG + Intergenic
998091290 5:139371772-139371794 CAGAACTTCCCAACTAGTGTGGG - Intronic
999118281 5:149184315-149184337 CAGAGCAGCCATTCTAATGTTGG + Intronic
999279570 5:150356352-150356374 TAGAGCTTACAGTCTAGTGATGG - Intergenic
1000809438 5:165843031-165843053 CAGAACTTACAGTCTAGTGTGGG - Intergenic
1001666977 5:173441339-173441361 AGGAGCTTGCATTCTAGTGTGGG - Intergenic
1004137945 6:12986609-12986631 GAGAGCTTCCAGTCTCGTTTGGG + Intronic
1004631640 6:17426947-17426969 CAGAACTTCCACTTTAGTCTGGG + Intronic
1007264356 6:40585927-40585949 CAGAGCCTGCACTCTTGAGTTGG - Intronic
1008543203 6:52563650-52563672 CAGAGCTTGCACTCCAGCCTGGG + Intronic
1011586255 6:88928422-88928444 CAGAGCTCATATTCTAGTGTGGG - Intronic
1011946358 6:92908893-92908915 CAAAGCTTCCAATTTTGTGTGGG + Intergenic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1015908414 6:138142100-138142122 AGGAGCTTACACTCTAGTGAGGG + Intergenic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1019402834 7:866397-866419 CACAGCTGCCACTCTCGTGACGG - Intronic
1019762577 7:2824567-2824589 TAGAGCTTACATTCTAGTGTGGG - Intronic
1022174935 7:27863594-27863616 CAGAGCTTGCATTCCAGTGCTGG - Intronic
1022197857 7:28086365-28086387 CAGAGCTTCCTCTTTAATTTGGG - Intronic
1022617489 7:31946705-31946727 CACAACCTCCACACTAGTGTTGG + Intronic
1023504119 7:40882211-40882233 AAGAACTTCAACTTTAGTGTTGG - Intergenic
1024868001 7:53925908-53925930 CGGAGCTTGCACTCTAGTGGGGG - Intergenic
1027719330 7:81719355-81719377 TAGATCTCCCACTCTAGTGTGGG - Intronic
1028311597 7:89344560-89344582 CCGAGCTTCCATTTTAGTGGAGG + Intergenic
1028641405 7:93045745-93045767 CAGTGCTCCCATTCTAGAGTGGG + Intergenic
1031108556 7:117576807-117576829 AAGAGCTTACAATCTAGTGAGGG - Intronic
1033277778 7:139985717-139985739 GGGAGCTTCCAGTCTAGTGGAGG - Intronic
1033278983 7:139992440-139992462 GCGAGCTTCCCCGCTAGTGTGGG - Intronic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1036755918 8:11471090-11471112 CAGAGCGTCCACCTTAGTGCTGG + Intronic
1037536262 8:19827466-19827488 CGGAGCTTGTACTCTAGTGAAGG - Intronic
1041678202 8:60557977-60557999 CAGAGCTTACAGTCTAGTTCAGG - Intronic
1042124598 8:65525389-65525411 CCGAGCTTACACTCTAGTGAGGG - Intergenic
1042204224 8:66312296-66312318 TAGAGCTTGCATTCTAGTGGGGG - Intergenic
1042208877 8:66357566-66357588 CAAATATACCACTCTAGTGTGGG - Intergenic
1042318753 8:67452627-67452649 GAGAGCTTCCATTCCAGTGGTGG + Intronic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1043805613 8:84669142-84669164 CACAACTTTCAGTCTAGTGTTGG + Intronic
1045233259 8:100326516-100326538 CAGATCTTGCAGTCTAGTGAGGG + Intronic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1045707944 8:104948250-104948272 AAGAGCTTCCAGTCTATTGAAGG + Intronic
1046173838 8:110548622-110548644 AAGTGCATCAACTCTAGTGTAGG - Intergenic
1046550898 8:115714980-115715002 CAGAGCTTACAGTCTAGCATGGG - Intronic
1048301165 8:133252488-133252510 CAGAGGCTCCACTCTGGAGTTGG - Intronic
1048562879 8:135561121-135561143 CAAAGCTTCTACCCTAGGGTTGG - Intronic
1048613419 8:136048715-136048737 CAGAGCTTTCACTCCACTGGTGG - Intergenic
1048959691 8:139565720-139565742 CAGAGTTTCCTCTGTAATGTGGG - Intergenic
1048974005 8:139661272-139661294 CAGAGCTTACATCCCAGTGTGGG + Intronic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1049836375 8:144738182-144738204 CAGAGCTTCCATGCAAGAGTGGG - Intronic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1051042325 9:12826417-12826439 CAGACCTTTCATTCTAGTGTGGG - Intergenic
1051807366 9:21010470-21010492 CAGAGCTTACAGTCTAGTCAAGG + Intronic
1054900065 9:70359684-70359706 GATAGCTACCACTCTAGTATGGG + Intergenic
1055560261 9:77515265-77515287 TAGATCTTCCATTCTAGTGGAGG + Intronic
1055760203 9:79598904-79598926 CAGAGCTTCTAGTTTAGAGTAGG + Intronic
1058705768 9:107637103-107637125 CAGAACTTCCTGTGTAGTGTGGG + Intergenic
1059334066 9:113557646-113557668 CAGAGCTGACAGTCTAATGTGGG + Intronic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1061635504 9:131905947-131905969 CAGAGCTAACAGTCTAGTGAAGG + Intronic
1186533391 X:10320464-10320486 CAAATGTTCCACTCTAGTGGGGG - Intergenic
1189503108 X:41582975-41582997 TGGAACTTCCACTCTAGTGGAGG - Intronic
1191925172 X:66301304-66301326 CAGAACTTACATTCTAGTGGAGG - Intergenic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1195431210 X:104791410-104791432 CAGAACTTCCTCTCCAGTGCTGG + Intronic
1195468254 X:105204998-105205020 TGGAGCTTCCATTCTAGAGTTGG + Intronic
1196172799 X:112608528-112608550 CGAAGCTTACATTCTAGTGTGGG - Intergenic
1196202978 X:112907043-112907065 GAGAGCTTCCAATCTAGTTGTGG + Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1199084706 X:143615437-143615459 CGGAGCTTACAATCTAGTGGAGG - Intergenic
1199444668 X:147908533-147908555 CTGAGCTTACACTCTAGTGAGGG + Intergenic
1199710654 X:150466875-150466897 CAGAGCTTTCACTTAATTGTTGG - Intronic