ID: 1017239613

View in Genome Browser
Species Human (GRCh38)
Location 6:152152634-152152656
Sequence CCTAATGGACAGCAGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017239613_1017239616 7 Left 1017239613 6:152152634-152152656 CCTCAATTCTGCTGTCCATTAGG 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1017239616 6:152152664-152152686 TTAAAACTACCTTTTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017239613 Original CRISPR CCTAATGGACAGCAGAATTG AGG (reversed) Intronic
905927123 1:41759125-41759147 CCTAATAGAAAGCAGACTGGTGG - Intronic
909058853 1:70855277-70855299 ACTCATAGAAAGCAGAATTGTGG + Intronic
910638333 1:89433636-89433658 CCTAATGGCAAGCACAACTGGGG + Intergenic
913370388 1:118092579-118092601 CCTAATGGAAAGCATGATAGGGG - Intronic
915926628 1:160026340-160026362 CATAATAGATAGCAGAATTATGG + Intergenic
919111846 1:193229860-193229882 ACTAATGGAAAGCAGAAGAGTGG + Intronic
1065778653 10:29145834-29145856 CCTAATGGGCAGCAGTATTATGG + Intergenic
1067326534 10:45273658-45273680 ACAAATGGAGAGCAGATTTGTGG + Intergenic
1068502873 10:57862420-57862442 CATTATGGACAGCAGCATGGAGG - Intergenic
1068724295 10:60283972-60283994 CCTAATGAACATCAGTTTTGGGG - Intronic
1071774998 10:88776924-88776946 CATAAGGGACAGGAGAATGGAGG - Intronic
1073974829 10:109088472-109088494 ATTAATAGAGAGCAGAATTGTGG + Intergenic
1081599808 11:44485198-44485220 GCTAATGGACATCAGAATTCAGG - Intergenic
1090225711 11:125071036-125071058 CCAAAGTAACAGCAGAATTGAGG + Intronic
1092097718 12:5857442-5857464 CATTATGGAAAGCAGAATGGAGG - Intronic
1093064580 12:14643622-14643644 CGTAGTGGACAGTAGAATGGTGG - Exonic
1097530905 12:60798811-60798833 CCTAATGAAAAGCACATTTGTGG - Intergenic
1098114844 12:67164201-67164223 CCTCCTGGAGAGCAGAACTGGGG - Intergenic
1098479933 12:70945748-70945770 CATAATGCACTGCAGAATGGAGG + Intergenic
1101268892 12:103122075-103122097 GGTAATAGACAGCAGAGTTGGGG + Intergenic
1102620497 12:114191043-114191065 CCTGCTTGACAGCAGAGTTGGGG - Intergenic
1104312310 12:127664414-127664436 CCAAATGGACCAAAGAATTGAGG - Intergenic
1104376663 12:128269053-128269075 GCTAATTAACAGCAGAATTCAGG - Intronic
1105416750 13:20219964-20219986 CATTATGGAAAGCAGAATGGAGG - Intergenic
1106853772 13:33824585-33824607 CTTAAAGGAGAACAGAATTGAGG + Intronic
1108363757 13:49690911-49690933 CATAATTGAGAGTAGAATTGAGG - Intronic
1109255210 13:60071949-60071971 CCTGATGGGAAGCAGAATTGGGG - Intronic
1110963019 13:81654645-81654667 CCTTATGGAAAACAGTATTGAGG - Intergenic
1112443008 13:99438592-99438614 CATAATGGAAAGCAGTATGGAGG + Intergenic
1113303766 13:109053617-109053639 CCTAAAGGACTGCAGAAGGGAGG + Intronic
1117592912 14:57293534-57293556 CCTAAACCACAGCAGAATTGCGG + Exonic
1119228666 14:72963144-72963166 CCTAATGGTCAGCTGGAATGTGG - Intergenic
1120928744 14:89826027-89826049 CCTAATGGAGAGCAGGGTGGTGG + Intronic
1125571577 15:40723625-40723647 TCTAAGGGATAGAAGAATTGTGG + Intronic
1128690199 15:69718823-69718845 CCCAATGGCCTGCAGAATGGAGG + Intergenic
1129661695 15:77556352-77556374 GCCAAAGCACAGCAGAATTGGGG - Intergenic
1130853480 15:87820498-87820520 CCTAATGGAGGACACAATTGTGG + Intergenic
1135108721 16:19673458-19673480 CCAAGTGGACAACAGAAATGGGG - Intronic
1135127481 16:19823258-19823280 CCCCATGGTCAGCAGAGTTGGGG + Intronic
1140893795 16:79307487-79307509 CCTGTTGGAAACCAGAATTGAGG + Intergenic
1148205556 17:45777571-45777593 CACCATGGACAGCAGAAATGCGG - Intergenic
1148317217 17:46712502-46712524 ACTAATGGAAAGCAGATTTCTGG + Intronic
1149516422 17:57284271-57284293 CCTCAAGGACAGCTGAAATGAGG - Intronic
1157285787 18:46376314-46376336 CTTAATGGACAGGAAAACTGAGG + Intronic
1157504017 18:48213214-48213236 GTTAAAGGACAGCAGGATTGAGG - Intronic
1157722465 18:49936057-49936079 CCTCCTGGACAGCAGACTGGTGG + Intronic
1157894877 18:51456539-51456561 CCTAAGGGACAGGAGAATTAAGG + Intergenic
1158194558 18:54869565-54869587 ACTCATGGACAGCAGAATTGTGG + Intronic
1158290987 18:55942551-55942573 ATTAATTGACAGCAGATTTGTGG + Intergenic
1163683148 19:18695342-18695364 CCATATGGACAGCACAAGTGGGG + Intronic
1164955522 19:32379928-32379950 CCTTGTGAACACCAGAATTGTGG + Intronic
1168051722 19:53834283-53834305 TCTAATTGGCACCAGAATTGGGG - Intergenic
1168179833 19:54654391-54654413 CATAATGGAAAGCAGAATCAAGG - Intronic
1168700930 19:58439265-58439287 CCTAGTGGGCAGCAGACTGGAGG - Intronic
927982846 2:27385390-27385412 CCTAATTCACAGTAGCATTGTGG - Intronic
929098817 2:38289752-38289774 CCTAATGAGTAGCAGAATTATGG - Intergenic
929126308 2:38525186-38525208 CCTAATGGTTAGGAGAATTGAGG - Intergenic
929554570 2:42917577-42917599 CCTAATCATCCGCAGAATTGTGG + Intergenic
935164423 2:100557589-100557611 GCTAAGGGAAAGCTGAATTGAGG + Intergenic
936345994 2:111675653-111675675 CCACATGGACAGCAGAACGGTGG + Intergenic
938998595 2:136707381-136707403 AATAAAGGACAGTAGAATTGTGG + Intergenic
946654564 2:221932425-221932447 CCTAAGGGTGAGCAGGATTGGGG - Intergenic
948045552 2:234940878-234940900 CCTACTGGGCTGCAGAAATGGGG + Intergenic
948594962 2:239073945-239073967 CCTAATGGGCAGCAGGACTGAGG + Intronic
1172855180 20:37996295-37996317 GCTAATGGCAAGCAGAGTTGAGG - Intronic
1174639136 20:52027948-52027970 CCTGATGGACAGCAGAAGTCTGG - Intergenic
1175886690 20:62295961-62295983 CCTCAAGGACAGCAGAAGAGGGG - Exonic
1177227562 21:18277550-18277572 CTTGATGGACAGCAGACATGAGG + Intronic
1178442610 21:32611518-32611540 CCCAATGGACAGCACAGATGGGG + Intronic
1179037073 21:37767354-37767376 TCAAAAGGACAGTAGAATTGTGG + Intronic
1179039184 21:37786525-37786547 CCTATTGTTCAGCTGAATTGTGG - Intronic
949191101 3:1250236-1250258 TCTAATGGACAACAGAAATCAGG + Intronic
949718499 3:6961431-6961453 CCTATTAGACTGCTGAATTGAGG + Intronic
951179803 3:19645948-19645970 GATAATGGACAGCAGAATGCAGG + Intergenic
951997821 3:28750841-28750863 CCTAATGGAGAGCTGAGTTTGGG - Intergenic
952085140 3:29811748-29811770 CCTAATGGACAAAAGATTTAGGG - Intronic
954544268 3:51419471-51419493 CCTTATGGACAGTAGTAATGAGG + Intronic
956065398 3:65392257-65392279 CCTAATGGAAAGGAAAATAGTGG + Intronic
962017234 3:131454249-131454271 CCTACTGGACTGCAGAACTCTGG - Intergenic
966949608 3:184804263-184804285 CCTAAAGAACTGCAGAATTCTGG - Intergenic
968660471 4:1796742-1796764 CCTAATGGACATCAGTCTTGGGG + Intronic
969601166 4:8177226-8177248 CCTAAAGGACTGCAAACTTGTGG + Intergenic
972061618 4:34881403-34881425 CCTAATGAAAAGCAGTACTGAGG - Intergenic
975721587 4:77253678-77253700 CCTAAGTGACAGTAAAATTGAGG + Intronic
976288308 4:83391371-83391393 CTAAAAGGACAGGAGAATTGGGG - Intergenic
979449166 4:120849403-120849425 CTAAACTGACAGCAGAATTGGGG + Intronic
980752600 4:137111500-137111522 CATTATGGACAACAGCATTGAGG - Intergenic
982209437 4:153022598-153022620 CCTCCTGGGCAGCAGAATGGTGG + Intergenic
983507259 4:168567466-168567488 GCAAATGGAAAGCAAAATTGTGG + Intronic
985986389 5:3520197-3520219 CAAAATACACAGCAGAATTGTGG + Intergenic
986534403 5:8772036-8772058 TCAAATGGACAGCACAATGGTGG - Intergenic
990560118 5:56975334-56975356 CGTAATTGACAGCATCATTGCGG + Intergenic
991641316 5:68757066-68757088 CCTAATTGAAAGAGGAATTGGGG + Intergenic
992554556 5:77890601-77890623 CCTAATCAAAAGCAGAATTTGGG + Intergenic
995002611 5:107152982-107153004 CCAAATTCACAGCAGAATTGAGG + Intergenic
999582386 5:153053300-153053322 CCAAGCGGAGAGCAGAATTGTGG - Intergenic
1000586399 5:163104637-163104659 CCTAATGGACAGATTCATTGTGG - Intergenic
1003578825 6:7321042-7321064 CCTAATGGTCAGCAACAATGTGG + Intronic
1005676188 6:28157808-28157830 CCAAAGGGAAAGTAGAATTGTGG + Exonic
1006580776 6:35076489-35076511 CCATGTGGACAGCAGCATTGGGG + Intronic
1008231427 6:48988842-48988864 GCAAATGGACACCAAAATTGAGG + Intergenic
1009398031 6:63224897-63224919 CCTGAGGGACAGGATAATTGAGG - Intergenic
1010198417 6:73262850-73262872 CCTAATGGAGGGCAGAATTCAGG + Exonic
1010927785 6:81764521-81764543 CCTAAGAGACAGCAGAACAGTGG - Intergenic
1015304609 6:131693894-131693916 CTTAATGGACAGCATAGTGGGGG - Intronic
1016991997 6:149936699-149936721 CTAAATTGACAGAAGAATTGTGG + Intergenic
1017239613 6:152152634-152152656 CCTAATGGACAGCAGAATTGAGG - Intronic
1018294638 6:162332437-162332459 CCTAAAGGAGAGGAGGATTGAGG - Intronic
1018914293 6:168123362-168123384 CCCAATGCACAGCAGCATGGGGG + Intergenic
1019549093 7:1593471-1593493 CCAAGTGGACAGTAGCATTGGGG + Intergenic
1023889604 7:44382768-44382790 CCCAGTGGAGAGCAGATTTGAGG + Exonic
1023967460 7:44970391-44970413 CCTGATGGAAGGCAGAATTACGG - Intronic
1024492067 7:49996853-49996875 CCTAAGGGACAGCAGAGTCAAGG - Intronic
1024534159 7:50416377-50416399 CATATTGGACAGCACAAATGTGG + Intergenic
1029288005 7:99479365-99479387 TCTAATCAACAGCAGATTTGAGG + Intronic
1032861075 7:135880028-135880050 CCTCAGGGACAGCAGAAAAGTGG - Intergenic
1035081102 7:156216717-156216739 CCTCATGGATAGAAGAATGGAGG - Intergenic
1035333080 7:158108777-158108799 CCTAATAAATGGCAGAATTGAGG + Intronic
1037486203 8:19349485-19349507 CATAATGTACAGCTGCATTGTGG + Intronic
1037893830 8:22638585-22638607 CCTTTTGGACAGCAGGAATGAGG + Intronic
1038681538 8:29673121-29673143 CCAAATGGACAGGTGAATGGAGG + Intergenic
1039918972 8:41879807-41879829 TCTTATGGACAGGAGAACTGAGG - Intronic
1040761900 8:50857117-50857139 TCTAATGAATAGCAGAACTGTGG - Intergenic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045206130 8:100043010-100043032 CCTCATGGTCAGCAGTGTTGCGG - Intronic
1046295634 8:112215858-112215880 GCTACTGGACAGCAAAATGGAGG - Intergenic
1048143492 8:131818832-131818854 CTTACTGGACAGCAGCATGGTGG - Intergenic
1051158177 9:14174421-14174443 CCTAATGGACACAATAAATGAGG + Intronic
1054357482 9:64075750-64075772 CATAATGGAGAGCAGTGTTGCGG - Intergenic
1056494411 9:87141797-87141819 CCTAATAGACAGGTGAGTTGCGG + Intergenic
1060666862 9:125436868-125436890 CCTGGTGGAAAGCAGAAGTGGGG + Intergenic
1188389163 X:29598854-29598876 GCAAATGGACAGCAAAAGTGAGG - Intronic
1192833746 X:74777775-74777797 TCTCATGGCCAGCAGGATTGGGG + Intronic
1193791833 X:85823711-85823733 GCAAATGGACACCAAAATTGAGG + Intergenic
1197398101 X:125952697-125952719 CATTATGGAAAGCAGTATTGTGG + Intergenic
1197875896 X:131105722-131105744 CATTATGGACAGCAGTATGGAGG - Intergenic