ID: 1017245057

View in Genome Browser
Species Human (GRCh38)
Location 6:152215814-152215836
Sequence TCTTCCATTTACTAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017245057_1017245062 -2 Left 1017245057 6:152215814-152215836 CCAGCCAGCTAGTAAATGGAAGA 0: 1
1: 0
2: 4
3: 39
4: 285
Right 1017245062 6:152215835-152215857 GAGGGTAAACGAACCTCCTTGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1017245057_1017245061 -3 Left 1017245057 6:152215814-152215836 CCAGCCAGCTAGTAAATGGAAGA 0: 1
1: 0
2: 4
3: 39
4: 285
Right 1017245061 6:152215834-152215856 AGAGGGTAAACGAACCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017245057 Original CRISPR TCTTCCATTTACTAGCTGGC TGG (reversed) Intronic
902185244 1:14720087-14720109 TCTCCCATTCATTTGCTGGCTGG - Intronic
902876610 1:19344279-19344301 TCTGCCAGTTACTAGCTGTGTGG - Intronic
903691955 1:25180595-25180617 TCTGCCATTTACTAGCTGTGTGG - Intergenic
904066756 1:27758228-27758250 TCCGCCATTTACTAGCTGTGTGG - Intronic
904344479 1:29859130-29859152 TCTGCCACTTACTAGATGTCAGG - Intergenic
904382151 1:30118922-30118944 TCTGCCATTTACCAGCTGTGTGG + Intergenic
904405495 1:30285713-30285735 TCTTCCACTCACTAGCTGTGGGG - Intergenic
904458486 1:30661677-30661699 TCTTCCACTCACTAGCTGTGGGG - Intergenic
905508467 1:38499643-38499665 TCTGCCGTTTACTAGCTGTTTGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906998180 1:50820796-50820818 TCTTCCATTTTGTATTTGGCAGG + Intronic
907647721 1:56260866-56260888 TCTCCCAGTTACTAGCTGTAAGG - Intergenic
908410436 1:63859188-63859210 ACTTTCATTTTCTGGCTGGCTGG + Intronic
909657571 1:78047625-78047647 TCTACCCTTTACTAGCTGTGTGG + Intronic
912345741 1:108962001-108962023 TCTACCACTTACTAGCTTGGTGG - Intronic
913175824 1:116272390-116272412 TCTGCCATTTATTAGCTGAAAGG + Intergenic
914246608 1:145890944-145890966 TCTGCCATTTATTAGCTGTATGG - Intergenic
914748558 1:150516514-150516536 GCTTCCAGATAATAGCTGGCTGG - Intergenic
915537043 1:156543004-156543026 TCTACCATTTACTAGCTGTGTGG - Intronic
916221341 1:162447860-162447882 TCTTCTTTTTAAAAGCTGGCCGG - Intergenic
916399813 1:164434652-164434674 TCTTCCATGTACTAACAGGAGGG + Intergenic
916608377 1:166365303-166365325 TCTTCCTGTGACCAGCTGGCTGG + Intergenic
916844464 1:168634995-168635017 CCTTCCATTTACTAGCTGTATGG - Intergenic
917444420 1:175095032-175095054 TCTGCCATTGACTAGCTGAGTGG + Intronic
920958409 1:210640913-210640935 TCTGCCATTTACTACCTAGGTGG - Intronic
921164678 1:212498236-212498258 TTTTTCAGTTACTAGCTGGGTGG + Intergenic
921469097 1:215527406-215527428 TCTTCCATTGTCTAGCTGAAGGG + Intergenic
923561244 1:235043537-235043559 TCTGCCATTTACTAACTGTGTGG + Intergenic
1063722657 10:8599793-8599815 TCATCCATTTACTAGCTGGGAGG + Intergenic
1064920711 10:20514732-20514754 TCTACCATTTACTAGTTGTATGG + Intergenic
1069625584 10:69865891-69865913 TCTACCATTTACTAGCTGCATGG + Intronic
1069735871 10:70653832-70653854 TCTGCCACTTACTAGCTGTGTGG + Intergenic
1070043748 10:72809290-72809312 TCTTCCATTTATTAGCTTTGTGG - Intronic
1070165445 10:73894156-73894178 TCCCCCATTTACTAGCTGTGTGG - Intergenic
1071110208 10:82146929-82146951 TCTTTCCTTTTATAGCTGGCTGG - Intronic
1072197423 10:93128421-93128443 TCTTCCATTTACCAGCTGTAAGG - Intergenic
1074535160 10:114323751-114323773 ACTTCCATGTACTAGCTGAGAGG + Intronic
1075558751 10:123452514-123452536 TCTTCCATTTATTAGGCGGGTGG - Intergenic
1075794952 10:125113329-125113351 TCTTCCCTACTCTAGCTGGCAGG + Intronic
1076506847 10:130983978-130984000 TCTTACATTCACGAGGTGGCAGG - Intergenic
1078727055 11:13941088-13941110 TCTGCCATTTACTAGCTCTATGG + Intergenic
1078746447 11:14120087-14120109 TCTACCATATACTAGCTGGGTGG + Intronic
1078939214 11:15982232-15982254 TCGGCCATTTACTAGCTGTGTGG + Intronic
1079082526 11:17423899-17423921 TCTGCCATTTAACAGCTGGGTGG + Intronic
1079927627 11:26514514-26514536 TCTACCATTTACTAGCTCTATGG - Intronic
1080411786 11:32031890-32031912 TCTTTCCTATCCTAGCTGGCAGG + Intronic
1081220996 11:40461365-40461387 TCTTCTATTTACTAGCTGTGTGG + Intronic
1081296424 11:41395413-41395435 GCTGCTATTTAATAGCTGGCTGG - Intronic
1081755821 11:45543589-45543611 TCTCCCACTCACTAGCTGGGTGG + Intergenic
1083813694 11:65119874-65119896 TACTCCATTTACTGGGTGGCTGG - Intergenic
1085092304 11:73727554-73727576 TCTACCATTTAGTAGTTGGATGG - Intronic
1085228314 11:74942654-74942676 TATGCCATTTACTAGCTGTGTGG + Intronic
1085815994 11:79738105-79738127 TCCACCATTTACTAGCTGTGTGG + Intergenic
1086544674 11:87953865-87953887 TTTTCCATTTACTATTTGTCAGG + Intergenic
1087084031 11:94198503-94198525 TCTGCCACTTACTAGCTGCAGGG + Intergenic
1087761527 11:102108810-102108832 TCTGCCATTTACTAGCTGTGAGG - Intergenic
1088269466 11:108018877-108018899 TCTGCCATTTGCTAGCTGTGTGG + Intronic
1090400959 11:126447931-126447953 ACTGCCATGGACTAGCTGGCTGG - Intronic
1090452415 11:126818402-126818424 TCTGCCATTTACTAGTTGTGTGG + Intronic
1090659956 11:128874906-128874928 TGTTCCATTTAGGAGCTGGAGGG - Intergenic
1090930301 11:131291857-131291879 TCTTCCACTTACTAGCTATATGG - Intergenic
1091753443 12:3036926-3036948 TCTTTCACTTACTAGTTGGATGG + Intronic
1091974984 12:4817190-4817212 AATTCCATTTACTAGGTGGTAGG + Intronic
1092209985 12:6639787-6639809 TCTGCCAGTTACTTGCTGGGTGG - Intronic
1095651951 12:44621393-44621415 TCTTCCTTTTACTAGCTATGAGG + Intronic
1096313166 12:50540012-50540034 TAATCCATTCACCAGCTGGCAGG + Intronic
1096595751 12:52694162-52694184 TCTGCCATTTACTAGCTACAAGG + Intronic
1096965859 12:55627082-55627104 TCAGCCATTTACTAGCTGTATGG + Intergenic
1100176784 12:92039872-92039894 TCTTCCATATACTGGGTGTCTGG - Intronic
1100862855 12:98825092-98825114 TCTACCATTTACCAGCTGTGAGG + Intronic
1100881448 12:99022256-99022278 TTTACCATTTACCAGCTGGTTGG + Intronic
1101355082 12:103969248-103969270 TCTCCCATTTACTAGCTCTGTGG - Intronic
1102434682 12:112911654-112911676 CCTCCCACTTACTGGCTGGCTGG + Intronic
1102467174 12:113136574-113136596 TCTGCCATTTGGTAGCTGTCTGG + Intergenic
1102727085 12:115075171-115075193 TCTTCCACTTACCAGCTGAGGGG + Intergenic
1103211329 12:119168880-119168902 CCTTCCTTTTTCTTGCTGGCTGG + Intergenic
1103243880 12:119438502-119438524 TCTTCCAGTTATTAGCTGGGTGG + Intronic
1104916035 12:132265050-132265072 TCTTCCATTTGCCAGCAGGTGGG - Intronic
1106659251 13:31781233-31781255 TCTACCACTTACTAGCTGTGTGG + Intronic
1110343406 13:74418372-74418394 TATTCCATTTACCAGTTGACTGG - Intergenic
1110865346 13:80388305-80388327 TCTTTCACTTACTAGCTAGGTGG + Intergenic
1111388902 13:87565044-87565066 TCTGGCATTAACTAGCTGCCTGG + Intergenic
1111789385 13:92834165-92834187 TTTTTCATTTATTAGCTGCCAGG - Intronic
1112987847 13:105473610-105473632 TTTTCCATTTTCTAGCTGCTTGG - Intronic
1115040312 14:28916505-28916527 TCTGCCATTTACTAGTTGTTTGG + Intergenic
1118287866 14:64493296-64493318 TCTGCCATTTACTAGCTGCGTGG + Intronic
1118370377 14:65132665-65132687 TCTGACACTTACTAGCTGGGAGG - Intergenic
1118966952 14:70595764-70595786 TCTGCCATCCACTACCTGGCGGG - Intronic
1119145808 14:72313068-72313090 TCTGCCCCTTACTAGCTGGGTGG + Intronic
1119384301 14:74247604-74247626 TCTCCCACTTACTAGCTGTGGGG - Intronic
1119664077 14:76472033-76472055 TCTGTCATTAACTAGCTGTCTGG - Intronic
1126857104 15:52849165-52849187 TCTTCCACTTACTAGCTTAGGGG + Intergenic
1127102392 15:55580630-55580652 TCTGCCATTTATTAGCTGTATGG - Intronic
1127568550 15:60217233-60217255 TCTGCCATTTACTAGCTATGTGG + Intergenic
1127949428 15:63790026-63790048 TATACCATTTACTAGCTGACTGG + Intronic
1128110266 15:65071728-65071750 TCTGCCAGTTACTAGGTGTCTGG + Intronic
1129427792 15:75477141-75477163 TCTGCCACTTACTAGCTGCATGG + Intronic
1129743812 15:78004014-78004036 TCTACCACTTACTAGCTGGGTGG + Intronic
1131084633 15:89566061-89566083 TCTTGAGTTTACTAGTTGGCTGG + Intergenic
1131623737 15:94096084-94096106 TCTACCATTTACTAGCTACACGG + Intergenic
1131911006 15:97201169-97201191 TCTTCCACGTACCAGCTGTCTGG - Intergenic
1132610017 16:810947-810969 TCTGCCACTTATTAGGTGGCTGG + Intronic
1133887944 16:9849449-9849471 TCTTCCATTTCCTAGCTAGATGG + Intronic
1134567993 16:15267518-15267540 TCTACCATTGACTAGCTGTGTGG + Intergenic
1135065428 16:19305583-19305605 TCTGCCACTTACTGGCTGGCAGG + Intronic
1135740398 16:24970302-24970324 TCTTCCTTTTAGTAGGTGTCAGG - Intronic
1135834997 16:25817108-25817130 TCTTCCCTTTACTAGCTGCATGG + Intronic
1135998277 16:27269469-27269491 TCTGCCACTTACTAGTTGGCAGG + Intronic
1137967940 16:52955345-52955367 TCTGCCATTTACAAGCTGTATGG + Intergenic
1138235913 16:55382430-55382452 TCTGCCACTTACTAGCTGTGTGG + Intergenic
1140967919 16:79985110-79985132 TCTGCCATTTACCAGCTGCATGG + Intergenic
1143392381 17:6567337-6567359 TCTTCCACTTATTAGCTGTGAGG - Intergenic
1143820063 17:9553894-9553916 TCTTCCATTTCCTAGTTGTGGGG + Intronic
1144041196 17:11412827-11412849 TCTTTCCTTTACATGCTGGCAGG + Intronic
1145772285 17:27502142-27502164 TCTGCCATTTCCTAGCTGAAAGG - Intronic
1145932385 17:28695206-28695228 TCTGCCATTCAGCAGCTGGCTGG + Intronic
1146749716 17:35367766-35367788 TCTGCCATTTATTAGCTGTACGG + Intronic
1147463172 17:40589019-40589041 TCTTCCATTAACTACCAGGGTGG + Intergenic
1147715291 17:42502776-42502798 TCTTCCATTCACTATCAGGAAGG + Intronic
1148045362 17:44740589-44740611 TCTTCCATTTAGAATCTGCCAGG + Intronic
1148138465 17:45311097-45311119 TCTGCCATTAACTAGCTGTGTGG + Intronic
1148675659 17:49443294-49443316 TCCACCATTTACTAGCTGTGTGG - Intronic
1148722104 17:49761564-49761586 TCTGCCATTTACTAGTTGTGTGG - Intronic
1149183995 17:53976024-53976046 TCTTGTACTTACTAGCTGCCTGG - Intergenic
1150224831 17:63518728-63518750 TCTGCCATTTAGTAGCTGTGGGG - Intronic
1151036458 17:70805804-70805826 TCTTCCACCAAATAGCTGGCTGG + Intergenic
1151193840 17:72417965-72417987 TCTTTCATTTGTTAGCAGGCAGG - Intergenic
1151617037 17:75220101-75220123 TCTGCCTTTTACTAGCTGTGAGG + Intronic
1151994646 17:77600992-77601014 TCTGCCATTTACCAGCTGTGTGG - Intergenic
1152988515 18:341258-341280 TCTGCCATTTACTAGTTGTTTGG + Intronic
1153034223 18:744193-744215 TCTACCATTTACTAACTGCAGGG - Intronic
1153265410 18:3263893-3263915 TCTGCCATTTTCTAGCTGTGTGG + Intronic
1154017668 18:10634012-10634034 TCTTCCAGTTACTAGCTAACAGG + Intergenic
1154187198 18:12195587-12195609 TCTTCCAGTTACTAGCTAACAGG - Intergenic
1155888728 18:31240289-31240311 TCTCCCATTTACTAACTAGGAGG + Intergenic
1156466076 18:37348531-37348553 TCTTCCATTTTCTATCTGCCTGG + Intronic
1156673955 18:39505273-39505295 TCCTCCATTTACAAGCTGTTTGG - Intergenic
1156918727 18:42492798-42492820 TCTACCATTTACCTGATGGCTGG - Intergenic
1158603086 18:58871478-58871500 ACTTCCACTTACGAGCTGGGAGG - Intronic
1163472800 19:17507035-17507057 TCTTCCATGTACAGGCCGGCTGG + Intergenic
1164423415 19:28118141-28118163 TGATCCATTTACAACCTGGCAGG + Intergenic
1164917914 19:32066642-32066664 TCTTCCATTTGCTTGCTGTGTGG - Intergenic
925422242 2:3722177-3722199 TCTGCCACTTACTAGCTGTGTGG - Intronic
927068149 2:19494506-19494528 TTTGCCATTTACTAGCTGTATGG + Intergenic
927720997 2:25382079-25382101 TGTGCCATTTATCAGCTGGCAGG + Intronic
928066313 2:28167985-28168007 TCTGACATTTACTAGCTGTGTGG - Intronic
928426237 2:31180527-31180549 TTTTCCATTTAATAACTGGGCGG - Intronic
928543171 2:32302958-32302980 TCTGCCACTTACTTGCTGTCTGG + Intronic
928627801 2:33158654-33158676 TCTTCCATTTTCTGGCTAGAAGG - Intronic
930540477 2:52699786-52699808 TCTGCCATTTACAAGCTGGGTGG + Intergenic
930874285 2:56196570-56196592 GCTTCCAGATACTAGCTGGCAGG + Intronic
931079785 2:58755629-58755651 TCTGCCATTTATTAGCTGTATGG + Intergenic
931665427 2:64606934-64606956 TCTCCCATTGACTGGCTGGTGGG + Intergenic
931836169 2:66100178-66100200 TCTTCCACTTCCTAGCTGTGTGG - Intergenic
932717426 2:74111738-74111760 TCTGCCATTTCCTAGCTGGATGG - Intergenic
935201116 2:100857378-100857400 CCTTCCATATAGTAGATGGCAGG + Intronic
935494636 2:103765082-103765104 TCTGGCATTTACTAGCTGTGTGG - Intergenic
936102880 2:109598766-109598788 TGTTCCATTTACCAGGAGGCAGG + Intronic
938295749 2:130178341-130178363 TCTGCCACTTACTAGCTGGGTGG - Intronic
938460870 2:131495478-131495500 TCTGCCACTTACTAGCTGGGTGG + Intergenic
938713396 2:133995402-133995424 TCTGACATTTACTAGCTGTGTGG - Intergenic
939253289 2:139711269-139711291 TCTGCCACTTAGTAGCTGGATGG - Intergenic
940777046 2:157895718-157895740 TCTGCCAGTTACTAGCTGTGAGG + Intronic
941509166 2:166384377-166384399 TCTTCCATATATTAGCTGTGTGG - Intergenic
943337078 2:186628901-186628923 TCTCTTATTTACTAGCTGGTTGG + Intronic
945986292 2:216356547-216356569 TCTAGCATTTACTAGCTGTGTGG - Intronic
1168995867 20:2132805-2132827 TCTCCTACTTACTAGCTGGGCGG + Intronic
1169636466 20:7697546-7697568 TCTTCCATTTTTTAGCTTGATGG - Intergenic
1172283921 20:33727825-33727847 CCTTCCATTGCCTTGCTGGCAGG - Intergenic
1173912764 20:46682568-46682590 TCTGCCATTTACTAACTGAGTGG + Intronic
1174235950 20:49091904-49091926 TTTTCTATTTACTAGAAGGCAGG + Intronic
1177626731 21:23671964-23671986 TTATCCCTTTACTAGCTGGAGGG - Intergenic
1180630081 22:17222775-17222797 CCTTCCATTTTCTTGCTGCCAGG - Intergenic
1181588843 22:23870348-23870370 TCTTCCATTCAGCAGCTGACTGG + Intronic
1182037035 22:27207006-27207028 TCAACCATCTACTAGCTGGAAGG + Intergenic
1182321871 22:29482857-29482879 TCTGCCACTCACTAGCTGGGTGG + Intronic
1182898649 22:33879458-33879480 TCTGCCACTTACTAGCTGGGTGG - Intronic
1184088608 22:42280928-42280950 TCTCCCATTTCCTAGCTGTGTGG - Intronic
950079221 3:10209297-10209319 TCTACCATCTACTGGCTGGGTGG + Intronic
950260308 3:11538426-11538448 TCTGCCATTTGCTAGCTGTGTGG + Intronic
950897027 3:16462114-16462136 TCTGCCACTTACTAGCTGAATGG + Intronic
951527163 3:23664570-23664592 TCTTCCTCTTACTAGCTGTATGG + Intergenic
955231692 3:57105069-57105091 TTTTCCACTTACTAGCTGTGCGG + Intronic
956353371 3:68363491-68363513 TTTTCCATGTATTAGCTGGGAGG - Intronic
956430505 3:69181327-69181349 TCTTCCAGTTACTACATTGCCGG - Exonic
956478683 3:69651145-69651167 TCTTCCACTTACTAGCTGGGTGG - Intergenic
956617464 3:71187025-71187047 ACTTTTATTTACTAGGTGGCAGG + Intronic
958602847 3:96320864-96320886 TCTTCCTTTTTCTGCCTGGCTGG - Intergenic
960094558 3:113676791-113676813 TCTGCCACTTCCTAGCTGTCAGG + Intronic
960702795 3:120453143-120453165 ACTGCCATTTACTAGCTGCATGG + Intergenic
960883578 3:122371297-122371319 TCTTCCTTGTACCAGCTGCCTGG + Intronic
960959449 3:123059315-123059337 TCTGCCACTTACTAGCTGTGTGG - Intergenic
961813147 3:129533226-129533248 TCTGCCATTTTCTAGCTGTATGG + Intronic
962574015 3:136739179-136739201 TCTATCATTTACTAGCTGTTTGG + Intronic
962611034 3:137076378-137076400 TCTGCCATTTACTAGCTGGTTGG + Intergenic
962728058 3:138253388-138253410 TCTACTACTTACTAGCTGGGGGG - Intronic
962924164 3:139976525-139976547 TCTACCACTTACTAGCTGAGTGG - Intronic
963344239 3:144074948-144074970 TCTGCCATTTGCCAGCTGTCTGG + Intergenic
963592423 3:147278767-147278789 TTTTCCACTTTATAGCTGGCAGG - Intergenic
963759018 3:149267377-149267399 TATTCAATTAACTAGTTGGCTGG + Intergenic
964081447 3:152763568-152763590 TCTGCCATTTACTACCTGCCTGG + Intergenic
964356021 3:155852804-155852826 TGTTCCATTCACTAGAAGGCTGG + Intronic
964494531 3:157274011-157274033 TCTGCCACTTACCAGCTGACTGG + Intronic
965255734 3:166407880-166407902 TCTGCCACTTACTAGCTTTCTGG - Intergenic
965279185 3:166726269-166726291 CCCTCCAGTTACTATCTGGCAGG + Intergenic
965587665 3:170333455-170333477 TCTACCATGTACAATCTGGCAGG - Intergenic
966443852 3:179978126-179978148 TATTCCAGTTACTAACTAGCTGG + Intronic
967690458 3:192467751-192467773 TCTGCCATTTCCTAGCAGGGAGG - Intronic
967971871 3:195005267-195005289 TCTTCCCTCTCCTAGATGGCTGG - Intergenic
968245273 3:197139736-197139758 TTTTCCATTTCCTCTCTGGCTGG - Intronic
968245278 3:197139800-197139822 TTTTCCATTTCCTCTCTGGCTGG - Intronic
970310879 4:14781122-14781144 TCTTCCACTTCCTAGCTGTGTGG + Intergenic
973978445 4:56285871-56285893 TCTACCATTTACCAGCTGTGTGG - Intronic
974208528 4:58739503-58739525 TCTTACATTTACTAGCTATAGGG - Intergenic
974461324 4:62192029-62192051 CCTTCCATTTACCAGCTCTCTGG + Intergenic
977465337 4:97377310-97377332 TCTACCATTTACTAGCTGTGTGG + Intronic
979050347 4:115921914-115921936 TTTACCATTCACTATCTGGCAGG - Intergenic
979226439 4:118291171-118291193 TCTTTCATTTACTAGGTAGTGGG - Intronic
979898009 4:126185477-126185499 TCTTTCTTTTACTGGCAGGCAGG + Intergenic
979965299 4:127069550-127069572 TGTTCCATTTTCTAGGTGGTTGG - Intergenic
980907406 4:138961787-138961809 TCTTCCCTTTACCTCCTGGCTGG + Intergenic
981015415 4:139969070-139969092 TCTCCCATTCACTGGCTGGCTGG - Intronic
981031373 4:140128850-140128872 TGTTCCATTTACTCCCTGCCTGG - Intronic
982165509 4:152610209-152610231 TCTGCCACTAACTAGCTGGGTGG - Intergenic
982391464 4:154868910-154868932 TCTACCAGTTACTAGCTGTGTGG - Intergenic
982732248 4:158968622-158968644 TCTACTATTTACTAGCTGTGTGG + Intronic
982811017 4:159826027-159826049 TCTTCTCTTTAGTGGCTGGCTGG + Intergenic
983809997 4:172050077-172050099 TCCTTCATTTTCTGGCTGGCAGG + Intronic
984497857 4:180521138-180521160 TCTTCCATTTAATAGCTAATGGG - Intergenic
984956850 4:185053623-185053645 TCTTCCTTTTAAAAGCTGGCTGG - Intergenic
986664301 5:10086963-10086985 GGTTCCATTTACTAGGTCGCTGG - Intergenic
991449309 5:66734836-66734858 TCTCCTATTTTCTAGCTGTCAGG + Intronic
991698292 5:69294028-69294050 TCCACCATTTACTAGCTGTGTGG - Intronic
995631270 5:114135308-114135330 TCTTCAATTTACTATCGGGTTGG - Intergenic
997252107 5:132397212-132397234 TGTGCTATTTACTACCTGGCAGG - Intergenic
998024805 5:138806855-138806877 TCTGCCATTTACTAGTTAGGTGG + Intronic
998179132 5:139924142-139924164 TCCTCCATTGCCTAGCTTGCAGG - Intronic
998923586 5:147098214-147098236 TCTGCCATTTACTAGCTGTGTGG + Intergenic
999686728 5:154109843-154109865 TCTACCACTTACTAGCTGTGTGG - Intronic
1000050968 5:157562652-157562674 TCTTTCATTTACTTGCTGGGTGG + Intronic
1000276418 5:159739764-159739786 TCTCCTATTTAATAGCTGTCTGG + Intergenic
1001170209 5:169412219-169412241 TCAGCCACTTACTAGCTGGGTGG - Intergenic
1001698176 5:173688148-173688170 TCTCCTACTTACTAGCTGGATGG - Intergenic
1005121435 6:22393512-22393534 TCTTCCTTTTCCCTGCTGGCTGG + Intergenic
1006818790 6:36874060-36874082 TCTTCCAGTTACTAGCTGTGTGG + Intronic
1007452398 6:41950140-41950162 TCTTCCTTTTTCTGGCTGTCTGG + Intronic
1007817318 6:44533782-44533804 TCTGCTATTTACTAGCTGTGTGG - Intergenic
1009277798 6:61706017-61706039 TATTCCATTTACTATGTGTCAGG - Intronic
1011158415 6:84359797-84359819 TCTTCCATTTCCTAGTAGGTAGG + Intergenic
1011722909 6:90177502-90177524 TCTACCACTTACTAACTGGAAGG - Intronic
1012153204 6:95781892-95781914 TCTTCCATCTTCTATCTAGCTGG + Intergenic
1012293192 6:97484452-97484474 CCTTCCATTTCATAGCTGACTGG + Intergenic
1012650482 6:101746090-101746112 TCTTCACTTGCCTAGCTGGCTGG - Intronic
1012705022 6:102514066-102514088 TTTTCCATTCACCAGCTGACAGG + Intergenic
1013759311 6:113498361-113498383 TCTTCCAGGTAGTTGCTGGCAGG + Intergenic
1013859735 6:114621387-114621409 TCTGCCATTTACTAGCTTGGTGG - Intergenic
1014863477 6:126498805-126498827 TTTGCCATTTACTAGCTGTATGG - Intergenic
1015120637 6:129697540-129697562 TCATTCATTTACTACCTGTCAGG + Intronic
1015611143 6:135020796-135020818 TATTCCATTGTCTAGCTGTCTGG - Intronic
1016488406 6:144568874-144568896 TCCACCATTTACTAGCTGTATGG - Intronic
1017245057 6:152215814-152215836 TCTTCCATTTACTAGCTGGCTGG - Intronic
1017464013 6:154677952-154677974 TCTTCCACATACTAGCTGTGTGG + Intergenic
1018132708 6:160747978-160748000 GCTCCCATTTACTGGCTGTCAGG + Intronic
1019624525 7:2009256-2009278 TCTGCCATGTCCTGGCTGGCAGG - Intronic
1020338328 7:7082250-7082272 TCCTCCATTTACTAGCTTCTTGG - Intergenic
1021125177 7:16843867-16843889 TCAACCATTTACTACCTGGTTGG - Intergenic
1021682138 7:23144414-23144436 GCTTCCATTTTCTTGCTTGCTGG + Intronic
1022849826 7:34248725-34248747 TCTTCCCCTTACTAGCTGTGTGG + Intergenic
1023255568 7:38309264-38309286 TCTACCATTTACTAGCTGAGAGG - Intergenic
1027486370 7:78766525-78766547 TCCTCCATTGGCTAACTGGCTGG + Intronic
1027504170 7:78994665-78994687 TCATCCATTTACTAGCTATGTGG + Intronic
1029884894 7:103858185-103858207 TCTACCACTTCCTAGCTGGGTGG + Intronic
1031704085 7:124960495-124960517 TCTTTCATTTTCCAGCAGGCAGG - Intergenic
1031883055 7:127218435-127218457 TGTACCATTTACTAGCTGTGTGG + Intronic
1032064712 7:128758505-128758527 TCTACCATTTTCTAGCTGTTTGG - Intronic
1032471014 7:132179275-132179297 TGTTCCATTTACAAGCAAGCAGG - Intronic
1032513054 7:132487225-132487247 AGGACCATTTACTAGCTGGCAGG - Intronic
1033979094 7:147141594-147141616 TCTTCTATTCACTAGCTGAAAGG - Intronic
1037583092 8:20257586-20257608 CCTTCCATGTCATAGCTGGCAGG - Intronic
1037771391 8:21802177-21802199 TCTGCCACTTTCTAGCTGCCTGG + Intronic
1038173600 8:25161194-25161216 TCTGCCACTTACTACCTGACAGG - Intergenic
1038668885 8:29565244-29565266 TCTACCATTTACTAGCTGTGTGG - Intergenic
1038856247 8:31336111-31336133 TCTTCTGTTTTCTAGCTTGCTGG + Intergenic
1038960468 8:32512654-32512676 TCTTCCACTAACTAGCTGTGTGG - Intronic
1041664121 8:60425787-60425809 TCTACCATTTACCAGCTGTAAGG + Intergenic
1041717044 8:60941856-60941878 GTTGCCATTTACTAGCTGCCTGG + Intergenic
1042294361 8:67203568-67203590 TCTTCTTTTTAGTAACTGGCTGG + Intronic
1044214475 8:89592726-89592748 TCTTTTACTTACTGGCTGGCTGG - Intergenic
1045579699 8:103465327-103465349 TCTACCACTTACTAGCTGTGTGG - Intergenic
1045781530 8:105869671-105869693 TCTTCCCTTTACTATTTGGAGGG + Intergenic
1045866299 8:106869590-106869612 TCTACCATCTACTAGCTGTGTGG - Intergenic
1046669102 8:117037783-117037805 TTTTCCAATTACTAGCTTGATGG - Intronic
1046694481 8:117323738-117323760 TCTGCCATCTGCAAGCTGGCAGG + Intergenic
1046823105 8:118656772-118656794 TCTTTCATTTCCTAGCTTGGAGG + Intergenic
1047206668 8:122807828-122807850 TCTTCCACTTACCACCTGGGTGG - Intronic
1047922503 8:129650035-129650057 TCTATCATTTACTAGCTGTGTGG + Intergenic
1048566036 8:135598434-135598456 TCTGCCACTTACTAGCTGTGTGG - Intronic
1050261042 9:3841384-3841406 TCTGCCATGTACTAGCTGTGTGG + Intronic
1051260872 9:15263384-15263406 TTTGCCATTTACTGGCTGGGAGG - Intronic
1051596226 9:18826657-18826679 TCTTCCATTTACTAACTGCCTGG + Intronic
1052612900 9:30799507-30799529 TTTGCCATTCACTATCTGGCGGG + Intergenic
1055509303 9:76979474-76979496 TCATCCATTTCCTTACTGGCAGG - Intergenic
1055968596 9:81889268-81889290 GCTTCCATTTCCTACCTGCCTGG + Intergenic
1058112036 9:101041260-101041282 TCTTCCATTAACTAGCTAGAGGG - Intronic
1059261943 9:112985532-112985554 TCTGCCATTTAGAAGCTGGGTGG + Intergenic
1059298684 9:113295679-113295701 TCTACCACCTACTAGCTGGGTGG + Intergenic
1061326094 9:129865630-129865652 TCCACCATTTACTAGCTGTGTGG - Intronic
1187359606 X:18612694-18612716 TCTTCACTTTATCAGCTGGCAGG + Intronic
1189249533 X:39589311-39589333 TCTTCCACTAACTAGCTGTGTGG + Intergenic
1190709565 X:53056996-53057018 TCTGCCATTTATTAGCTGTATGG + Intronic
1190755732 X:53400210-53400232 TGTGCCATTTACTAGCTGTGTGG - Intronic
1190962420 X:55265701-55265723 TCTGCCATTTACAAGCTAGCAGG - Intronic
1192388820 X:70703388-70703410 AATTCTCTTTACTAGCTGGCAGG - Intronic
1194073198 X:89353351-89353373 TCTCCCATTTAGTAAGTGGCAGG + Intergenic
1194267664 X:91775461-91775483 TCTGCCATGTTCTAGCTGTCTGG - Intergenic
1194764948 X:97838834-97838856 TCTACCATTTACTAGTTGTGCGG - Intergenic
1195519971 X:105819714-105819736 TCTTCCAATTACTAGCTGTGAGG + Intergenic
1196186074 X:112746444-112746466 TCTTCCACTTACTAGCTGTGTGG - Intergenic
1196563942 X:117182525-117182547 TCTTCTACTTACCAGCTGTCTGG + Intergenic
1196790832 X:119462969-119462991 TCTGCCATTCGCTAGCTGTCAGG - Intergenic
1196893648 X:120312315-120312337 TCTGCCACTTACTAGCTGAGTGG - Intergenic
1197117214 X:122847958-122847980 TCTTCCACTTACTACCTGTGTGG - Intergenic
1197610710 X:128635216-128635238 TCCACCATTTACTAGCTGTGTGG + Intergenic
1198401046 X:136268640-136268662 TCTTCCTTTTACTCGCTAGGTGG - Intergenic
1198551091 X:137745506-137745528 TCTACCACTTACTAACTGGGAGG + Intergenic
1198563048 X:137872082-137872104 TCTGCTATTTACTAGCTGTGTGG + Intergenic
1200584872 Y:4996392-4996414 TCTGCCATGTTCTAGCTGTCTGG - Intergenic
1200727428 Y:6689156-6689178 TCTCCCATTTAGTAAGTGGCAGG + Intergenic
1200728580 Y:6704931-6704953 TCTCCCATTTAGTAAGTGGCAGG + Intergenic