ID: 1017247211

View in Genome Browser
Species Human (GRCh38)
Location 6:152239571-152239593
Sequence GGCTTCTGCTGTACTGAAAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017247211_1017247218 16 Left 1017247211 6:152239571-152239593 CCCGTTTCAGTACAGCAGAAGCC 0: 1
1: 1
2: 2
3: 4
4: 114
Right 1017247218 6:152239610-152239632 TATGGAACTGGGTTTCCTTTTGG 0: 1
1: 0
2: 0
3: 24
4: 247
1017247211_1017247216 4 Left 1017247211 6:152239571-152239593 CCCGTTTCAGTACAGCAGAAGCC 0: 1
1: 1
2: 2
3: 4
4: 114
Right 1017247216 6:152239598-152239620 CCATCAGCTCTGTATGGAACTGG 0: 1
1: 1
2: 0
3: 5
4: 100
1017247211_1017247214 -2 Left 1017247211 6:152239571-152239593 CCCGTTTCAGTACAGCAGAAGCC 0: 1
1: 1
2: 2
3: 4
4: 114
Right 1017247214 6:152239592-152239614 CCTGAGCCATCAGCTCTGTATGG 0: 1
1: 0
2: 1
3: 14
4: 207
1017247211_1017247217 5 Left 1017247211 6:152239571-152239593 CCCGTTTCAGTACAGCAGAAGCC 0: 1
1: 1
2: 2
3: 4
4: 114
Right 1017247217 6:152239599-152239621 CATCAGCTCTGTATGGAACTGGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017247211 Original CRISPR GGCTTCTGCTGTACTGAAAC GGG (reversed) Exonic
903162025 1:21495857-21495879 GGCTTCTCCCGTACTGGAAGCGG + Intergenic
908205814 1:61847844-61847866 GGCTTCTGTTGCTCTGAAAATGG + Intronic
915274382 1:154777835-154777857 GGCTTCTCCTGCTCTGGAACAGG - Intronic
915693163 1:157710951-157710973 GGGTTCTGCTGGACAGATACTGG + Intergenic
916553416 1:165871983-165872005 GGCTTCTGTTCTTCTGGAACTGG - Intronic
920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG + Intergenic
923377360 1:233377948-233377970 TGCTTCTGCTGAACTGACACAGG + Intronic
1063683362 10:8211871-8211893 GGCTTTTGCTTTGCTGAAACAGG - Intergenic
1066539076 10:36424734-36424756 GGCTTCTACGATACTGAACCAGG + Intergenic
1067260225 10:44683062-44683084 GGCTTCCTCTGCACTGAAATGGG + Intergenic
1076446562 10:130518227-130518249 GGTCTCTCCTGCACTGAAACGGG + Intergenic
1082810434 11:57476268-57476290 GGCTGCTGCTGCACGGGAACCGG + Exonic
1082961974 11:58927199-58927221 GGCTACTGTTTTACTTAAACTGG + Intronic
1084705621 11:70814588-70814610 GGCCTCTGTTTTCCTGAAACTGG - Intronic
1086990350 11:93296375-93296397 AGCATCTGCTGTACTGCACCTGG + Intergenic
1089366463 11:117923933-117923955 GGCTTAAACTGGACTGAAACGGG - Intronic
1090521525 11:127484995-127485017 TGCTTCTGCTGTCCTGGAGCTGG + Intergenic
1092465817 12:8730496-8730518 GGCCTCTGCTGGACTGTAGCTGG + Intronic
1094784813 12:33835474-33835496 GCCTTCTGCTGTACTGAAATAGG + Intergenic
1099243414 12:80165440-80165462 GGTTTCTGCTGTCTGGAAACTGG + Intergenic
1101308430 12:103554452-103554474 GGCTTCTGGAGAACTCAAACTGG - Intergenic
1104211886 12:126696907-126696929 GGCTTCTGCTTTTCTGCCACTGG - Intergenic
1112561845 13:100522126-100522148 AGCATCTGCTGTACAGAAGCAGG - Intronic
1115524006 14:34261302-34261324 GGCATCTGCTCTAGAGAAACTGG - Intronic
1117411427 14:55454824-55454846 GGCTGCTTTTGTACGGAAACAGG + Intronic
1118251193 14:64163138-64163160 GGCTTCTAGTGTATAGAAACTGG - Intronic
1118544098 14:66865587-66865609 GGCTTCTTCTGTACCTAATCAGG - Intronic
1129029654 15:72609074-72609096 AGATTCTGCTGTAATGAAAGAGG - Intergenic
1129129921 15:73484386-73484408 GGCTTCTTCTGTCCTGGAGCTGG + Intronic
1129689799 15:77706691-77706713 GGCTTCTGGCATACTGAGACTGG - Intronic
1131483877 15:92804290-92804312 GGCTTTTGCTGTGTTGTAACAGG + Intronic
1136411915 16:30082671-30082693 GGCCTCCGCTGGACAGAAACAGG + Intronic
1137264051 16:46854200-46854222 GGCTTTTGCTGGACTGCAAATGG - Intergenic
1137602767 16:49767924-49767946 GGTTTCTGTTGTAATGAAATTGG - Intronic
1147439850 17:40441424-40441446 GGCTTCTGCTGTACTGGAGCTGG - Intergenic
1151617297 17:75221839-75221861 GGATTCTGCTGTACTAAGCCAGG + Intronic
1152919171 17:83057236-83057258 GGCTTCTGCTGTCCTGGCCCTGG + Intergenic
1157160094 18:45306105-45306127 GGCTTCTACTCTACTGATAAGGG - Intronic
1162741226 19:12775037-12775059 GGCTTCTGCTCACCTGAGACCGG + Intronic
1164259285 19:23555182-23555204 GGCTACTGCTTTACTTAAATTGG - Intronic
1166548476 19:43649023-43649045 GTCTCCTGCTGTACTAAAAGTGG - Exonic
1167742490 19:51332500-51332522 GGCTGCTGCTGGAGTGAAATAGG + Exonic
1168222205 19:54968629-54968651 GGCTTTTACTTTACTGAAGCTGG - Intronic
925958652 2:8994474-8994496 GGCTTCTGCTGTACAGAAACAGG + Intronic
926591404 2:14743894-14743916 GGCCTCTACTGTCCTGAAATTGG + Intergenic
927813563 2:26194384-26194406 GGCTTATACTGCACTGAAAGGGG - Intronic
927862459 2:26568643-26568665 GGGTTCTGTTGTACTCATACTGG - Intronic
929247434 2:39718362-39718384 GTCTTCAGCTGTACCTAAACAGG + Intergenic
936731286 2:115384366-115384388 TGCTTCTGCTTTTCTGAGACAGG - Intronic
942366210 2:175230496-175230518 GGCTTCTGCTGTCTTGAGGCTGG + Intergenic
947001199 2:225458614-225458636 GGCTTCTGCTCTTGTGAACCTGG - Intronic
1169921976 20:10744686-10744708 GGCTTCTGATGAAGTGAAGCAGG - Intergenic
1182066245 22:27433730-27433752 GGCCACTGCTGGAATGAAACAGG - Intergenic
949309677 3:2682847-2682869 GGCTTGTCCTGAAATGAAACTGG - Intronic
950266778 3:11579311-11579333 GGCTACTGCTTTACTGACAATGG + Intronic
950942681 3:16909705-16909727 GGCTTTTGCTGAACAGAAATAGG - Intronic
953423285 3:42771747-42771769 TGCTGCTGCTGTATTGAGACAGG - Intronic
954520904 3:51225479-51225501 GGGTGCTGCTGCACTGATACTGG + Intronic
955201623 3:56856753-56856775 CACTTCTGCTGTAATAAAACTGG + Intronic
955770545 3:62380606-62380628 GGCTTCTGGGGTACTGAGAAAGG + Intergenic
959743608 3:109750089-109750111 GGCATCTGCTGTACTTAAAGCGG + Intergenic
961388863 3:126540347-126540369 GGCTGCTGATGGACTGACACTGG - Intronic
962718341 3:138148231-138148253 GGCTTCTACTGAACAAAAACAGG + Intergenic
964525569 3:157612700-157612722 GGCCTGTGCTGTACTGGAAGTGG - Intronic
964703263 3:159592162-159592184 GGGTTCTACTGAACTGAAATGGG + Intronic
967814927 3:193790530-193790552 TGCTTCTGCTGTGCAGAGACTGG + Intergenic
971207151 4:24581980-24582002 GGTTTCTGCAGTACTGAGAAGGG - Intronic
971448836 4:26780648-26780670 GGCTTCTGGTCTCCTGCAACTGG + Intergenic
974777495 4:66505443-66505465 GGCTTCTGCTCCACATAAACAGG - Intergenic
975064496 4:70043402-70043424 AGCTTCTCCTCTAGTGAAACTGG - Intergenic
975065993 4:70064224-70064246 AGCTTCTCCTCTAGTGAAACTGG - Intergenic
977300566 4:95262459-95262481 TGCTACTGCTGAAATGAAACAGG - Intronic
979815369 4:125095773-125095795 GGCATCTGCTTTACTGACCCAGG + Intergenic
981945457 4:150338015-150338037 TGCTACTGCTGTCATGAAACTGG + Intronic
984869587 4:184314458-184314480 AGCCTCTGCTGGAGTGAAACAGG - Intergenic
985570751 5:643556-643578 GGCTTCTGCTGCACAGACTCAGG + Intronic
986127956 5:4900799-4900821 GGCTTGTGCTTTACAGACACAGG - Intergenic
994455230 5:99997352-99997374 GGAGTCTGGTGTTCTGAAACTGG + Intergenic
997785048 5:136702892-136702914 GGCTTGTGCTCTACAGACACAGG + Intergenic
998652349 5:144135112-144135134 GGTCTCTGCTCTACTGAGACTGG + Intergenic
998889734 5:146733374-146733396 GGTATCTGCTGTGTTGAAACTGG - Intronic
999298413 5:150475040-150475062 GGATTCTGCTGTGCAGACACTGG + Intergenic
1000671663 5:164070873-164070895 GGATTTTGCTGTAGTAAAACTGG + Intergenic
1000956684 5:167552303-167552325 GTTTTCTGATGTACTGAAAAAGG - Intronic
1004323924 6:14656175-14656197 AGTTTCTGCTGTTCTTAAACTGG - Intergenic
1006473053 6:34238682-34238704 GGCCTCTGATGTTCAGAAACAGG + Intronic
1012233915 6:96790787-96790809 CACTTTTGCTGTACTTAAACTGG - Intergenic
1013596265 6:111663603-111663625 TGTTTCTGCTGTACTGAAGTAGG + Intronic
1015152482 6:130055233-130055255 GGATTCGGCTGTACTAAAGCAGG + Exonic
1015886944 6:137927230-137927252 GGCTCCTGCTGAACTGGAAGCGG + Intergenic
1017247211 6:152239571-152239593 GGCTTCTGCTGTACTGAAACGGG - Exonic
1018291083 6:162293158-162293180 GGCCTCTACTGAAGTGAAACTGG - Intronic
1020504790 7:8971192-8971214 GATTTCTGCTGTTGTGAAACAGG + Intergenic
1020513742 7:9090715-9090737 TGCTTCTGCTGCCCTCAAACTGG + Intergenic
1021692630 7:23245603-23245625 GGTTTCTACTGCACTGAAAATGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024418016 7:49130532-49130554 TGCTTCTGCTTTAATGAAGCAGG - Intergenic
1024764447 7:52640610-52640632 GCCTTCTGCTGTTCTGGATCAGG - Intergenic
1031328791 7:120436808-120436830 TGCTTCTGCTGTACTGCTTCAGG + Intronic
1033135215 7:138778541-138778563 GGCTTCTGCCGCACTGAGTCCGG - Intronic
1034149967 7:148907547-148907569 GGCATCAGCTGTAAGGAAACTGG - Intergenic
1039624956 8:39039814-39039836 GGCTAATGCTGCACTGAAAATGG + Intronic
1039911812 8:41832489-41832511 GGCTTCTGCTTCACTGGTACTGG - Intronic
1041575948 8:59395571-59395593 AGCTTTTGCTGCTCTGAAACTGG - Intergenic
1043929577 8:86075404-86075426 GGCTTCTACTGTCATGGAACTGG + Intronic
1048230181 8:132631623-132631645 GGCGTCTGCTATCCTGAAGCTGG - Intronic
1048377485 8:133835355-133835377 GTCTTCTTCTGAACTTAAACAGG + Intergenic
1051221258 9:14850814-14850836 GGCTGCTGCAGTTCTCAAACTGG + Intronic
1053555547 9:39133128-39133150 GGCGTCTGCTGAGCAGAAACGGG + Exonic
1054860800 9:69951097-69951119 GTCTTCTCCTGTACTCAAACTGG - Intergenic
1059003213 9:110372814-110372836 TGCTTCAGCTGTGCTGAAGCTGG + Intronic
1059395759 9:114033076-114033098 TGCTTCTCCTGTAAAGAAACTGG - Intronic
1060356395 9:122913050-122913072 AACATCTGCTGAACTGAAACCGG + Intronic
1060442252 9:123652608-123652630 GGCATCTCCTGCACAGAAACAGG - Intronic
1060958852 9:127664689-127664711 GGCTGCTGCAGTGCTGAGACTGG + Intronic
1187015383 X:15322155-15322177 GACTTCAGCAGTACTGAAGCAGG + Intronic
1189791757 X:44611632-44611654 GGCTTCTGATGTTGTGAAAGAGG + Intergenic
1192363628 X:70454252-70454274 GGCTGCAGCTGCTCTGAAACGGG + Exonic
1198406845 X:136321602-136321624 GGCTTAGGCTGTACTGGCACTGG + Intronic
1198820856 X:140646655-140646677 AGCTTCTCTGGTACTGAAACTGG + Intergenic
1199674241 X:150172106-150172128 AGCTTCTGCTAAACTCAAACTGG - Intergenic
1200778841 Y:7196047-7196069 GTCTTCTGCTGCACTCACACTGG + Intergenic