ID: 1017248086

View in Genome Browser
Species Human (GRCh38)
Location 6:152249388-152249410
Sequence CTGTGCTATGGGAAGGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017248082_1017248086 -8 Left 1017248082 6:152249373-152249395 CCAGGAGAAACAATACTGTGCTA 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG 0: 1
1: 0
2: 2
3: 23
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017248086 Original CRISPR CTGTGCTATGGGAAGGTAAA AGG Intronic
902060597 1:13638888-13638910 ATGTGTTATGGGAAGGCTAATGG + Intergenic
902561871 1:17282705-17282727 CTGTGCAATGAGAAGGTAACTGG - Intronic
903299837 1:22370893-22370915 CTGTCCTATGGGAGGGAAATGGG - Intergenic
905607401 1:39314635-39314657 CTGTGCTATGGGTTGGGAACTGG - Intronic
907317729 1:53583241-53583263 CTGTGCTCAGGGAAGGCACAGGG - Intronic
908179291 1:61588245-61588267 CTGTTACATGGGAAGGTAACAGG - Intergenic
908614396 1:65902455-65902477 CTGTGCTTTTGTAAGGTAAGTGG - Intronic
909879186 1:80851037-80851059 CTGAGCTAGGGCCAGGTAAAAGG - Intergenic
910235740 1:85034398-85034420 CTGTGCACTAGGAAGGCAAAGGG + Intronic
910486548 1:87721222-87721244 CTTTCCTATGGCAAGGAAAATGG - Intergenic
911115730 1:94245634-94245656 ATATCCTATGGGAAAGTAAAGGG - Intronic
913085786 1:115435307-115435329 CTGAGATGTGGGAGGGTAAACGG + Intergenic
913520692 1:119643182-119643204 ATTTGCTATGGGTAGTTAAAAGG - Intronic
916311018 1:163399037-163399059 CTGTGCTCTGGGAGGGGAAATGG - Intergenic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
919422692 1:197390321-197390343 CTGTGCTCAGAGGAGGTAAATGG + Intronic
923279641 1:232430843-232430865 CTGTGGTATGGAAGGGCAAATGG - Intronic
923581009 1:235212835-235212857 CTGTGGTTTGGGAAGTTAATAGG - Intronic
1065804925 10:29385395-29385417 CTGAGCCATGGGAAGGGAAGAGG + Intergenic
1066975633 10:42365748-42365770 CTGTGCCTAGGGAAGATAAAAGG + Intergenic
1067430276 10:46238146-46238168 CTATGCTATGGCAAGGCTAAGGG - Intergenic
1067548781 10:47218653-47218675 CTGTGTTTTAGGAAGGTAATTGG + Intergenic
1069753375 10:70759183-70759205 CTTTGCTTTGGGAAGGAAGACGG - Intronic
1070182357 10:74026439-74026461 CTGTGGCATGGGATAGTAAATGG + Intronic
1071861638 10:89680064-89680086 CTGTAGTATGGTTAGGTAAAAGG - Intergenic
1074866335 10:117546282-117546304 ATGGGCGATGGGAAGGTAGAGGG + Intronic
1075583773 10:123642877-123642899 CTGAGCAATGGGAAGTTCAAAGG + Intergenic
1079359367 11:19757642-19757664 GTGTGTGATGGGAAGGTATAAGG + Intronic
1081169904 11:39854436-39854458 CTGTGTTATGGAAAGGGATATGG + Intergenic
1082687096 11:56252976-56252998 TTCTGCTAAGGGAAGGCAAAAGG + Exonic
1083592707 11:63904768-63904790 CTGTGCTGTGGGAAGAGAAGTGG - Exonic
1083766389 11:64843507-64843529 CTGAGCTCTGGGAAGGCACAAGG - Intronic
1084103367 11:66964749-66964771 CTGGGCTGTGGATAGGTAAAAGG + Intergenic
1084456031 11:69268768-69268790 CTGTGTGGTGGGAAGGAAAATGG + Intergenic
1084569628 11:69951567-69951589 CTGAGCTCTGGGCAGGTCAAGGG + Intergenic
1084725964 11:70942234-70942256 CTGTGGTGTGGGAAGTTCAAGGG + Intronic
1084941115 11:72613863-72613885 CTGTCCTCTGGGAAGATAAGAGG - Intronic
1084978702 11:72816991-72817013 CTGTCCTGTGGGAAGGCCAAGGG - Intronic
1085652631 11:78282134-78282156 CTGTGGTATGGAATGGTATAAGG - Intronic
1086722109 11:90133912-90133934 CTGTGCTATGGGAGAGACAAAGG + Intronic
1087562903 11:99814400-99814422 CTGTATTATGGGAGAGTAAATGG + Intronic
1090081546 11:123616785-123616807 CTGTGCTAAGTGAAGGTCAAGGG - Intronic
1091822864 12:3489749-3489771 CTGTGTTCTGAGAAGGGAAAAGG + Intronic
1092107687 12:5934288-5934310 CTGTGCAAAAGGAAGATAAATGG + Intronic
1092562084 12:9626659-9626681 CTGTACTTTGGGAAGAAAAAGGG + Intergenic
1093444820 12:19245118-19245140 TCTTGCTTTGGGAAGGTAAAAGG - Intronic
1096085790 12:48864363-48864385 CTTTGCTCTGGGGAAGTAAAAGG + Intronic
1096154080 12:49332215-49332237 CTCTGCTATGGGGAGGAAGAAGG - Intergenic
1097548904 12:61041656-61041678 CTGTGGAATGGAAAGGTAGAGGG - Intergenic
1097829973 12:64214045-64214067 GTGTGCAATGGGATGGTGAAGGG - Intronic
1099501472 12:83419133-83419155 CTGTGCTAGGGGAGTGTGAAAGG + Intergenic
1100030082 12:90176156-90176178 CTGTGTTAAGGAAAGCTAAAAGG - Intergenic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100347363 12:93745509-93745531 CTGTGCTATGGGGAAGTGACTGG + Intronic
1103097424 12:118143236-118143258 CAGGGCTAGGGGAAGGGAAATGG - Intronic
1103659679 12:122503745-122503767 CTGTGCTCTGGGAAAATGAAAGG + Intergenic
1103674801 12:122647260-122647282 CTGTGCTTTCGGAAGGACAAAGG + Intergenic
1103777092 12:123374226-123374248 CAGTGCTTTGGGAAGCTAAAGGG - Intergenic
1106372953 13:29154480-29154502 CTGTGTTGTGAGAAGGTTAATGG - Intronic
1107872258 13:44758181-44758203 CTGTGCTATGATTAGGCAAATGG + Intergenic
1109348092 13:61141748-61141770 GTATTCTATGGGAAGTTAAAGGG + Intergenic
1109797267 13:67332231-67332253 CGGTGCTATGGGATGTTTAAAGG - Intergenic
1110124061 13:71919816-71919838 TGTTGCTATGGGAAAGTAAAGGG - Intergenic
1114953718 14:27791037-27791059 CTGTGTTATGGAAGAGTAAATGG - Intergenic
1115829559 14:37320668-37320690 CAGTGCTATGGGAATGGCAAGGG - Intronic
1115887828 14:37993622-37993644 CAGTGCTATGGGAAGGGAATAGG - Intronic
1116861716 14:50000887-50000909 TTCTGCTATGGGAAGGACAAGGG + Intronic
1117329093 14:54694912-54694934 CTCTACTCTGGAAAGGTAAAGGG + Intronic
1118171065 14:63389022-63389044 CAGTGCTATGGGAAGGTCACCGG + Intronic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1119528328 14:75341000-75341022 CAGTCCTGAGGGAAGGTAAATGG - Intergenic
1120384566 14:83827819-83827841 CTGTGTGAAGGTAAGGTAAAGGG + Intergenic
1120524411 14:85561068-85561090 CTGTGCAATAGAAAGGTAATGGG - Intronic
1120810587 14:88799327-88799349 CTGTACTATGGGAGGCCAAAGGG + Intergenic
1121859781 14:97306443-97306465 CTGAGCTAAGGGAAGTAAAATGG - Intergenic
1122668050 14:103347686-103347708 GTGTACTTTAGGAAGGTAAAGGG - Intergenic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1122895445 14:104754379-104754401 CTGGGCCATGGGGAGGTAAGGGG + Intronic
1126414296 15:48401772-48401794 CTGGGCTAAGGCAAGGTAAGTGG + Intergenic
1126928016 15:53612685-53612707 CTGTGCTATAGTAAGGACAATGG + Intronic
1127178834 15:56392729-56392751 TTATGGTAAGGGAAGGTAAATGG + Intronic
1127851651 15:62918405-62918427 CTGTCTGATGGGAATGTAAATGG + Intergenic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1129750833 15:78062219-78062241 CTATTCTCTTGGAAGGTAAAGGG + Intronic
1131859664 15:96639110-96639132 CTGCCCTAAGGGAAGGAAAATGG - Intergenic
1132369024 15:101280290-101280312 CCTTGCTATGGCAAGGTCAAAGG + Intergenic
1132903486 16:2270783-2270805 CTCCGCTCTGGGAAGGTAAGGGG - Intergenic
1133503083 16:6383922-6383944 CTGTGGTATGGGAATTTTAAGGG + Intronic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1140752478 16:78038143-78038165 TTGTGCTATGGGAATTTACAAGG - Intronic
1142117306 16:88365809-88365831 CTCTGCCATGATAAGGTAAATGG - Intergenic
1142950930 17:3479549-3479571 CAGTGCTGTGGGAAGGTAGAAGG - Intronic
1144457372 17:15430218-15430240 CTGTGCTTTGGGAAGCTGCAGGG + Intergenic
1144796506 17:17895107-17895129 CTGTCCTATGGGAGGATAAGAGG - Intronic
1149513165 17:57258836-57258858 ATGTGCTTTGGGAAGGGAAGGGG + Intronic
1149722057 17:58855145-58855167 CTGTGCTTCTGGAAGGGAAAGGG + Intronic
1150337863 17:64343380-64343402 CTGTGCCCTGGGAAGTTACAGGG + Intronic
1153134451 18:1898376-1898398 AAGTGTTATGGGAAGGTAAGAGG + Intergenic
1153616865 18:6943316-6943338 CTGTGCTCTGTGATGGAAAATGG - Exonic
1155410776 18:25542385-25542407 CTGTGTGCTGGGAAGATAAAGGG + Intergenic
1156490643 18:37493907-37493929 GTGTGGTATGGGAAAATAAATGG + Intronic
1156685705 18:39642915-39642937 CAGTGCTATTGTAAGGGAAAAGG + Intergenic
1157269760 18:46263698-46263720 CTGTGCTGTGGGAAGTCAACAGG - Exonic
1157762778 18:50276414-50276436 CTGTGCTGTGGGGAGGAAGAGGG + Exonic
1159128049 18:64247736-64247758 GTGTGGTAAGGGAAGGTAGATGG - Intergenic
1159471731 18:68866666-68866688 CAGTGCTATGGCAAGATAAAGGG - Intronic
1160344311 18:78120208-78120230 CTGTGATATGAGAAGGAATAAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162668534 19:12235922-12235944 CTGTGCCTAGGGAAGATAAAAGG + Intronic
1163485362 19:17582356-17582378 CTGAGCTATGGGATGGGAATGGG + Exonic
1163983649 19:20924829-20924851 CTGTGCCTAGGGAAGATAAAAGG - Intronic
1164048858 19:21566873-21566895 CTCTGCCTAGGGAAGGTAAAAGG + Intergenic
1164070735 19:21765981-21766003 CTGTGCCTAGAGAAGGTAAAAGG + Intronic
1165849234 19:38839725-38839747 CTGTCCCATGGGAAGGCAGAAGG + Intronic
925005799 2:442240-442262 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005811 2:442333-442355 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005853 2:442613-442635 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005892 2:442893-442915 CTGTGCTATGAGATGGTCACTGG + Intergenic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
927843430 2:26459216-26459238 CTGAGCTATGGACAGGGAAAAGG - Intronic
929294031 2:40226177-40226199 CTGGGCAATGGGAAGGGCAAAGG + Intronic
930091644 2:47535293-47535315 CTGCCCTATGGGCTGGTAAAGGG + Intronic
930153747 2:48084088-48084110 CTGTGCTATATGAAGAAAAAAGG + Intergenic
930494174 2:52117978-52118000 CTGTGCACTGAGAAGGGAAAGGG - Intergenic
933030444 2:77321996-77322018 CTGAGCTGTAGGAGGGTAAAAGG + Intronic
933609100 2:84415648-84415670 CTGTGCTCTCAGAAGATAAAAGG - Intergenic
934123574 2:88864056-88864078 CTGGGATGGGGGAAGGTAAAAGG + Intergenic
934791557 2:97066717-97066739 ATGTGCTTTGGGAATGTGAAAGG - Intergenic
934814881 2:97315826-97315848 ATGTGCTTTGGGAATGTGAAAGG + Intergenic
934822814 2:97392657-97392679 ATGTGCTTTGGGAATGTGAAAGG - Intergenic
935591067 2:104845556-104845578 CTTTTCTATGGGAAAGAAAAAGG - Intergenic
937160982 2:119760370-119760392 CTGTGATATACGAAGGTAAGAGG + Exonic
937770239 2:125712384-125712406 CTGTGAAATGGGAATGTTAATGG + Intergenic
938995876 2:136677165-136677187 CAGTGTTATGGGAAAGAAAAGGG + Intergenic
941883063 2:170501212-170501234 ATGTGCAGTGGGAAGGGAAAAGG - Intronic
944348271 2:198695257-198695279 CTGTGCTAAGGGGATGGAAAAGG + Intergenic
1168903918 20:1389272-1389294 ATCTGCTGTGGGAAGGCAAAGGG + Intronic
1169871603 20:10254111-10254133 CTATGCAATGGGCTGGTAAAAGG - Intronic
1171723312 20:28588932-28588954 CTGTGCTTTGGGAAGGCAATGGG + Intergenic
1171754743 20:29094150-29094172 CTGTGCTTTGGAAAGGCAATGGG - Intergenic
1171787909 20:29488388-29488410 CTGTGCTTTGGGAAGGCAATGGG + Intergenic
1171860030 20:30391000-30391022 CTGTGCTTTGGGAAGGCAATGGG - Intronic
1177013505 21:15756284-15756306 CTGTGCTTTGGAAGGGAAAACGG + Intronic
1178458832 21:32782227-32782249 CTGTGCTTTGGGAAAGAAAGAGG + Intergenic
1179258461 21:39737910-39737932 TTCGGCTATGGGAAGGTGAAAGG + Intergenic
1180296865 22:10947593-10947615 CTGTGCTTTGGGAAGCCAATGGG + Intergenic
1180411743 22:12617976-12617998 CTGTGTTTTGGGAAGGCAATGGG - Intergenic
1182080259 22:27523863-27523885 CTGTGAAATGGGTATGTAAATGG - Intergenic
1182872383 22:33659553-33659575 ATTTGCTGTGGGAAGGAAAATGG + Intronic
1183276936 22:36904422-36904444 GTGTTCTATGGGATTGTAAATGG - Intergenic
1183801488 22:40168893-40168915 CTGTGCTATGGGAATAAAAAGGG - Intronic
1184179819 22:42813156-42813178 CTCTGCTAGGGGAAGACAAAGGG + Intronic
949364650 3:3267730-3267752 CTGTTCTATGGGAAGGTAGTGGG + Intergenic
949701361 3:6763052-6763074 TTTTTCTATGGGAAGGAAAAAGG - Intergenic
950092356 3:10304934-10304956 AAGTCCTCTGGGAAGGTAAAGGG - Intronic
950217603 3:11170442-11170464 CTGGGCAGTGGGAAGATAAATGG + Intronic
950731795 3:14966213-14966235 CTGGCCTATGGGAAGGAAACTGG - Intronic
951550807 3:23873353-23873375 CTGTACTGAGGGAAGGTACAGGG + Intronic
951848348 3:27109477-27109499 CCGTGGTAAGGGAAGATAAATGG - Intergenic
952843876 3:37670388-37670410 CTGTCCTATGGGAAGGTGAGTGG - Intronic
953663495 3:44907998-44908020 CTATGCTATGGGATGGCAGATGG + Intronic
953795557 3:45983153-45983175 CTGTGCGTTGGAAAGGTGAAGGG + Intronic
953942551 3:47113214-47113236 CAGCGCTATGGGAAGCTAAGTGG - Intronic
954631003 3:52047565-52047587 CTGTGCCAGGGGCAGGCAAAGGG - Intergenic
955740795 3:62089514-62089536 CTGACCTATGGCAAGTTAAAAGG - Intronic
957468467 3:80626649-80626671 CTTTGCTATAGAAAGTTAAAAGG - Intergenic
957660207 3:83140431-83140453 CTGTGTTAATGGAAGATAAAGGG + Intergenic
960599113 3:119437747-119437769 CTGTGTTTTGTGAAGGTAAGTGG - Exonic
961864825 3:129945997-129946019 CTGTGAAATGGGAGGGTGAATGG - Intergenic
962784336 3:138752764-138752786 CTATGCTATGGTAGGATAAAAGG + Intronic
963849902 3:150200820-150200842 CTGAGCTATGGAAAGGAATAAGG - Intergenic
964902012 3:161671104-161671126 CTGTGATATATGTAGGTAAAGGG + Intergenic
965116671 3:164499206-164499228 CTATGCTCTGGGATGGTAGATGG + Intergenic
966621348 3:181967662-181967684 CAGTGCTATAGGAAGGAGAAAGG + Intergenic
967387511 3:188926127-188926149 TTGTGGGATGGGAAGGGAAAAGG - Intergenic
968841964 4:3014167-3014189 CTGTGATAAGGGAAAGGAAAGGG - Intronic
969118837 4:4891957-4891979 CTGTGCTATGGGATTTTAAAGGG + Intergenic
971644311 4:29178258-29178280 CTGTATTATGGAAAGATAAATGG + Intergenic
972288830 4:37672172-37672194 CTGATCTCTGGGAAGGGAAAGGG - Intronic
974107208 4:57483801-57483823 CTGGCCTCTGGGAAGGTAGAAGG + Intergenic
975327221 4:73072138-73072160 CTGTGCTTTGGGAAGCTGAGTGG + Intergenic
976051137 4:81012537-81012559 CTCTGCTAGGGCAAGGCAAAAGG + Intergenic
977421141 4:96801280-96801302 CTGTGCTATGGGAGTTTCAAGGG - Intergenic
978012564 4:103705596-103705618 ATGTGCTATGGGAATCTATAAGG + Intronic
985438200 4:189954840-189954862 CTGTGCTTTGGGAAGCCAACGGG - Intronic
985819867 5:2152320-2152342 CTGTGCAATGAGAGTGTAAATGG - Intergenic
985819870 5:2152355-2152377 CTGTGCAATGAGAGTGTAAATGG - Intergenic
985819873 5:2152390-2152412 CTGTGCAATGAGAGTGTAAATGG - Intergenic
985819879 5:2152460-2152482 CTGTGCAGTGAGAATGTAAATGG - Intergenic
987774622 5:22348180-22348202 CTGTGCTATGGGCAGCCAGAAGG - Intronic
988728888 5:33950554-33950576 CTGTGCTATGGCTAGGTAAAGGG + Intronic
988897737 5:35696414-35696436 ATGAGCAATGGGAAGGGAAATGG + Intronic
989251297 5:39319047-39319069 CTGTGCTATGGGAGGGTTGGGGG - Intronic
989817731 5:45756760-45756782 TTGTGCTATGGCAAGGGAAGAGG - Intergenic
992207872 5:74448596-74448618 TTGTGCTATGGGAAGGAGAAAGG + Intergenic
993088018 5:83387979-83388001 ATGAGTTATGGGAAGGAAAAAGG - Intergenic
994108156 5:95969392-95969414 CTTTGATTTGGGAAAGTAAAGGG + Intergenic
994158161 5:96526271-96526293 CTGAGCTATAGGAAGGAATAGGG + Intronic
995938401 5:117547426-117547448 CTGAACTTTGGGAAGGTAACAGG + Intergenic
997057366 5:130460313-130460335 CTCTGCTAGGGGAGTGTAAAAGG + Intergenic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
999670685 5:153956838-153956860 CTGTGTTATGGGCAGAGAAAGGG - Intergenic
1000575049 5:162966651-162966673 CTCTGCTATGGCAATGCAAAGGG - Intergenic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002892256 6:1345484-1345506 CAGTGCTTTGGGAAGCTGAAAGG + Intergenic
1003644072 6:7900204-7900226 CTTCTCTATGGGAAGGTGAATGG - Intronic
1004497013 6:16174279-16174301 ATGTGGTATAGGAAGATAAAGGG - Intergenic
1004683159 6:17916385-17916407 TTCTGCTCTGGGAAGGTAACAGG - Intronic
1005476086 6:26209411-26209433 CAGTGCTAAGGGAAGAGAAAAGG - Intergenic
1014316499 6:119872149-119872171 CTGTCCTCGGGGAAGGAAAAGGG + Intergenic
1015381099 6:132570358-132570380 CTGTGCTACGCGAACGTGAATGG + Exonic
1016476810 6:144436232-144436254 CTGTTCTTTGGAAAGGTCAATGG + Intronic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1019119485 6:169791947-169791969 CTATGCTGTGGGAAGGGACAAGG - Intergenic
1022762008 7:33365329-33365351 TTCTTCTATGGGAAGGTCAAGGG + Intronic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023531557 7:41161869-41161891 CAGTGTTATGGGAAGACAAATGG + Intergenic
1024798643 7:53050100-53050122 CTATCCTATGGGAATTTAAAAGG - Intergenic
1024996288 7:55275326-55275348 CTGTGCAGTGGGAAGGGAAAGGG - Intergenic
1026101838 7:67390270-67390292 CTGTGCTGTGGGAAGGGGAGGGG - Intergenic
1027336642 7:77157923-77157945 CTGTGCTATGGGTAGGAGATAGG - Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1029779148 7:102713186-102713208 CTGTGCTATGGGTAGGAGATAGG + Intergenic
1029920429 7:104256748-104256770 CTGAGCTATGGGAGAGGAAAGGG - Intergenic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1034726198 7:153338261-153338283 TGGTGCTATGGGAAGGTAGGGGG - Intergenic
1035273116 7:157731995-157732017 CTGGGCCATGGGACGGGAAAGGG - Intronic
1037607249 8:20448297-20448319 CTTATCCATGGGAAGGTAAAGGG + Intergenic
1037982274 8:23262714-23262736 CTGTGCTACAGGAAATTAAAAGG + Intergenic
1038055909 8:23857469-23857491 CTGTGATATAGCAAGATAAAAGG + Intergenic
1039835105 8:41249743-41249765 CAGTGCTGTGTGAAGGGAAACGG + Intergenic
1041063057 8:54054708-54054730 CTGTAATACGTGAAGGTAAAGGG + Intronic
1041277526 8:56178117-56178139 AAGTTCTATGGGAAGGAAAAAGG + Intronic
1041679133 8:60569070-60569092 CCCAGTTATGGGAAGGTAAATGG + Intronic
1042432200 8:68720680-68720702 CTGTGATAGGGATAGGTAAATGG - Intronic
1042884942 8:73538554-73538576 CTCTGATATGGAAAGGAAAAAGG + Intronic
1043661396 8:82746765-82746787 CTGTGCTAATGAAAGGTAAAAGG - Intergenic
1043871175 8:85434783-85434805 GTGTGCTATGGGAAGAGTAAAGG + Intronic
1044469748 8:92552940-92552962 GTCTGTTATGGGAACGTAAAGGG - Intergenic
1044738494 8:95302315-95302337 CTGTGAAATGGGAATGGAAAGGG + Intergenic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1045394757 8:101749864-101749886 CTGTACTATGTGGAAGTAAAAGG - Intronic
1045561429 8:103267615-103267637 CTGAGCTATGGGAAGTTAAAAGG + Intergenic
1047503420 8:125460035-125460057 CTGTGCTAAGGGAAGATGATGGG - Intergenic
1047654786 8:126965129-126965151 CTGTAGTTTGGGAAGCTAAATGG - Intergenic
1048705738 8:137151109-137151131 CTGTGCTAAGGGCAGTGAAATGG - Intergenic
1049157625 8:141076466-141076488 CTGGGACAGGGGAAGGTAAATGG + Intergenic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1051559635 9:18425912-18425934 ATGTTCTTTTGGAAGGTAAAGGG + Intergenic
1051888580 9:21920567-21920589 GTGGGCTATTGGAAGGTAAGTGG - Intronic
1052666615 9:31502963-31502985 CTGTGGTATTGGGATGTAAAAGG - Intergenic
1053443822 9:38136400-38136422 CTGTTAGATGGGAAGGGAAAGGG - Intergenic
1053726790 9:41011420-41011442 CTGTGCTTTGGGAAGCCAATGGG - Intergenic
1054339155 9:63840380-63840402 CTGTGCTTTGGGAAGCCAATGGG + Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1057205068 9:93166926-93166948 CTGTGGGATGGGAAGGTACAGGG - Intergenic
1061547851 9:131315143-131315165 CTGTGCTTTGGGAAGGTCACTGG + Intergenic
1202803725 9_KI270720v1_random:28774-28796 CTGTGCTTTGGGAAGGCAATGGG + Intergenic
1203448523 Un_GL000219v1:85846-85868 TTGTGCTTTGGGAAGGCAATGGG + Intergenic
1185925188 X:4138189-4138211 CTAAGCTATGGGTAGGCAAAGGG + Intergenic
1188306715 X:28568150-28568172 CTGTGGTTTGTGAAGGTATATGG - Intergenic
1188582482 X:31731401-31731423 CTGTGACATGGGAAGCTGAAAGG + Intronic
1188875016 X:35418770-35418792 CTGTGCTTAGAGAAGGTAACTGG + Intergenic
1191888864 X:65920170-65920192 CTGTGCTCTGGGCTGGTACAGGG + Intergenic
1192218512 X:69180568-69180590 GGGTGCTATGGGAATGTACAGGG + Intergenic
1192281291 X:69688813-69688835 CTAGGCTATGGAGAGGTAAATGG + Intronic
1192323060 X:70107805-70107827 CTGAGCTATAGGAAGGAATAAGG + Intergenic
1192729989 X:73793484-73793506 CTGTGATATGGAAAGGGGAAGGG - Intergenic
1197055101 X:122109247-122109269 CTGTGCCATGGCAATGTGAAAGG + Intergenic
1199370505 X:147042434-147042456 CTTTGCTAGGGCAATGTAAAAGG + Intergenic
1201379535 Y:13358886-13358908 CTCTGATATGGGAAGGAATACGG - Intronic
1201609230 Y:15822619-15822641 CTTGGCAATGGGAAGGTCAATGG + Intergenic