ID: 1017248420

View in Genome Browser
Species Human (GRCh38)
Location 6:152253093-152253115
Sequence CAGGGACAAGACTGAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017248420 Original CRISPR CAGGGACAAGACTGAGTTGC TGG Intronic
900685370 1:3944733-3944755 CAGAGACAAGAGTGAGGTGATGG + Intergenic
901779920 1:11587158-11587180 CAGAGCCAAGACTGAGATCCAGG + Intergenic
902647920 1:17816635-17816657 AAAGGACAAGACGGAGTTGCAGG - Intronic
902654671 1:17859223-17859245 CAGGCCCAAGACTGAGTCCCGGG - Intergenic
903009716 1:20320955-20320977 CAGGGAGAAGAGTGGGTTGTGGG + Intronic
905977005 1:42183159-42183181 CAGGTTCAAGTCTGAGTAGCTGG - Intronic
906341980 1:44988362-44988384 CACTGCCAAGACTGAGTGGCTGG - Intergenic
907301089 1:53486741-53486763 CAGGGAGAAGGCTGAGTGACAGG + Intergenic
908418429 1:63935679-63935701 CAGTGACAAGACAGGGTAGCAGG - Intronic
910214807 1:84832541-84832563 CAGGGTCATGAAGGAGTTGCAGG + Intronic
913165427 1:116180581-116180603 CAGAGCCAAGACTGAGATCCAGG + Intergenic
914953485 1:152140399-152140421 CAGGCACAATACTGAGTGCCAGG - Intergenic
915477371 1:156161086-156161108 CAGGGGCAGGACTGAGTGGTGGG + Intronic
915592095 1:156876363-156876385 CAGGGACAGGACTGAGTTGGGGG - Intronic
917424756 1:174902330-174902352 CAGAGACAACTCTGAGTTCCTGG - Intronic
920300089 1:204983223-204983245 CAGGGACAAGAATCAGTTATGGG + Intronic
921899205 1:220432548-220432570 CAAGCACATGACTCAGTTGCTGG + Intergenic
922062433 1:222105347-222105369 ATGGGACAAGACTGGGTTTCTGG - Intergenic
923135842 1:231117960-231117982 CACTGCCAAGACTGAGTGGCTGG - Intergenic
923426848 1:233879112-233879134 CATGGACAGGACTGAGGTTCAGG + Intergenic
1063382065 10:5591698-5591720 CAGGGACAATGCTGAGCTGGAGG + Intergenic
1064236466 10:13580690-13580712 CAGGGACCAGTCTCAGCTGCAGG - Intergenic
1066415796 10:35220310-35220332 GAGAAAGAAGACTGAGTTGCTGG + Intergenic
1066488786 10:35874086-35874108 CAGGGTCCTGACTGAGTTGCAGG - Intergenic
1067078458 10:43201130-43201152 CAGGCTCAAGACTGAGCTTCTGG + Intronic
1069772301 10:70907591-70907613 CAGGGCCCAGGCTGAGCTGCGGG + Intergenic
1070051055 10:72890276-72890298 CAAGTACCAGACTGAGTGGCTGG + Intergenic
1070903190 10:80048782-80048804 AAGGGACAAGCCTGAGATGGGGG - Intergenic
1072194705 10:93107225-93107247 CAGGGACAAGCTGGTGTTGCTGG - Intergenic
1072203341 10:93180599-93180621 CCGGGAGAAGTCTGAGTTGAAGG - Intergenic
1072501677 10:96024059-96024081 CATGGACAAGAGTGAGGGGCTGG - Intronic
1072743809 10:97926215-97926237 CAGGGGGGAAACTGAGTTGCGGG + Intronic
1073025705 10:100485943-100485965 CAAGGAGAAGTCTGAGCTGCAGG - Intergenic
1074118546 10:110476186-110476208 CAGGGCCCAGAGTGAGCTGCAGG - Intergenic
1075470594 10:122686358-122686380 CAGGGACCCGACTGATTGGCTGG + Intergenic
1078063687 11:8064211-8064233 CAGGGAGAAGACTGAGATGAAGG + Intronic
1078749183 11:14143633-14143655 CAAGAATTAGACTGAGTTGCAGG + Intronic
1078907520 11:15701733-15701755 TGGGGAGAAGACTGAGATGCAGG - Intergenic
1081652606 11:44834400-44834422 CAGGGAGAGGACTGAGTGGTTGG + Intronic
1081715083 11:45244392-45244414 AAGGGACAAGAGTGAGTTTCTGG + Intronic
1083647629 11:64181841-64181863 CTTGGAGAAGACTGAGTTGGTGG + Intergenic
1084273803 11:68041960-68041982 CAGGGCCAAGACAGAGCAGCTGG + Intronic
1089863850 11:121614911-121614933 CTGGGCCAAGACTGACTTGGGGG + Exonic
1090610639 11:128467541-128467563 CAGGGATAAGGGGGAGTTGCAGG - Intronic
1093314893 12:17637138-17637160 CAGGGAATAGAATGGGTTGCAGG - Intergenic
1093997295 12:25655782-25655804 CCTGGCCAGGACTGAGTTGCTGG + Intergenic
1097068318 12:56336942-56336964 GAGGGACAAGGGTGAGTTGGAGG - Intronic
1097199736 12:57268391-57268413 CAGGGACCAGCATGGGTTGCTGG + Exonic
1099596352 12:84671664-84671686 CAGGGACTAGAGTGGGGTGCAGG - Intergenic
1099958322 12:89372832-89372854 CTGGGGTAAGACTGAGCTGCAGG - Intergenic
1100827046 12:98484257-98484279 CAGGGTCAAGAGTGAGTTCTGGG - Intergenic
1101774373 12:107780171-107780193 CAGGGACAGGCCTGCGTTGAAGG + Intergenic
1102230906 12:111261569-111261591 GATGGACAAGAGTGAGTTTCTGG - Intronic
1102902400 12:116648528-116648550 CAGGGACAAGACTGGCTTTCTGG - Intergenic
1103729717 12:123019494-123019516 CAGGGAGATGGCTGAGTGGCAGG - Intronic
1104159007 12:126160914-126160936 CAGGGACAACCCTGGGTTGCAGG + Intergenic
1105964706 13:25373440-25373462 CAGGGTCAAGACTAAATAGCAGG + Intronic
1107750215 13:43557367-43557389 CAGGGACAAGACACAATTTCAGG + Intronic
1107998314 13:45883530-45883552 CTGGCATAAGACTGACTTGCTGG - Intergenic
1109520859 13:63508790-63508812 CAGGGACATGATGGAGTTGAAGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1115385191 14:32788956-32788978 CTGAGACAGGACTGAGTTCCTGG + Intronic
1117618327 14:57557586-57557608 CATTGACAAGACTTAGTTTCTGG + Intergenic
1118527345 14:66661252-66661274 CTGGGACAAAACAGAGTTGCTGG + Intronic
1119271593 14:73310194-73310216 CAGGGACAACAGGGAGTTGCAGG + Intronic
1119726399 14:76924316-76924338 AAGGGACAGGACGGAGCTGCAGG - Intergenic
1120283066 14:82463716-82463738 CTGAGACAGGACTGAGTTCCTGG + Intergenic
1121537296 14:94699623-94699645 CAGGGACAAGATTGAGTCAAGGG + Intergenic
1123192603 14:106585720-106585742 CAGGGACAAGACATTGTTGATGG - Intergenic
1126718131 15:51544323-51544345 CAGGAACAAGAGAGAGTTGCGGG - Intronic
1126742979 15:51796963-51796985 CAGGGACAGCACGGAGATGCTGG + Intronic
1127291451 15:57574743-57574765 CAGGGACAGAACTGACTTGGAGG + Intergenic
1127569406 15:60226702-60226724 CAGGCACAAGGCTGGGTTTCTGG - Intergenic
1128247538 15:66143413-66143435 CAGGGAGTAGACTGAGGGGCTGG - Intronic
1128787216 15:70406685-70406707 CAGGGCCATGAGTTAGTTGCAGG - Intergenic
1130109831 15:80954964-80954986 CATGGACCACACTGAGTAGCAGG - Intronic
1131117991 15:89806115-89806137 CATTGACAAGACTGAGCTGGTGG - Exonic
1132796120 16:1723957-1723979 TAGGAGCAAGACTGTGTTGCTGG + Intronic
1132931108 16:2459715-2459737 CAGGGACAGGACGGGGTTGCTGG - Intergenic
1133209026 16:4252743-4252765 CAGGGAGAAGTCTGGGTTGGTGG - Intergenic
1133390854 16:5408789-5408811 CAGGAGCAAGACAGAGTTGGGGG + Intergenic
1134445868 16:14331122-14331144 CTGGGACAAGCCTGGGTAGCAGG + Intergenic
1137476719 16:48815736-48815758 CAGGGACAAGATGGAGCTGGAGG + Intergenic
1138057047 16:53846107-53846129 CAGGGACCAGAATGGGTGGCAGG + Intronic
1139592394 16:67940557-67940579 CAGGGACAAGATTGAGCATCTGG - Intronic
1140630318 16:76844607-76844629 CATGGACATCAATGAGTTGCAGG + Intergenic
1141334695 16:83143662-83143684 CAGGGACAAGAATGAGTGCAGGG + Intronic
1144091164 17:11857827-11857849 CAGGAGCAAGAGGGAGTTGCGGG - Intronic
1145259372 17:21345536-21345558 CAGAGACAAGGCTGAGAGGCAGG - Intergenic
1145317246 17:21742413-21742435 CAGAGACAAGGCTGAGAGGCGGG + Intergenic
1145961677 17:28890031-28890053 CAGGGACAACACTGGGGGGCTGG + Intronic
1146032934 17:29381900-29381922 CAAGGTCAAGACTGACTTCCTGG - Intergenic
1146972176 17:37082179-37082201 CAAGGACAAGAGTGAGGGGCTGG + Intergenic
1147678000 17:42220483-42220505 CAGGGACTAGACAGAGCCGCCGG - Intronic
1147688050 17:42299089-42299111 CAGGGACGAGACAGAGCCGCCGG + Intronic
1149960038 17:61098656-61098678 CATGGACAAGAGTGAGTAGAAGG + Intronic
1151417166 17:73973990-73974012 CAAGGCCAAGGCTGAGTAGCTGG - Intergenic
1156836888 18:41565839-41565861 AAGGGACAAGACTGCCTTGTGGG - Intergenic
1157609527 18:48947848-48947870 CCGGGAGAGGACTGACTTGCAGG + Intronic
1159278448 18:66251222-66251244 AAGGGACAAGTCAGAGTTGCAGG - Intergenic
1160730270 19:638909-638931 CAGGGCCAGGACTGGGCTGCTGG + Intergenic
1162583598 19:11545615-11545637 CAGGGAGATGAGGGAGTTGCTGG + Intronic
1164854141 19:31507464-31507486 CAGGGAGAAGACTGTGTAGATGG - Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1167732439 19:51268389-51268411 GATGGAGAAGACCGAGTTGCAGG + Intronic
1168224148 19:54982487-54982509 CAGGGACTGGCCTGAATTGCAGG + Exonic
925338888 2:3119442-3119464 CAGGGACAAGACTGACTTTAGGG + Intergenic
926339190 2:11890745-11890767 CAGGGAGAAAACTGAGGTTCTGG - Intergenic
927229661 2:20809796-20809818 CAGGGAGGAGACTGATTTGCTGG + Intronic
927937601 2:27084389-27084411 CAGTGACAAAATTGAGTTGAAGG - Intronic
929008670 2:37419709-37419731 CAGGGAGAAGACTGAGGGGTAGG + Intergenic
931383263 2:61773490-61773512 CAGGAACAAGAGGGAGTGGCAGG + Intergenic
932937652 2:76124307-76124329 AAGGGAGTAGACTGAGTGGCTGG + Intergenic
933436551 2:82257200-82257222 CTGGGACAGGACTGAGTTCTAGG - Intergenic
935082473 2:99811666-99811688 CAGGGATAAGACTGAATTAATGG - Intronic
935378605 2:102425700-102425722 CGGGGACAAGACTGCTTTACAGG - Intronic
937514786 2:122640998-122641020 CAGGGAAAAGACTGAGGTCAAGG - Intergenic
937999056 2:127717810-127717832 CAAGGACATGCCTGAGTTTCTGG - Intronic
939433715 2:142145751-142145773 CAGGGTCAAGACTGAAAGGCTGG - Intergenic
940098300 2:150004016-150004038 CAAGGACAAGACTGAGGTGTTGG - Intergenic
940362755 2:152813669-152813691 CAGGGCCAAGGCAGAGTTGAAGG - Intergenic
941191620 2:162391082-162391104 CAGAGAGAAGACTGTGTTTCTGG - Intronic
942209655 2:173657933-173657955 CAGGTAAAAGAGGGAGTTGCTGG + Intergenic
943626937 2:190211644-190211666 CAGGGACAGGAGGGAGTTGGGGG - Intronic
945487592 2:210416036-210416058 CAGGGACACCAATGAGTTGTAGG + Intergenic
945969432 2:216221482-216221504 TGGGGACAGGACAGAGTTGCAGG - Intergenic
946194371 2:218024329-218024351 CAGGGACATGAGTGTGTTGGAGG - Intergenic
947179863 2:227402350-227402372 CAGGGACTAGACTGCCTTGTGGG - Intergenic
947969019 2:234306433-234306455 CAGGCAAAAGACTCAGGTGCAGG + Intergenic
948734136 2:239988472-239988494 CAGGCACAGGACTGAGATGGTGG + Intronic
1169064212 20:2684999-2685021 CATGGATAAGCCTGAGGTGCTGG - Intergenic
1170554343 20:17503682-17503704 CAGGGAGGAGGCTGAGGTGCAGG - Intronic
1172965731 20:38833294-38833316 CAGGGACAGGAGTGGGTTGGAGG + Intronic
1173755936 20:45516028-45516050 CAGAGACAAGACTGAGACCCCGG + Intergenic
1173863644 20:46300241-46300263 CAGGGACAACAGAGAGTTCCTGG - Intronic
1175683080 20:61005621-61005643 AAGGAACCAGACTGAGATGCAGG + Intergenic
1179143527 21:38748254-38748276 CAGGAACGAGACTGAGAGGCAGG - Intergenic
1179842223 21:44084646-44084668 CAGGGTCAGAACTGAATTGCAGG - Intronic
1184355513 22:43977010-43977032 AAGGCACAAGACTGAACTGCAGG - Intronic
1184940403 22:47760744-47760766 CAGGGACCTGGCTGAGTTACTGG + Intergenic
1185284560 22:49994460-49994482 CAGGGACAAGTCTGGAGTGCGGG - Intergenic
949561977 3:5211596-5211618 CAGAGACAAGGCTGAGCTGCAGG - Intronic
952344326 3:32469787-32469809 GAGGGACAAGACTTAGATGTGGG + Intronic
954997406 3:54894299-54894321 CTGCGAAAGGACTGAGTTGCCGG - Intronic
955984683 3:64560336-64560358 CAGGAAAAAGACTGAGTAGATGG + Intronic
956606595 3:71079106-71079128 CAGGGGCAAGACAGAGTGGGTGG - Intronic
956906665 3:73772947-73772969 CAGGGACAAGGGTGTATTGCAGG + Intergenic
959439283 3:106357280-106357302 CAGGGACACCAGTGAGTTGTAGG + Intergenic
959675526 3:109031096-109031118 CAGGGACAACAGTAAGTTGAAGG + Intronic
959719579 3:109471457-109471479 CACTGGCAAGACTGAGTGGCTGG - Intergenic
959952284 3:112193532-112193554 CAGGCACAAGGCTGCTTTGCTGG + Intronic
966824179 3:183949918-183949940 CACGGAGAAGCCTCAGTTGCTGG - Intronic
967815423 3:193794357-193794379 CAAGGACAAGACTGACAGGCAGG + Intergenic
968735996 4:2296861-2296883 CAGGTAGAAGGCTGAGCTGCTGG - Intronic
969443974 4:7233719-7233741 CAGAGACAGGACTCAGATGCAGG - Intronic
969447801 4:7255575-7255597 CAGAGACAGGCCTGAGTTCCGGG + Intronic
971274626 4:25183872-25183894 AAGGGAGAAGACTAAGGTGCGGG + Intronic
973808608 4:54548918-54548940 CAGTGACCAGTCTGAGTTACAGG + Intergenic
974080810 4:57210464-57210486 CAGCTCCAAGGCTGAGTTGCTGG - Intergenic
974389971 4:61253555-61253577 CAGGGAATATACTGTGTTGCAGG + Intronic
976886288 4:89988703-89988725 CAGGGGCAAATCTGAGCTGCTGG - Intergenic
976970378 4:91095416-91095438 CAGGCAGAACACTGATTTGCTGG - Intronic
978594205 4:110359203-110359225 CAGGAACAACAAGGAGTTGCTGG - Intergenic
982086107 4:151837955-151837977 CAGGGACATGAATGAGCTGGAGG + Intergenic
985716348 5:1464171-1464193 CAGGGACAAGACCAAGTGTCTGG + Intronic
986014371 5:3745106-3745128 GAGGGACAAGTCTGAGTGGAGGG - Intergenic
986023339 5:3825343-3825365 CAAATTCAAGACTGAGTTGCGGG + Intergenic
986464732 5:8010015-8010037 CAAGGACAAGACTTTATTGCAGG - Intergenic
991629014 5:68635223-68635245 CAGGTATGAAACTGAGTTGCTGG - Intergenic
997206082 5:132051006-132051028 CAGGGTCAGGAGTGAGTGGCAGG - Intergenic
998056427 5:139082212-139082234 CAGGGACCACTGTGAGTTGCAGG - Intronic
998391332 5:141788836-141788858 CTGGGCCAAGCCAGAGTTGCAGG + Intergenic
998924059 5:147103058-147103080 AAGGCCCAAGACTGAGATGCTGG - Intergenic
998974726 5:147632703-147632725 CAGAGACCAGAATGAGCTGCTGG - Exonic
1002302166 5:178263296-178263318 CAAGGACAAGATGGAGCTGCTGG - Exonic
1006422557 6:33944563-33944585 CAGTGACACCACTGGGTTGCTGG - Intergenic
1011513058 6:88122753-88122775 TAGGGACTAGACTGCCTTGCAGG + Intergenic
1012538833 6:100335761-100335783 CAGGGATAAGAGGGAGCTGCTGG - Intergenic
1014754815 6:125291451-125291473 CTGGGACAGCACTCAGTTGCCGG + Intronic
1014858199 6:126429478-126429500 CAGGAACAAGAGAGAGTTGGGGG - Intergenic
1017005778 6:150027310-150027332 TAGGGAGAAGGCTGAGTGGCTGG - Intergenic
1017081903 6:150677547-150677569 CAGACACAAGACTCAGTTGGGGG + Intronic
1017248420 6:152253093-152253115 CAGGGACAAGACTGAGTTGCTGG + Intronic
1017629546 6:156383081-156383103 CAGGAACAAGAGAGAGTGGCGGG - Intergenic
1019532217 7:1509450-1509472 CAGTGAGAAGGCTGAGGTGCGGG - Intergenic
1019629028 7:2036689-2036711 CAGGCACACGTCTGGGTTGCTGG - Intronic
1028385737 7:90251033-90251055 CTGGGAGAAGACTGGGTTGGAGG - Intronic
1034350753 7:150413372-150413394 CAGGCAGAAGGCTGAGCTGCCGG - Intergenic
1034473762 7:151270801-151270823 CAGGGACAAGGCTGAGTATGCGG + Intronic
1034907885 7:154966717-154966739 CAGGGAGATGACTGTGTGGCTGG - Intronic
1035289866 7:157831001-157831023 CAGGTAAATGACAGAGTTGCAGG + Intronic
1038148091 8:24916778-24916800 CAGGGCCAAGACTTAGTAGCTGG + Intronic
1040677571 8:49768755-49768777 CAGGTATAGGACTGAGGTGCTGG + Intergenic
1044741233 8:95328427-95328449 CCAGGTCAAGACTGAGTTGGGGG - Intergenic
1044823636 8:96176501-96176523 CAGGGTCAAGACTGCCTTCCAGG + Intergenic
1045096542 8:98803643-98803665 CAGGGATAAGACTGATTAACAGG - Intronic
1045767317 8:105689618-105689640 CAGGGACATGATTAAGTTGGTGG + Intronic
1054793911 9:69280932-69280954 CATGGCCAAGCCTGAGTTGATGG + Intergenic
1056077881 9:83060148-83060170 CAGGGATAAGATTGAGTGCCAGG + Intronic
1058832479 9:108831622-108831644 GAGAGACAAGAGTGAGTGGCTGG + Intergenic
1061385449 9:130286854-130286876 CAGGAGCAAGGCTGAGTGGCAGG - Intronic
1061644624 9:131990696-131990718 CTGGGACAAGACTGGTTTTCAGG - Intronic
1061822941 9:133238633-133238655 CAGGGTCAAGGCTGTGTTGAGGG + Intergenic
1061913585 9:133737825-133737847 CAGGTACGAGACAGAGTTGGAGG - Intronic
1062504464 9:136866039-136866061 CGGGGACAAGGCTGGGGTGCCGG - Intronic
1186528500 X:10271450-10271472 CAGGGGCAAGACTGAGGCGGGGG + Intergenic
1187947517 X:24440891-24440913 CTTGGACAAGAGGGAGTTGCTGG + Intergenic
1192160999 X:68787437-68787459 CAGGGGCCAGCCTGAGTTTCAGG + Intergenic
1196015394 X:110934440-110934462 CAGGGGCAAGAGTGAGGGGCGGG - Intergenic
1197858995 X:130949742-130949764 CAGGGATAAGACTGTATTCCTGG - Intergenic
1201145746 Y:11064563-11064585 CAGGGACAAGAGACAGTTCCTGG - Intergenic