ID: 1017249016

View in Genome Browser
Species Human (GRCh38)
Location 6:152260082-152260104
Sequence TCCAGGAGGTCTGCAGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017249016 Original CRISPR TCCAGGAGGTCTGCAGATGC CGG Intronic
900927570 1:5715853-5715875 TGCAGGCGGTCTCCAGAAGCTGG - Intergenic
900991383 1:6099893-6099915 GCCAGTAAGTCTGCAGGTGCGGG + Exonic
901802958 1:11719722-11719744 CCCAGGAGGTTTGCACAAGCCGG + Exonic
902104895 1:14026798-14026820 TCCAGGAGGGAAGCAGATGAAGG + Intergenic
902385358 1:16072949-16072971 TTCAGGGGCTCTGCAGATGGGGG + Intronic
903231357 1:21924244-21924266 TCCAGGATGTCTGGTGACGCTGG - Intronic
905248403 1:36630400-36630422 TCCGGGAAGCCTGCAGATGTGGG - Intergenic
905591596 1:39168573-39168595 TCAGGGAGCTCTGCAGAGGCGGG - Intronic
906951317 1:50336321-50336343 TCCAGGAGGGCTCCAGGTCCTGG - Intergenic
907042155 1:51271443-51271465 TCCTGGATGGCTGCAGATGTTGG + Exonic
911717911 1:101156117-101156139 TCCAGGATGTAGGCAGATGCAGG - Intergenic
912241306 1:107912724-107912746 TCCAGAAGAGGTGCAGATGCAGG - Intronic
912796513 1:112696658-112696680 TCCAGGAGGGCAGCTGGTGCTGG + Exonic
913068604 1:115280014-115280036 TCCTGAGGGTCTGCAGAGGCTGG - Intergenic
913264675 1:117032888-117032910 TCCCGGCGGACTGCAGCTGCGGG + Intronic
914860757 1:151383926-151383948 TCCAGGATGTCTATAGATGGTGG - Intergenic
915356856 1:155260513-155260535 TACAGGAGGTGTGCAGGTGAGGG - Intronic
916841582 1:168607081-168607103 TCCAGGAGCCGAGCAGATGCTGG + Intergenic
917437483 1:175035859-175035881 TCCTGGAGCTCGGCTGATGCAGG - Intergenic
918076616 1:181175646-181175668 TAGAGGAGCTCTGCAGCTGCTGG - Intergenic
919913351 1:202125580-202125602 TCCAGGAGGTGTGGAGGGGCTGG - Intronic
921040076 1:211422619-211422641 ACCATGAGATCTGCAGTTGCAGG - Intergenic
922170725 1:223152231-223152253 CCCAGGAGCTGAGCAGATGCTGG + Intergenic
922924424 1:229335869-229335891 TCCAGGGGTTCTGCATCTGCAGG + Intronic
923019933 1:230155338-230155360 TCCCGGAGGTCAGCGGCTGCAGG - Intronic
1062787613 10:278394-278416 TCCAGGAGGGCTGGATATGGGGG + Intronic
1064994797 10:21287148-21287170 ACCAGGAGGTCAGCAGTGGCAGG + Intergenic
1065853004 10:29806106-29806128 CCCATGAGGTCTGCAGCTGTGGG + Intergenic
1066615378 10:37288512-37288534 TGCAGGAGATCTGCAGAAGAGGG - Intronic
1066654862 10:37687829-37687851 TCCAGGAGCTGTGCAGGTGCTGG + Intergenic
1067798605 10:49340053-49340075 CCCAGAAGCCCTGCAGATGCAGG + Intergenic
1069955081 10:72044965-72044987 TCCAGGAGGCCTGCGGAAGCAGG - Intergenic
1070358465 10:75663518-75663540 TTCTGGAGATCTGCAGAAGCTGG - Intronic
1071965280 10:90845735-90845757 GCCAGGAAGTCTCCAGATGCAGG - Intronic
1074367838 10:112874353-112874375 TCCAGGATTTCTGCAAAAGCTGG + Intergenic
1075443604 10:122498662-122498684 ACCAGGAATTCTCCAGATGCTGG - Intronic
1076752303 10:132549667-132549689 TCCTGGAGCTCTGCAGCTGCAGG + Intronic
1077553630 11:3215437-3215459 ACCTGGAGGTCTGCAGAGGTGGG + Intergenic
1078865047 11:15289403-15289425 TCGAGGAAGTCTGGAGAGGCTGG + Intergenic
1078895504 11:15593797-15593819 TCCCCGGGGTCTGCAGATGGAGG - Intergenic
1078928690 11:15896613-15896635 TTCAGGAGCTCTGGAGAAGCTGG - Intergenic
1079615123 11:22482567-22482589 TCCAGAAGCTGAGCAGATGCTGG + Intergenic
1080104003 11:28492607-28492629 TCCAGGAGGTATCAACATGCAGG - Intergenic
1080793057 11:35538452-35538474 TCCTGGGGGCCTTCAGATGCAGG - Intergenic
1084064282 11:66694357-66694379 TCCTGGCGGTTTGCAGATGCTGG - Exonic
1085851519 11:80125445-80125467 GCCAGGAGCTAAGCAGATGCTGG + Intergenic
1086103123 11:83122307-83122329 GCTAGGAGGTGTACAGATGCAGG - Intergenic
1087367216 11:97235510-97235532 TCCAGTGGGTCTGCAGAGGAAGG - Intergenic
1088014605 11:105043762-105043784 CCTAGGAGGGCTGCAGATGATGG + Intronic
1089879641 11:121761374-121761396 CCCTGGAGGTCAGCAGATGTGGG - Intergenic
1091959455 12:4680012-4680034 TCAAGGATATATGCAGATGCAGG + Intronic
1092349428 12:7743906-7743928 ACCAGAAGGTGAGCAGATGCTGG - Intronic
1093980691 12:25472066-25472088 CTCAGGAGGCCTGAAGATGCTGG - Intronic
1098786653 12:74766830-74766852 TCCAGGAGTTGTACAGATTCAGG - Intergenic
1099871219 12:88351771-88351793 TTCAGAAGGTGAGCAGATGCTGG - Intergenic
1103030387 12:117607621-117607643 TCCGGGAGGTCTGTGGATGCAGG - Intronic
1103465828 12:121141318-121141340 CCCCGGAGGCCTGCAGGTGCAGG - Intronic
1104756738 12:131274095-131274117 TCTGGGAGCTCTGCAGATTCAGG - Intergenic
1105552381 13:21410140-21410162 TCCAGGAGATCTGCAGAAGAGGG - Intronic
1106481029 13:30136901-30136923 TCCAGGAGGTGAGGAGAAGCTGG + Intergenic
1106850071 13:33780856-33780878 CCCAGAAGCTATGCAGATGCCGG - Intergenic
1107548024 13:41452228-41452250 CACAGGAGGTGTGCACATGCAGG + Intergenic
1108453730 13:50592300-50592322 TGCAGGAGGTATGCAGAAGAAGG - Intronic
1110797518 13:79657413-79657435 ACCAGGAGGTGAGCAGATGTTGG + Intergenic
1112265755 13:97921787-97921809 TCCATGGCATCTGCAGATGCAGG + Intergenic
1112987394 13:105468016-105468038 TGCAGGAGGCCTCCAGAAGCTGG - Intronic
1113964641 13:114145816-114145838 GCCAGGAGGCCTGGAGCTGCTGG - Intergenic
1114590649 14:23861647-23861669 ACCAGGAGCTGAGCAGATGCTGG - Intergenic
1119325127 14:73755289-73755311 TCCCTGAGGGCTGCAGTTGCTGG - Intronic
1120770210 14:88370755-88370777 TCCAGAAGGCCTGCAGAAGAGGG + Intergenic
1121241385 14:92432491-92432513 TCCAGGAGAAATGCAGCTGCTGG - Intronic
1121569374 14:94936016-94936038 TGCAGCAGGCCTGCAGATGGGGG - Intergenic
1122283530 14:100638190-100638212 TCCAAGACGTGTGCAGAGGCGGG + Intergenic
1122649115 14:103216007-103216029 ACCTGGAGGTCTGTAGCTGCAGG + Intergenic
1122890547 14:104730166-104730188 CCCAGGAGGACTGCAGGAGCCGG + Exonic
1123833184 15:24162891-24162913 TGCAGGAGGTGTGCAGATTCAGG + Intergenic
1123895918 15:24829641-24829663 TCCATGAGGTCTTCTGATTCAGG + Intronic
1124917225 15:33987658-33987680 TAGAGGAGGCCTGCAGATGCAGG - Intronic
1125984825 15:44039558-44039580 TCCAGCAGGCCTGCAGAAGAGGG + Intronic
1126070452 15:44861218-44861240 ACCAGGAGTTCTGGAGATGGTGG + Intergenic
1129219884 15:74125947-74125969 TCCACCAAGTCTGCAGTTGCGGG + Intronic
1129890254 15:79067050-79067072 CCCAGGAGGACAGCAGATGCAGG - Intronic
1130988816 15:88862618-88862640 TCCAGAAGGACTGCAGATAGTGG + Intronic
1132041554 15:98528851-98528873 TGCTGGAGGTCTGCAGGTGGTGG + Intergenic
1132240506 15:100253853-100253875 TCCAAGGGGTCTGCAGTTGGGGG - Intronic
1133292791 16:4734100-4734122 TCTAGGCGGGCTGCAGGTGCCGG + Exonic
1133359979 16:5166505-5166527 TCTAGTGGCTCTGCAGATGCAGG + Intergenic
1133745887 16:8686391-8686413 TCCAGGAGGGATTCAGAGGCAGG + Intronic
1137717625 16:50608441-50608463 TCCAGAAAATCTGCAGATGGAGG + Intronic
1137969888 16:52974821-52974843 TCCAGCAGATCTGCAGAAGAGGG - Intergenic
1138210402 16:55158330-55158352 TCCAGGCGGTCTCTAGAAGCTGG - Intergenic
1138476950 16:57276725-57276747 TCCAGGAGGCATGCTGTTGCAGG + Intronic
1138885704 16:61075509-61075531 ACAAGGAGGTCTGCAGAAGTAGG + Intergenic
1139209088 16:65058492-65058514 CCCTGGGGGTCTGCAGATGGGGG + Intronic
1140935918 16:79670089-79670111 CCTAGGAGGTATGCAGGTGCTGG + Intergenic
1141737982 16:85867906-85867928 TGCAGGAGGGCTGCATATCCTGG - Intergenic
1141994936 16:87630345-87630367 GTCAGAAGGTCTGCAGATGAGGG - Intronic
1142847832 17:2690705-2690727 TCCAGGAGGCCAGCAGAAACAGG - Exonic
1143326898 17:6104971-6104993 TCAAGGAGGACTGAAGATGGAGG + Intronic
1143575000 17:7787052-7787074 TCCTGGAGGCCTGCAGAGGCAGG + Intronic
1145220576 17:21085225-21085247 CCCAGCAGGTCTGCCGTTGCTGG + Intergenic
1147400005 17:40175060-40175082 CCCAAGTGGGCTGCAGATGCTGG - Intergenic
1149365558 17:55939863-55939885 TCCAGCAGATCTGCAGAAGAGGG + Intergenic
1151620357 17:75241233-75241255 TCCCGGAGGCCTGGAGATGTGGG - Intronic
1151670247 17:75568310-75568332 TCCAGGAGGGCAGCAGGTGTGGG - Intronic
1152317217 17:79588164-79588186 TCCAGGTGGGATGCAGTTGCTGG + Intergenic
1152333936 17:79689568-79689590 TCCACATGGTCTGCAGATGCCGG - Intergenic
1152514488 17:80815298-80815320 TCCACGGGGCCTGCAGAGGCTGG - Intronic
1152931413 17:83112015-83112037 GCCACGAGGTCTGCAGCTGGGGG + Intergenic
1153448908 18:5204681-5204703 CCCAGAAGCTCAGCAGATGCTGG + Intergenic
1153771771 18:8422419-8422441 TCCAGAAGCTGAGCAGATGCTGG + Intergenic
1154342396 18:13514803-13514825 ACCAGGATGTTTGCAGAGGCTGG - Intronic
1155197323 18:23487066-23487088 TCAGGAGGGTCTGCAGATGCTGG - Intergenic
1155403962 18:25467552-25467574 TCCAGGAGCTCTGCCCATGCTGG + Intergenic
1155624173 18:27815325-27815347 TCTTGAAGGTCAGCAGATGCTGG - Intergenic
1157285339 18:46373720-46373742 TCCAGGATCTCTGCAGGTGTGGG + Intronic
1160168553 18:76533665-76533687 TGGAGGTGGTCTGCAGGTGCAGG + Intergenic
1160889418 19:1369384-1369406 TCCAAGGGGTCTTCAGAGGCTGG - Intronic
1161539200 19:4839473-4839495 TACAGGTGGCCTGCAGTTGCTGG + Exonic
1162004306 19:7767521-7767543 TCCTGGAAGTCTGCAGCTGTAGG - Exonic
1163015477 19:14451613-14451635 TCCAGGAGGGGCTCAGATGCGGG - Intronic
1163742236 19:19022579-19022601 TCCAGCATGCCTGCAGCTGCAGG + Intronic
1164085555 19:21899207-21899229 TCCAGCAGACCTGCAGATGAGGG - Intergenic
1164203638 19:23039911-23039933 TCCAGGAGGCCTGTACATGTGGG - Intergenic
1164743015 19:30590645-30590667 TCCAGGAGGAGTGGAGATGTGGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166216920 19:41341917-41341939 GCCGGGAGCTTTGCAGATGCTGG + Exonic
1166304842 19:41931860-41931882 TCCAGGAGGGCTGCAGTGGTGGG - Intergenic
1166871191 19:45872207-45872229 CCCAGGGGGGCTGCAGGTGCTGG - Exonic
1167092333 19:47353240-47353262 TCCTGGAGGTCTTGAGATTCTGG - Exonic
1168354842 19:55694721-55694743 TCCAGGAGAGCTGGAGCTGCTGG + Exonic
1168712669 19:58510921-58510943 TCCCGGAGGTCTGCAGAGATGGG + Exonic
925046715 2:778002-778024 CCCAGGAGGTCAGAAGGTGCTGG - Intergenic
925164884 2:1709839-1709861 TCTTGCAGGTCTGCAGATGATGG - Intronic
925612671 2:5715813-5715835 TTTAGGAAGTCTGCAGATCCTGG + Intergenic
925766924 2:7245156-7245178 TCCAGAAGCCCAGCAGATGCTGG + Intergenic
927432067 2:23035137-23035159 TGCAGGAGGCCTGCAGAGGGGGG - Intergenic
931639367 2:64368465-64368487 ACCAGGAGTTCTTCAGCTGCTGG + Intergenic
932838468 2:75059682-75059704 CCCAGGAGGTTTGCAGATTCAGG - Intronic
935351502 2:102155014-102155036 TCCAGGAGCTCAGCAGTTGCAGG - Intronic
935639826 2:105280172-105280194 TTCAAGGGGTCTGCAGATGGTGG + Intronic
935863756 2:107362819-107362841 TGCAGCAGGTCGGCAGATGCTGG + Intergenic
936032132 2:109080921-109080943 TCCAGGAGGGCTGGAGAGCCAGG + Intergenic
937231389 2:120400075-120400097 TCCATGAGGTCAGCAGTGGCAGG + Intergenic
939222810 2:139324924-139324946 TCCAGGAGGACAGCAGGTGGTGG - Intergenic
941170337 2:162128284-162128306 TCCATGTGGTCTGCTGAGGCTGG + Intergenic
943601760 2:189930122-189930144 TCCTGGATGGCTGCAGATGTTGG - Intronic
947944668 2:234091399-234091421 TACAGAAGCTGTGCAGATGCGGG + Intergenic
948024919 2:234769174-234769196 GCCAGCAGGTCTGCAGAACCAGG - Intergenic
948163875 2:235845973-235845995 TCCAGGAGGTCTGGAGGGCCTGG - Intronic
948187462 2:236032718-236032740 TGCAGGAGGTCTGTAGAAGGGGG + Intronic
948330063 2:237157473-237157495 TTCAGCAGGACTGCAGATCCTGG - Intergenic
948600219 2:239103695-239103717 TGCAGGAGCTCAGCGGATGCTGG - Intronic
948676124 2:239597756-239597778 TCCAGAAGCTGAGCAGATGCTGG + Intergenic
1168849181 20:965117-965139 TCCAGGAGGCCTGCAGACCCTGG - Intronic
1170109829 20:12793123-12793145 CCCAGAAGGTGAGCAGATGCTGG - Intergenic
1170870757 20:20203915-20203937 TCCAGGAATTCTGCAGAAACAGG - Intronic
1171311398 20:24147793-24147815 ACCACGAGGACTGCAGCTGCTGG + Intergenic
1171381652 20:24738197-24738219 TCCAGTAGGTCTGCAGCTCAGGG + Intergenic
1172217849 20:33249119-33249141 TCCAGAAGCTGAGCAGATGCTGG - Intergenic
1173246530 20:41341176-41341198 TCCAGGGGGCCTGCAGCCGCTGG - Intronic
1173845418 20:46185382-46185404 TCCAGGTGGTGTGCTGAGGCAGG + Intronic
1175681139 20:60989815-60989837 TCCTGGAGGCCTGGGGATGCAGG - Intergenic
1175767410 20:61601120-61601142 TCCAGAAGCTGAGCAGATGCCGG - Intronic
1175952739 20:62592121-62592143 CCCAGGTGCTCTTCAGATGCAGG + Intergenic
1178281949 21:31291378-31291400 TCCAGAAAGTCTGCTGATGATGG + Intronic
1179410317 21:41157424-41157446 TCCAGGAGGTATCCAGAAGCAGG + Intergenic
1180156766 21:45981877-45981899 TCCAGCAGGCCTGCAGCAGCAGG - Exonic
1183247255 22:36703402-36703424 TCCAGGAGCTTTGCAGATAGGGG - Exonic
1183360790 22:37382233-37382255 TACTGGAGGTCTGCAGGTGACGG - Intronic
1185149334 22:49155115-49155137 CCCAGGAGCTCTGCAGACGGTGG - Intergenic
1185293384 22:50040235-50040257 TCCATGAGGTCTGCCTACGCCGG - Intronic
1185293390 22:50040269-50040291 TCCATGAGGTCTGTCCATGCTGG - Intronic
1185301768 22:50084589-50084611 TCCAAGAGTTCTGCAGCAGCAGG + Intronic
1185331808 22:50255355-50255377 TCCAGGAGGTTCACAGCTGCGGG + Exonic
950371204 3:12532197-12532219 ACCAGCAGGTCTGCAGGGGCAGG - Intronic
950396031 3:12734744-12734766 TCCAGGTGGGCAGCAGAGGCAGG - Exonic
952747037 3:36791211-36791233 TGCAGGAGGGCTGCATATCCAGG - Intergenic
954419154 3:50409463-50409485 TACAGGGGCTCTGCAGGTGCAGG - Intronic
954559331 3:51543029-51543051 GCCAGGAATTCTCCAGATGCAGG + Intronic
955607089 3:60716564-60716586 TCCAGGAGGTATTCAGAAGAAGG - Intronic
956218594 3:66877489-66877511 CCCAGAAGCTCAGCAGATGCTGG + Intergenic
956355820 3:68390739-68390761 TCCAGCAGATCTGCAGAAGAGGG + Intronic
957772216 3:84708243-84708265 ACCAGAAGCTGTGCAGATGCTGG + Intergenic
959435195 3:106306243-106306265 TCAAGGTGGCCTACAGATGCTGG - Intergenic
959817666 3:110693764-110693786 TCCAGGAGCCTTGCAGATCCAGG + Intergenic
962616340 3:137130523-137130545 TCCAGAGGATCTGCAGGTGCAGG + Intergenic
963519405 3:146345821-146345843 TCCAGGAGCTCTACATATTCTGG - Intergenic
963527308 3:146430769-146430791 TCCAAGAGGTATGCAGGTCCAGG + Intronic
968861216 4:3171965-3171987 TTCAGGGGCTCTACAGATGCAGG + Intronic
969369380 4:6721445-6721467 TCCAGGAGCTCTTCAGATGCTGG + Intergenic
969578943 4:8052691-8052713 TCCAGGAAGGGTCCAGATGCTGG + Intronic
969607275 4:8208768-8208790 TGCAGGTGGTCAGCAAATGCGGG + Intronic
969854726 4:9989998-9990020 TCAAGGAGGTCAGAAGATGCTGG - Intronic
970003376 4:11386901-11386923 TCCAGGAACCCTGCAGTTGCAGG + Intergenic
972629367 4:40829912-40829934 TCCAGGGTTTCTGCAAATGCAGG - Intronic
973702829 4:53553643-53553665 TCATGGAGGTCTGCGGATGAGGG + Intronic
975287055 4:72632948-72632970 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
975367461 4:73545319-73545341 TCCAGCAGATCTGCAGAAGAGGG + Intergenic
981885441 4:149667314-149667336 TCCAGCAGGCCTGCAGAAGAGGG + Intergenic
985068648 4:186146383-186146405 CCCAGGAGGTCTTGGGATGCAGG - Intronic
985715969 5:1461770-1461792 TTCCGCAGGTCTGCAGATGAAGG - Exonic
985731939 5:1554157-1554179 CCCAGGAGGCCTCCAGAGGCTGG + Intergenic
985951554 5:3225364-3225386 ACCAGGACGTCTGTAAATGCAGG + Intergenic
987947015 5:24623190-24623212 GCCAGCAGTCCTGCAGATGCAGG + Intronic
988112372 5:26839270-26839292 TCAAGGTGGCCTCCAGATGCCGG + Intergenic
989458848 5:41672969-41672991 TCCAGTAGTTCTGGAGGTGCTGG - Intergenic
991616251 5:68499730-68499752 CCCAGGAGGTGTGGAGGTGCAGG + Intergenic
992187963 5:74262099-74262121 TCCAGATGGACTGCACATGCTGG - Intergenic
997005608 5:129813512-129813534 TCCAGAAGGTCTACAGACACAGG + Intergenic
997119877 5:131163330-131163352 TGCAGGAGATCTGGAGAGGCAGG - Intronic
997384084 5:133458878-133458900 TCCAGGAGCTCTGGAGCAGCAGG + Intronic
999128281 5:149263126-149263148 TCCAGGGGCTGTGCAGATGAGGG + Intergenic
999134650 5:149310391-149310413 TCCAGGAGGTATACAAGTGCAGG - Intronic
999143700 5:149379247-149379269 TCCAGGCGGGCAGCAGCTGCAGG - Exonic
999233139 5:150074166-150074188 TCCAGGTGTTCAGCTGATGCTGG - Intronic
1000021460 5:157322584-157322606 TCCAACAGGGCTGCAGATGGGGG + Intronic
1000262248 5:159599309-159599331 ACCAGGAGATCAGCAGATGCTGG - Intergenic
1001936715 5:175710619-175710641 TCCAGGAGGCCTGCAGAAGGTGG - Intergenic
1002282294 5:178138368-178138390 TCAAGGAGGCCTACAGATGCAGG - Intronic
1002409064 5:179060184-179060206 GGCAGGAGGTCTCCAGCTGCTGG - Intergenic
1002953374 6:1838096-1838118 TGCAGGAAGTCTCCAGATACAGG + Intronic
1005797273 6:29378714-29378736 TCAGGAAGGTCTCCAGATGCAGG - Intronic
1006200066 6:32280099-32280121 TCCAGCAGGCCTGCAGAAGAGGG + Intergenic
1006719154 6:36138872-36138894 TCCAGCAGGTCCGCAGCTGCAGG - Exonic
1007298044 6:40843420-40843442 TCCAGTAGGGCTGGAGATACTGG - Intergenic
1008183590 6:48363869-48363891 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
1008551868 6:52640299-52640321 TCCGCGAGGTCTCCATATGCTGG - Intergenic
1011020593 6:82808746-82808768 TCCAGCAGATCTGCAGAAGAGGG - Intergenic
1011970139 6:93212254-93212276 TTCAGAAGGCCTGCAGAAGCCGG + Intergenic
1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG + Intergenic
1012482021 6:99677475-99677497 TCCAGGAGTACTGCAGATGAAGG - Intergenic
1013869489 6:114739867-114739889 TCCAGAAGGTGAGCAGATGCTGG + Intergenic
1015326968 6:131934128-131934150 TCCTGGAGGGATGCAGAAGCAGG - Intergenic
1017249016 6:152260082-152260104 TCCAGGAGGTCTGCAGATGCCGG + Intronic
1018633655 6:165841970-165841992 TAAAGGAGCTCTGCAGAAGCGGG - Intronic
1018712914 6:166509479-166509501 TGAAGGAGGCCTGCAGAAGCTGG - Intronic
1019016692 6:168885325-168885347 CCCAGGAGGCCTGCAGAGCCTGG + Intergenic
1019122503 6:169814259-169814281 TCAGGGTGGTCTGCAGGTGCGGG - Intergenic
1019122514 6:169814298-169814320 TCAGGGTGGTCTGCAGGTGCGGG - Intergenic
1019122576 6:169814571-169814593 TCAGGGTGGTCTGCAGGTGCGGG - Intergenic
1021976698 7:26018205-26018227 TCCAAGATGTCTGCAGAGGCTGG - Intergenic
1022055358 7:26727202-26727224 ACAAGGAGGTCTGCAGATCATGG + Intronic
1022225515 7:28358629-28358651 GGCAGGACGGCTGCAGATGCTGG - Intronic
1023991535 7:45131851-45131873 TGAAGGAGGACTGCAGAGGCTGG - Intergenic
1024005216 7:45220156-45220178 CCGTGGAGGTCTGCAGATGGTGG - Intergenic
1024261842 7:47579314-47579336 TCCAGGAGGTCAGCTGACCCTGG - Intronic
1024380073 7:48685844-48685866 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
1024618069 7:51132723-51132745 ACCAGAAGGTGAGCAGATGCTGG - Intronic
1024631861 7:51255785-51255807 TCAAGGTGGTGTGCCGATGCAGG + Intronic
1026456898 7:70580568-70580590 GCCATGAGGGCTGCAGCTGCAGG + Intronic
1026680834 7:72465418-72465440 TCCAGGATATTGGCAGATGCAGG - Intergenic
1028174135 7:87633957-87633979 ACCAGAAGCTCAGCAGATGCCGG - Intronic
1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG + Intronic
1032188218 7:129745909-129745931 TCCTGGTGGTCTGCAAAAGCAGG + Intronic
1032518623 7:132525711-132525733 TCCTGTGGGTCTGGAGATGCAGG - Intronic
1032754526 7:134876183-134876205 CCCAGGAGGTCTGCGGACGGAGG - Intronic
1033399403 7:141007620-141007642 TCCAGGAGGCGTGCAGGTACCGG - Intronic
1033426869 7:141252693-141252715 TCCAGGAGTTATGTAGATCCAGG - Intronic
1035248497 7:157581037-157581059 TGCAGGGGGTGTGCAGGTGCTGG - Intronic
1035466631 7:159083717-159083739 TCCAGGAGGTATGCAGTTTGGGG + Intronic
1036705536 8:11043531-11043553 TCCAGGGGCTCTGCAGCTGCTGG - Intronic
1037585102 8:20270657-20270679 TCCAGGAGGTGGGCAGGTGTGGG + Intronic
1041047310 8:53899893-53899915 ACCAGGAGGTCTGCTGAGGGCGG - Intronic
1042660250 8:71146838-71146860 TTCAGGAGGTCTCCAGAAGAAGG + Intergenic
1044126192 8:88460194-88460216 TACAGGAGGTCTGTAGATACAGG - Intergenic
1044515770 8:93136707-93136729 TCCAGAAGCTGAGCAGATGCTGG - Intronic
1044657078 8:94559613-94559635 TCCAGGAGGGCTGTATATGCAGG + Intergenic
1044702281 8:94975511-94975533 TCCAGGAGGCCAGCAGCTGCAGG - Intronic
1047443174 8:124897189-124897211 TCCATAAGGTCTGCAGGAGCTGG - Intergenic
1047517259 8:125565902-125565924 TCCACAAGGACTGCAGATGCTGG - Intergenic
1047521996 8:125602099-125602121 TCCAGGAGGCCTGCTGCTGAAGG + Intergenic
1048265010 8:132978129-132978151 TCCAGAAGCTGGGCAGATGCTGG - Intronic
1049553354 8:143270735-143270757 GCCAGGAGGTCAGCAGACTCAGG + Intronic
1049601788 8:143511249-143511271 TCCAGGAGTCCTGCAGAGCCTGG + Intronic
1049800771 8:144516581-144516603 TCAGGGATGCCTGCAGATGCTGG + Exonic
1051321839 9:15913898-15913920 TCCAGGAGACCTGCAGAAGAGGG - Intronic
1055338881 9:75261215-75261237 TCCAGGAGACCTGCAGAAGATGG - Intergenic
1057041101 9:91847901-91847923 GCCAGGAGTTCTGCTGAAGCTGG - Intronic
1057526961 9:95811381-95811403 GCCAGGAGTTCTGCAGGGGCAGG + Intergenic
1058318875 9:103604550-103604572 TCCAGGAGGTATCCAGAAGAAGG + Intergenic
1060392040 9:123285761-123285783 CCAAAGAGGTCTGCAGAGGCTGG - Intergenic
1060445505 9:123683637-123683659 CCCAGGAGGTCTTCATATTCTGG - Intronic
1060529760 9:124341357-124341379 TCCCGGGGCTCAGCAGATGCGGG + Intronic
1060821186 9:126662481-126662503 GCCAGGAGGTCTCCAGGGGCAGG - Intronic
1060893764 9:127204575-127204597 TCCTGGAGGCCAGCAGGTGCTGG - Intronic
1062441157 9:136570478-136570500 TTCAGGAGGTCTGCACATCTCGG - Intergenic
1186033814 X:5398889-5398911 TCCAGGAGGTATCCAGAAGAAGG + Intergenic
1186087822 X:6010313-6010335 TCCAGGAGGTCTAAAGGTGAGGG - Intronic
1190890117 X:54560452-54560474 ACCAGGAGGCCTGCTGACGCTGG - Intronic
1196602848 X:117622340-117622362 TCCAGCAGATCTGCAGAAGAGGG - Intergenic
1196766646 X:119252005-119252027 TCCAGGACATCTGCAGAATCTGG + Intergenic
1196859828 X:120016202-120016224 TCCAAGGGGTCTGCGGAAGCGGG + Intergenic
1198975707 X:142333380-142333402 TACAGAAGGTTTGCAGATGCAGG - Intergenic
1199383855 X:147201181-147201203 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
1201638498 Y:16152270-16152292 TCCAGGAGGTATCCAGAAGAAGG - Intergenic
1201730195 Y:17193938-17193960 TCCCGGAGGTCTGCAGAGTCAGG + Intergenic
1202054915 Y:20819365-20819387 TCCAAGAGGCCTGCAGCTGAGGG + Intergenic