ID: 1017249387

View in Genome Browser
Species Human (GRCh38)
Location 6:152263047-152263069
Sequence CAGGACATGGAGAGATAGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017249385_1017249387 -8 Left 1017249385 6:152263032-152263054 CCTGGGAAGGTAGTACAGGACAT 0: 1
1: 4
2: 8
3: 10
4: 110
Right 1017249387 6:152263047-152263069 CAGGACATGGAGAGATAGTACGG 0: 1
1: 0
2: 1
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017249387 Original CRISPR CAGGACATGGAGAGATAGTA CGG Intronic
900239922 1:1611367-1611389 CAGGACACAGAGAGAAAGCAGGG + Intergenic
900745772 1:4359920-4359942 CAGGAAATGGAGAGATCCTTTGG + Intergenic
901952485 1:12759971-12759993 CAGGTAATGGAGAGAAAGTGAGG + Intronic
903796668 1:25934120-25934142 CTGGACCTGGAGGGATAGTCAGG - Intergenic
903831882 1:26180436-26180458 CAAGACCTGGAGGGAGAGTAAGG - Exonic
905358085 1:37398855-37398877 CAGGCTATGGAGAGACAGCAAGG + Intergenic
906820792 1:48927849-48927871 GAGTACCTGGAGAGACAGTATGG - Intronic
908609119 1:65836295-65836317 TAGGACATGGGGACATGGTAAGG - Intronic
908677303 1:66619650-66619672 CAGGACAAGGAGAGAAAGGAGGG + Intronic
912309702 1:108607795-108607817 CTGGGAATGGAGAGAAAGTATGG - Intronic
912445625 1:109733923-109733945 ATGGACATGGAGAGTGAGTAGGG + Exonic
912516017 1:110216981-110217003 CAGGACCAGGAGAGAGAGCAGGG + Intronic
915166771 1:153952246-153952268 CAGGAGATGGAAAGATGCTAGGG + Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916860660 1:168801092-168801114 CAGGAGAGGGAGAGAGAGCAGGG + Intergenic
917713377 1:177709962-177709984 GAGGTCATGGAGAGATAGGAGGG - Intergenic
918182306 1:182094979-182095001 CAGGCCTTGGAGAGAGAGGATGG - Intergenic
919780603 1:201218467-201218489 CTGGACATGGGGAGATAGCTTGG - Intronic
920243892 1:204573655-204573677 AAGCACATGGAGAGATTCTAGGG - Intergenic
923359028 1:233189256-233189278 GATTACATGGAGATATAGTAAGG + Intronic
1063033407 10:2259207-2259229 CAAAACATGGAAAGATAGTTGGG + Intergenic
1066451067 10:35530718-35530740 CAGGATATTCAGAGACAGTATGG + Intronic
1066965299 10:42258403-42258425 GAGGATATGGAGAAATAGGAAGG - Intergenic
1068439737 10:57036463-57036485 TAGGAAAGGGAGAGAGAGTATGG - Intergenic
1069348452 10:67497561-67497583 GAGGACGTGGAGAAATAGGAAGG - Intronic
1071420500 10:85492614-85492636 GAAGACATGGAGAGAAAGCAGGG + Intergenic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1075148961 10:119908975-119908997 TACCACATGGAGAGAAAGTATGG - Intronic
1077461135 11:2711230-2711252 CAGTACATGGGGAGGAAGTATGG - Intronic
1079503156 11:21125203-21125225 CAAGACAAAGAGAGATACTAAGG + Intronic
1079721959 11:23826352-23826374 CAGGAGACAGAGAGATAGCAAGG + Intergenic
1079923319 11:26459171-26459193 CTGGACAGGGAATGATAGTAAGG + Intronic
1081367938 11:42259451-42259473 CAGGATATCAAGAGATAGTTGGG + Intergenic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083876874 11:65528922-65528944 CAGCACGTGGAGAGATACTGAGG + Intronic
1084591182 11:70091585-70091607 GAGGACATGGAGGGAGAGAAAGG + Intronic
1084930799 11:72554072-72554094 CAGGACATAGATAGATGGGAGGG - Intergenic
1085600064 11:77847545-77847567 GAGGGCATGGAGATATAGAAGGG + Intronic
1086390578 11:86359048-86359070 CAGTAGCTGGAGAGATTGTAAGG - Intergenic
1086912480 11:92488884-92488906 GAGGAAATGGAGACATAGAAAGG - Intronic
1088181655 11:107120180-107120202 CAGAAAAAGGAGAGAGAGTAAGG + Intergenic
1090149075 11:124362883-124362905 GAGGACGTGGAGAAATAGGAAGG + Intergenic
1093140618 12:15506583-15506605 CAGGACAGAGAGAGAGAGCAGGG + Intronic
1093199296 12:16167877-16167899 GAGGACATGAAGAGACAGTTTGG - Intergenic
1095673680 12:44891181-44891203 CAGGGCATGGAGAACAAGTATGG - Intronic
1095859297 12:46897864-46897886 CAGGAGAGGGAGAGAGAGAAAGG - Intergenic
1097810571 12:64014416-64014438 CAGCACATGGACACATAGAAGGG + Intronic
1098478742 12:70937852-70937874 GAGGATGTGGAGAAATAGTAGGG + Intergenic
1099787623 12:87286848-87286870 CAGAACATAGAAAGAAAGTAGGG - Intergenic
1101241979 12:102848168-102848190 CAGGACACCAAGAGATGGTAGGG + Intronic
1101364044 12:104055096-104055118 CAGGACCTGGAGAGAGGATATGG + Intronic
1101904210 12:108813142-108813164 CAGGAAAGGGATACATAGTAAGG + Intronic
1104956511 12:132469228-132469250 CATGCCATGGAGAAAAAGTAAGG + Intergenic
1105868109 13:24479395-24479417 CAGAACGTGGTGAGATAGGAAGG - Intronic
1106404379 13:29461181-29461203 CAGGACAGAGAGAGAGAGAAGGG + Intronic
1107333973 13:39333728-39333750 GAGGATATGGAGAAATAGGAAGG + Intergenic
1108771111 13:53700974-53700996 CAGGAGATGGAGAGAGTGCAGGG - Intergenic
1108910848 13:55549977-55549999 CAGGAGAGAGAGAGATAGTGAGG - Intergenic
1109098996 13:58155725-58155747 CAGGACATAGAAAGAAAGCAGGG - Intergenic
1109549402 13:63873585-63873607 CAGGAAATCGAGAGGTAGTAAGG - Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1111089685 13:83427230-83427252 CAGGACATGTGGGGATAATATGG + Intergenic
1112504046 13:99964620-99964642 CAAGATATGGAGATATATTAAGG + Exonic
1114673446 14:24426834-24426856 CAGGAGAAAGAGAGATAGTGGGG + Exonic
1116039813 14:39672336-39672358 CAAGGCTTGGAGAGGTAGTAGGG + Intergenic
1119691381 14:76675515-76675537 CAGGACTTGGAGAGAGAATTGGG - Intergenic
1119716495 14:76863342-76863364 TAGAACGTGGAGAGACAGTAAGG - Intronic
1120893821 14:89512162-89512184 CAGGACATGAAGCCATAGTGAGG + Intronic
1121149974 14:91623674-91623696 CAGGTGATGGAGAGAAAGCAAGG - Intronic
1121426584 14:93856559-93856581 CGGGACATGGGGACAGAGTAGGG + Intergenic
1122412153 14:101531113-101531135 CAGGGCATGGACAGAAAGTGGGG - Intergenic
1125421742 15:39511232-39511254 GAGGAAATGGAGAGATGGTATGG + Intergenic
1128397508 15:67243240-67243262 CAGGAAAGGGAGAGAGAATATGG + Intronic
1132592102 16:730574-730596 CAGCACGTGGAGAGACTGTACGG - Exonic
1133107826 16:3525136-3525158 CAGGCCATGGAGAAATGGTACGG + Intronic
1133937003 16:10277545-10277567 CAGGCCCTGGAGAGAAAGCAGGG + Intergenic
1134123062 16:11598261-11598283 CAGGCCCTGGAGAGACAGTGGGG - Intronic
1134311211 16:13076751-13076773 AAAGAAATGGAGAGAAAGTAAGG - Intronic
1135050033 16:19185192-19185214 CAGGACAGGGAGAGAAGGAAGGG - Intronic
1135673516 16:24394726-24394748 AAGGACATGGAGAGACAGCCAGG + Intergenic
1135894390 16:26385670-26385692 CAGGAAATGGAGAGATGTTAGGG - Intergenic
1137532116 16:49284309-49284331 CAGGACATAGAGAGGGAGTTAGG - Intergenic
1138339850 16:56281517-56281539 CGGGAAAGGGAGAGATAGAAGGG - Intronic
1139615826 16:68090409-68090431 TAAAACATTGAGAGATAGTAGGG + Intronic
1142194435 16:88732992-88733014 CTGGACAGGGAGAGACAGTCAGG - Intronic
1142545186 17:696518-696540 CAGGACATGGCAAGAGAGGACGG + Intronic
1143075800 17:4342200-4342222 CAGGACAAGGAGAGATAATCAGG - Intronic
1143979276 17:10854340-10854362 CAGCACATGCAGAGATCATATGG + Intergenic
1144088508 17:11832216-11832238 CATGACATGGAGTGACAGGAGGG - Intronic
1144676853 17:17167544-17167566 CAGGACATGGAGAGGCATCATGG + Intronic
1147176742 17:38660557-38660579 CAGGAGCTGGATAGAGAGTAGGG - Intergenic
1147304271 17:39552421-39552443 CAGGACATTTAGAGCAAGTATGG + Intronic
1148094846 17:45045200-45045222 CAGGACACGGACAGAAAGCAGGG + Intronic
1148743972 17:49908249-49908271 CAGGACAGGGAGACAGAGCAGGG + Intergenic
1148961910 17:51400596-51400618 CAAGAAAAGGAGAGATAGGATGG - Intergenic
1150515501 17:65805804-65805826 CAGAACATTGAGAGATTCTATGG - Intronic
1150922456 17:69497775-69497797 CAAGACTTGGAGAGACAATAAGG - Intronic
1151219788 17:72603921-72603943 CAGGGCAGGGAGAGATAATAAGG + Intergenic
1151744872 17:76006645-76006667 CAGGTCATGGAAAGAGATTATGG - Intronic
1153521635 18:5959592-5959614 CAGGGCAGGGATAGATAGGAGGG + Intronic
1155181987 18:23355985-23356007 CAGGACATGGGGAGAGGGTGAGG + Intronic
1156511035 18:37637074-37637096 CAGGGCTTTGGGAGATAGTAAGG - Intergenic
1157106877 18:44782145-44782167 CAGGACATGGGTAGAAAGAAGGG + Intronic
1157259077 18:46163154-46163176 CAGGCCATGGGGAAATAGAATGG - Intergenic
1158235464 18:55308091-55308113 CAGGAAATGGAAAGATAGTATGG + Intronic
1159456078 18:68661535-68661557 AAGGACAGTGAGAGACAGTATGG - Intergenic
1160157264 18:76443115-76443137 CTGACCATGGAGAGATAGGACGG - Exonic
1163676007 19:18655659-18655681 CTGGACATGGAGAGCCAGGATGG + Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1166004084 19:39895348-39895370 CAGGACATGGAGAGAAATACAGG - Intronic
1167595820 19:50427615-50427637 CAGGAGCTGGAGAGATAGCCAGG + Intronic
1167805221 19:51778364-51778386 CATGAGATGGAAAGATAGAATGG - Intronic
1168534878 19:57160553-57160575 CAGCACATGGGTACATAGTATGG + Intronic
926792036 2:16583743-16583765 GAGGACATGGAGACATGGGAAGG + Intronic
926885787 2:17597292-17597314 CAGGACATTGAGAGATTGGTAGG - Intronic
927297209 2:21468381-21468403 CAGGACAAAGAAAGAAAGTAGGG + Intergenic
927826733 2:26314506-26314528 CAGGAGATGGACAGCTGGTATGG + Exonic
928229622 2:29486129-29486151 CAGCACAAGGAGAGATAACATGG - Intronic
930261496 2:49152308-49152330 CATGAGATGTTGAGATAGTATGG - Intronic
930367297 2:50456264-50456286 CAGGATTTGGTGAGATAGGAAGG - Intronic
931609541 2:64083708-64083730 CAGGACAAGGAGAGAGAAAAAGG + Intergenic
934314736 2:91906842-91906864 GAGGATATGGAGAAATAGGAAGG + Intergenic
934580095 2:95430858-95430880 AAGGACATGGGAAGATAGGATGG + Intergenic
934599352 2:95645867-95645889 AAGGACATGGGAAGATAGGATGG - Intergenic
941684837 2:168437878-168437900 CAGGAGATGGATAGAAAGTTAGG + Intergenic
942149597 2:173061988-173062010 CAGGATATGAAGAGAAAGGAAGG - Intergenic
942470622 2:176256064-176256086 TAGAGCTTGGAGAGATAGTAGGG - Intergenic
943280330 2:185924073-185924095 CAGAACAGGGAGAGAGAGTATGG - Intergenic
943536073 2:189152400-189152422 AAGGGCATGGACAGATAATATGG + Intronic
943643798 2:190386824-190386846 CAGGAAATGGGGAGAGAGCAGGG - Intergenic
944845048 2:203659740-203659762 CAGGACAAGAAGAGAAAGTAGGG + Intergenic
945006512 2:205413340-205413362 AAGGAAATGGTGAGGTAGTAAGG - Intronic
945849356 2:214986723-214986745 CAGGACCTGGAGAGAAATCAAGG + Exonic
946447144 2:219749657-219749679 GAGGACATTGAGAGAAAATAAGG - Intergenic
1169812624 20:9623899-9623921 CAGGGCATGGTGAGAATGTAAGG + Intronic
1172926630 20:38542918-38542940 AAGGATATGGAGAGAAAGGAGGG + Intronic
1179055876 21:37933602-37933624 CAGGAGAAAGAGAGAGAGTAAGG - Intergenic
1179365482 21:40755114-40755136 CAGGACATGGAGAGATTTGGGGG + Intronic
1179774651 21:43653301-43653323 AAGGGCATGCAGAGACAGTAGGG + Intronic
1181559753 22:23693218-23693240 CAGGAGATGGACAGAAAGCAGGG + Intronic
1183541291 22:38430860-38430882 AAGGACATCCAGAGATAGGAAGG + Intronic
949315676 3:2752115-2752137 CAGGACATGGAGGGACAGAAAGG - Intronic
949623912 3:5847203-5847225 CAGGACATGGAAAGAAATTCGGG + Intergenic
950398864 3:12754832-12754854 CAGGACATGGGGAGCAGGTAGGG + Intronic
952864448 3:37843705-37843727 GAGGACGTGGAGAAATAGGAAGG + Intergenic
953402197 3:42633837-42633859 AAGCACATTGAAAGATAGTATGG + Intronic
953554726 3:43935065-43935087 GAGGATATGGAGAAATAGGAAGG - Intergenic
954148055 3:48644001-48644023 GAGGACAAGGAGAGACAGCAGGG + Intronic
954645743 3:52130586-52130608 GAGGACATGCAGAGAGAGAACGG - Intronic
954992749 3:54855191-54855213 CAGGAAATGGAGAGAGGGGAGGG + Intronic
955109222 3:55931114-55931136 GAGGACATGGAGAAATAGGGAGG + Intronic
955446930 3:59021886-59021908 AAGAACATGGAGAGATCTTAAGG - Intronic
955665554 3:61345845-61345867 CAGGTCATGGAGAGTCAGCATGG + Intergenic
955952833 3:64259533-64259555 CAGGACATGGACATATATTTGGG - Intronic
957878067 3:86174950-86174972 CAGGACACGGAAAGAAAGCAGGG - Intergenic
958182659 3:90080951-90080973 CCAGACATGGAGAGATAATCAGG - Intergenic
959677810 3:109056084-109056106 CAGGAAATGCAGAGAGGGTAGGG + Intronic
961978837 3:131055131-131055153 CAGGACCTGAAGAGATAGATAGG - Intronic
962868030 3:139464122-139464144 AAGGAAATGGGGAGAGAGTAAGG - Intronic
967645457 3:191917799-191917821 CATGACATGGATAGAAGGTAGGG + Intergenic
968360715 3:198144933-198144955 CAGGACACTGTGAGATTGTAAGG - Intergenic
968541141 4:1169027-1169049 CAGGACATGGAGAGAAGGGTGGG - Intronic
969101102 4:4768763-4768785 CAGGAGATGGACAGATAGAGAGG + Intergenic
970680321 4:18499696-18499718 GAGGATGTGGAGAGATAGGAAGG + Intergenic
970704294 4:18782128-18782150 CAGGAGAAAGAGAGATAGCAGGG + Intergenic
971566241 4:28145193-28145215 CAGGAAACAGAGAGATAATAGGG + Intergenic
972808315 4:42554333-42554355 CTGGACATGGAGAGAAAAGAAGG + Intronic
973956586 4:56068997-56069019 GAGGACACGGAGACATAGAAGGG + Intergenic
975289147 4:72656643-72656665 GAGGATATGGAGAAATAGGAAGG + Intergenic
975902674 4:79171316-79171338 CATGACATGGAGAGAAAAGAGGG - Intergenic
978514237 4:109554335-109554357 CAGGACCTGGAGACAGAATAGGG + Intergenic
980200178 4:129646719-129646741 AAGGACAAGGTGAAATAGTATGG + Intergenic
983988045 4:174083976-174083998 TAGGAGATGGTGAGATGGTAAGG - Intergenic
985846398 5:2352760-2352782 TAGGACATAGATAGATAGGAGGG - Intergenic
987095608 5:14546580-14546602 AAGGACATGGAGAGACACCAGGG + Intergenic
989129847 5:38096387-38096409 CAGGACTTGGAAAGATAAAAGGG + Intergenic
989277274 5:39603688-39603710 CAGGGCATGGAGAAAAAGCAAGG - Intergenic
989419160 5:41215703-41215725 CAGGACATGGAGAGTTAAGATGG + Intronic
991497224 5:67238297-67238319 CAGGACTTGGAGTGAAAGGATGG + Intergenic
992334847 5:75756090-75756112 CAGGGCATGGGGAGAGAGTGGGG + Intergenic
994448001 5:99902313-99902335 AAGGACAAGGAGAGATATGAGGG - Intergenic
996346700 5:122495383-122495405 AGGGACATGGAGAGTTACTATGG + Intergenic
996384274 5:122894331-122894353 CAAGAGATGGAGATATATTAGGG - Intronic
996951820 5:129135921-129135943 CAAGACATGGAGAAGTAGAAAGG - Intergenic
1000426348 5:161095499-161095521 CAGGAAGTGCAGAGCTAGTAAGG + Intergenic
1002788236 6:419850-419872 CAGGGAATGGGGAGATAGTGTGG - Intergenic
1004681739 6:17902405-17902427 CAGGATTTGGAGAGAAAATAAGG + Intronic
1005292608 6:24394339-24394361 TAGGACATGAAGAGATACCAGGG + Intergenic
1005600342 6:27420462-27420484 TTGGGCATGGAGAGACAGTAGGG - Intergenic
1006253533 6:32811187-32811209 CAGGACATGGAAAGAAAGCAGGG - Intergenic
1006299509 6:33186123-33186145 CAGGAAAAGGGGAGGTAGTAGGG - Intronic
1008140198 6:47823207-47823229 CAGGGGTTGGAGAGATAGTTTGG + Intronic
1009212892 6:60884219-60884241 GAGGATATGGAGAAATAGGAAGG - Intergenic
1010174792 6:73015812-73015834 CACAGCATGGAAAGATAGTAAGG - Intronic
1010743190 6:79531309-79531331 CTTGACATTGAGAGGTAGTATGG - Intronic
1012669060 6:102017260-102017282 CAGGAGATGGAGAGAGTGAAGGG + Intronic
1015583823 6:134755492-134755514 CAGGACTAAGAGAGATAGTGAGG - Intergenic
1015805307 6:137102399-137102421 CAGGACATGGTGAGAAATTGAGG - Intergenic
1016046146 6:139482681-139482703 CAGGAAATGCTGAGATAGTGTGG + Intergenic
1016487291 6:144555398-144555420 CAAGACAGAGAGAGATAGAAGGG + Intronic
1016548681 6:145252910-145252932 AATGAGATGGAGAGATAGCAAGG - Intergenic
1017249387 6:152263047-152263069 CAGGACATGGAGAGATAGTACGG + Intronic
1017625609 6:156345391-156345413 AAGGAGAGGGAGAGATAGGAAGG - Intergenic
1018255314 6:161912570-161912592 CAGCACGTGGAGAGGTGGTATGG + Intronic
1019259290 7:71699-71721 CAGGACACTGTGAGATTGTAAGG + Intergenic
1020426454 7:8071672-8071694 AAGAACATGGAGAGACAGTTGGG - Intronic
1020904693 7:14050816-14050838 AAGGACATGGACACATAGTAGGG + Intergenic
1021022937 7:15626258-15626280 CTGGACATGTAGAGTTTGTATGG + Intronic
1026673629 7:72410605-72410627 CAGGACATGAAGGGACATTAGGG - Intronic
1027247709 7:76378585-76378607 CAGGGAATCCAGAGATAGTAAGG - Intergenic
1028853308 7:95561505-95561527 CAGGACATGGAGACAGTGTAAGG - Intergenic
1031290368 7:119927431-119927453 CAGGAGAAGGAGAGCTTGTATGG - Intergenic
1031554078 7:123149992-123150014 CATGACATGGAGAGAGAGAATGG - Intronic
1031938555 7:127762389-127762411 GAGGACATGAAGAGACAGCAAGG - Intronic
1031986945 7:128169336-128169358 CTGGAAATGGAGAGATGGTTGGG - Intergenic
1032413643 7:131719453-131719475 CAGGGGATGGAGAGATGGGAAGG + Intergenic
1032753839 7:134869430-134869452 CAGCACTGGAAGAGATAGTATGG + Intronic
1035095895 7:156355148-156355170 CAGGACATGGTGAGATGGCCTGG - Intergenic
1035279427 7:157768235-157768257 CAGGAGATGCAGAGAGAGTGAGG + Intronic
1035365225 7:158344991-158345013 TAGGCCATGGAGGGAAAGTATGG + Intronic
1036285254 8:7438885-7438907 CAGGCCAGTGAGAGATAGTAAGG - Intergenic
1036336222 8:7872644-7872666 CAGGCCAGTGAGAGATAGTAAGG + Intergenic
1037338586 8:17816467-17816489 GAGGATATGGAGAAATAGGAAGG + Intergenic
1037447257 8:18978524-18978546 CAGGTTATGGAGAGATGTTAAGG - Intronic
1039471637 8:37817036-37817058 CAGGTAATGGAGACACAGTATGG + Intronic
1039925666 8:41929610-41929632 CGTGACATGGAGAGATACAAAGG + Exonic
1043178836 8:77057905-77057927 CAGGAGCTAGAGAGAGAGTAAGG + Intergenic
1045492633 8:102681838-102681860 CAGGAGATGGAGCTATAGAAGGG + Intergenic
1045749764 8:105469374-105469396 TAGGAGATTGAGAGATAGAAAGG - Intronic
1046460110 8:114522760-114522782 GAGAACATGGACAGATAGAAGGG - Intergenic
1046802581 8:118445059-118445081 AAGGACATTGCAAGATAGTAAGG - Intronic
1046834315 8:118782565-118782587 CAGGGGATGGAGAGAAACTAAGG + Intergenic
1048768455 8:137869098-137869120 CAGGGCATGGAGAGAAGGCAAGG - Intergenic
1049291632 8:141806374-141806396 CAGGACATGGAAAGGAAGGAGGG - Intergenic
1049566192 8:143340358-143340380 CAGGACATGGAGGGAGAGAAGGG + Intronic
1049721449 8:144117501-144117523 CAGGACACAGAAAGATAGCAGGG + Exonic
1050633014 9:7580656-7580678 CAGTCCATGGGGAGATAGGAAGG + Intergenic
1050653490 9:7799076-7799098 CAGGACCTGGAGAAAAAGTATGG + Intronic
1051538884 9:18191823-18191845 CATGAAATGGAGAGAGAATATGG - Intergenic
1052643194 9:31195817-31195839 TAGGACATGGAGAGAAAAGAGGG - Intergenic
1052754146 9:32523709-32523731 CAAGACAGGGAGAGAGAGAATGG - Intronic
1053165460 9:35841090-35841112 CAGGAGAGGGAGAGACAGCAGGG - Intronic
1053183739 9:35996724-35996746 CAAGACATGGAGAGAGAAGAGGG + Intergenic
1053184569 9:36004392-36004414 CTGGACATGGAGAGATGCAAGGG + Intergenic
1055179477 9:73366703-73366725 CAGGAAATGGAAAGAAAGCAAGG - Intergenic
1055335288 9:75227435-75227457 CAGGACCAGGAGAGAGAATAGGG + Intergenic
1056163160 9:83918334-83918356 CAGGACAGGGAGGGAGAGGAGGG + Intronic
1056389650 9:86129175-86129197 AGGGACAGGGAGAGATAGTGAGG - Intergenic
1060884483 9:127140873-127140895 CAGGCCCTGGAGAGATGGAAGGG + Intronic
1062745418 9:138208764-138208786 CAGGACACTGTGAGATTGTAAGG - Intergenic
1203698528 Un_GL000214v1:117512-117534 CAGGTCATAGGGAGATAGTCTGG + Intergenic
1203699446 Un_GL000214v1:123663-123685 CAGGTCATAGGGAGATAGTCCGG + Intergenic
1203700392 Un_GL000214v1:129946-129968 CAGGTCATAGGGAGATAGTCCGG + Intergenic
1203701311 Un_GL000214v1:135966-135988 CAGGTCATAGGGAGATAGTCTGG + Intergenic
1203569739 Un_KI270744v1:119900-119922 CAGGTCATAGGGAGATAGTCTGG + Intergenic
1185691104 X:2155895-2155917 CAGGACATGGACATATATTTTGG + Intergenic
1186135919 X:6520765-6520787 CAGGCCTTGGAGAGATTGGAGGG + Intergenic
1186333132 X:8557687-8557709 GAGGATATGGAGAAATAGGAAGG + Intronic
1186404132 X:9286830-9286852 CAGGACATGGAAAGACAATGTGG - Intergenic
1187948203 X:24446995-24447017 GAGGAGATGGAGAGATGCTAGGG + Intergenic
1189098111 X:38161131-38161153 CAGGACATGGAGAGACTGAGGGG + Intronic
1189285848 X:39852030-39852052 GAGGACATGGAGAGAGAGCCAGG + Intergenic
1190322576 X:49187396-49187418 CAGGGAAAGGAGAGACAGTAGGG + Intergenic
1192334381 X:70205183-70205205 CAGGAGAGGGAAAGATCGTAAGG + Exonic
1193476646 X:81974284-81974306 GAGGACATGGAGAAATAGGAAGG + Intergenic
1195377649 X:104243527-104243549 CAGGACATGAAAAGATAAGAAGG - Intergenic
1195578592 X:106477077-106477099 CAGAAGATTGAGAGACAGTAGGG + Intergenic
1195737706 X:108030875-108030897 CAGGAAGTGGAGACATAGGAAGG + Intergenic
1198250001 X:134870617-134870639 CAGGCAATGGAGAGAATGTATGG + Intergenic
1198660595 X:138964327-138964349 CAGGACATAGAAAAATAGTGGGG - Intronic
1199319397 X:146420535-146420557 CAGGATAGGGACAGCTAGTAGGG - Intergenic
1199537270 X:148916790-148916812 CAAAACATGGAGAGAGAGAAAGG - Intronic
1199621512 X:149705700-149705722 CAGGACATCTAGAGACAGTCAGG + Intronic