ID: 1017253720

View in Genome Browser
Species Human (GRCh38)
Location 6:152309855-152309877
Sequence GGATGGCGGTGTGCTGCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017253715_1017253720 2 Left 1017253715 6:152309830-152309852 CCTGCCTGCATGATGTTACACTG 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 178
1017253713_1017253720 9 Left 1017253713 6:152309823-152309845 CCCTGCACCTGCCTGCATGATGT 0: 1
1: 0
2: 1
3: 17
4: 216
Right 1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 178
1017253714_1017253720 8 Left 1017253714 6:152309824-152309846 CCTGCACCTGCCTGCATGATGTT 0: 1
1: 0
2: 1
3: 18
4: 190
Right 1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 178
1017253716_1017253720 -2 Left 1017253716 6:152309834-152309856 CCTGCATGATGTTACACTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 122
Right 1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017253720 Original CRISPR GGATGGCGGTGTGCTGCAGC CGG Exonic
900418889 1:2547099-2547121 GGAAGGCGGTTTGAGGCAGCGGG + Intergenic
901080300 1:6580245-6580267 GGACGGCGGAGGGCGGCAGCCGG - Intronic
902224630 1:14988828-14988850 GGAGGGCCGTGGCCTGCAGCTGG - Intronic
902250681 1:15152976-15152998 GGATGGGGGCGCGCTGCACCGGG - Intronic
904756799 1:32772383-32772405 GAATGGAGGTGTCCTGCAGCTGG + Exonic
905422982 1:37860646-37860668 AGATGGCAGTTCGCTGCAGCTGG - Intergenic
906471803 1:46137169-46137191 GGAAGGCTGTGTGGTGCAGCGGG - Intronic
911253226 1:95604143-95604165 GGATGGCGGTGGGGTGCTACTGG + Intergenic
912697972 1:111855691-111855713 GGGTGGAGGTGTGCAGCAGGGGG - Intronic
915143032 1:153778573-153778595 GGTGGGCGGGGTGCTGAAGCTGG + Intronic
915928445 1:160042064-160042086 GGATGGTGGTGAGCACCAGCTGG + Exonic
917135367 1:171784021-171784043 GGTTGGCCGTGTCCTGCAGGTGG + Exonic
921383472 1:214548256-214548278 GGCTGTCAGTGTGCTGGAGCAGG - Intronic
922507675 1:226135938-226135960 GGAGGGAGGAGGGCTGCAGCCGG + Intergenic
922535586 1:226378354-226378376 GGATGGTGGGGTACAGCAGCTGG - Intronic
922775381 1:228212119-228212141 GGATGGACGTGGGCCGCAGCAGG - Exonic
922821234 1:228487279-228487301 TGGCAGCGGTGTGCTGCAGCCGG - Exonic
922868940 1:228884382-228884404 GGAGGGCTGTCTCCTGCAGCAGG + Intergenic
922957883 1:229619878-229619900 GCATGGTGGTGTGGTGAAGCCGG - Intronic
923310230 1:232727964-232727986 GGATGGTCATGTGCTGCTGCTGG - Intergenic
1062977876 10:1699146-1699168 GGATTGCAGTATGCTGCAGCTGG - Intronic
1064381461 10:14845476-14845498 GGATGGAGGTGTGAGGCGGCTGG + Intronic
1067474706 10:46557583-46557605 GGAAGGCGCTGTGGTGCTGCGGG - Intergenic
1067942962 10:50671387-50671409 GGATGTGGCTGTGCTGGAGCTGG - Intergenic
1070864206 10:79696348-79696370 GGATGTGGCTGTGCTGGAGCTGG - Intergenic
1071578848 10:86752399-86752421 GCAGGGCAGTGAGCTGCAGCAGG + Intergenic
1071631105 10:87218574-87218596 GGATGTGGCTGTGCTGGAGCTGG - Intergenic
1072668937 10:97415132-97415154 GGTGGGCAGTGTGGTGCAGCTGG + Intronic
1075092942 10:119453609-119453631 GGATGGCGTGTTGCTGCATCTGG - Intronic
1076713370 10:132351157-132351179 GCATGGGGTGGTGCTGCAGCAGG - Intronic
1080485852 11:32705491-32705513 GCTTGGCTGTGTGCAGCAGCCGG + Intronic
1081413858 11:42789869-42789891 GGATGGAGATGTGTTGCGGCTGG - Intergenic
1081611426 11:44565517-44565539 GGAAGGCGGTGCGCTCCCGCCGG - Intronic
1082260536 11:50073836-50073858 GGATGCCGGGAGGCTGCAGCTGG + Intergenic
1083390525 11:62346357-62346379 GGAGGGTGGTGTGCTGAAGAGGG - Intronic
1084733949 11:71092514-71092536 CGATGGCTGTGTGATACAGCGGG + Intronic
1089610432 11:119665627-119665649 AGTGGGCAGTGTGCTGCAGCTGG - Intronic
1090173654 11:124627029-124627051 GGATGGTGGTGTGCAGCCTCAGG + Exonic
1090627677 11:128620260-128620282 GGCTGGCTGTGTGCTGGACCAGG - Intergenic
1091238568 11:134037398-134037420 GGAGGGCGGTGGGCGGGAGCTGG + Intergenic
1091930624 12:4392548-4392570 GGCCGTCTGTGTGCTGCAGCTGG + Intergenic
1092230617 12:6773704-6773726 GGATGGCCGGGGGCGGCAGCGGG - Exonic
1095589458 12:43887602-43887624 TGCTGGCGGTCTTCTGCAGCAGG - Intronic
1096100932 12:48970098-48970120 GGATGGCGCTGTGGTGCGGCAGG + Exonic
1097153530 12:56996317-56996339 GGGTGGGGGGCTGCTGCAGCAGG - Exonic
1101387874 12:104273705-104273727 GGATGGCGCTGGCCTGCAGAAGG - Intronic
1103073754 12:117966154-117966176 GGATGGGGATGTGCCGCAGTGGG - Intronic
1106125212 13:26895539-26895561 GGACGGCGCTGTGATGGAGCAGG + Intergenic
1106327716 13:28710176-28710198 GAATGGGGGTGGGCTCCAGCTGG - Intronic
1106885827 13:34183216-34183238 GGATAGGGGCTTGCTGCAGCTGG - Intergenic
1107722832 13:43267114-43267136 GGAGAGGGGTGGGCTGCAGCGGG - Intronic
1112571242 13:100595333-100595355 GGCAGGCTGTGTCCTGCAGCAGG + Intergenic
1116452109 14:45078374-45078396 GGATGGTGGTTTGCAGGAGCTGG - Intergenic
1117912780 14:60650121-60650143 GGAGGGTGGTGTGCAGCAGTGGG - Intronic
1117931067 14:60840543-60840565 GGATTGCAGAGTGCAGCAGCTGG + Intronic
1119628386 14:76203572-76203594 GGATGGGAGAGTGCTGAAGCTGG + Exonic
1119731901 14:76956499-76956521 GGCTGGCGCTGGGCGGCAGCCGG - Intergenic
1119922600 14:78460183-78460205 GGAGGGTGGTGTGCTGGAGAGGG - Intronic
1121599698 14:95194148-95194170 GGATTGGGGTGTGCTGCTCCGGG + Intronic
1121726723 14:96157655-96157677 GGGTTGTGGTGTGCTGCAGGTGG - Intergenic
1122580600 14:102769280-102769302 GGAGGCCAGTGTGCTGGAGCAGG + Intergenic
1128539624 15:68517590-68517612 GGAGTGCTGTGTTCTGCAGCTGG + Intergenic
1130251837 15:82304842-82304864 GGATGGCAGTGTCATGCTGCAGG - Intergenic
1131063118 15:89416654-89416676 GAATGTCGCTTTGCTGCAGCGGG + Intergenic
1132971220 16:2690077-2690099 GGATGGCGGAGAGCTGCAGCCGG + Intronic
1133001479 16:2853640-2853662 GGAGGGCGAGGTGGTGCAGCTGG + Intronic
1133304388 16:4800527-4800549 GGAAGGCGAAGTGCAGCAGCTGG + Exonic
1133971687 16:10572734-10572756 GGATTGCGGGGTGCTACAGGTGG - Intronic
1135046901 16:19163358-19163380 AGATGCAGGTGTGCTGCAGGAGG - Intronic
1135409110 16:22219844-22219866 GGATGGCCCTGTGCTGAGGCTGG - Intronic
1137693045 16:50442437-50442459 GCATGGCTGTGTGCAGTAGCTGG + Intergenic
1141799746 16:86298673-86298695 GGATGGTGGCTTTCTGCAGCAGG + Intergenic
1142155996 16:88533164-88533186 GCAGGGCCGTGTGCTGCTGCTGG - Exonic
1142258985 16:89033616-89033638 GGATGGCAGTGAGGAGCAGCAGG + Intergenic
1142942931 17:3398005-3398027 TGATGGCGGTGTAGTGCAGGGGG + Exonic
1142946462 17:3433409-3433431 TGATGGCGGTGTAGTGCAGGAGG + Exonic
1142986047 17:3695885-3695907 GGATGGAGGCCTGCAGCAGCCGG + Exonic
1143040562 17:4032860-4032882 AGATGTTGGTGTGCTTCAGCTGG + Exonic
1144356503 17:14451733-14451755 GGATGGAGCTCTGCTGAAGCAGG - Intergenic
1144659697 17:17060127-17060149 GGCTGGGTGTGTGCTGCAGGAGG + Intronic
1144707534 17:17379494-17379516 GGATGGTGGTTTCCTGGAGCTGG - Intergenic
1144737597 17:17563817-17563839 GGGTGGGGCTGTGCTGGAGCTGG - Intronic
1145061587 17:19737532-19737554 GCATGGCGTTGGGCTGCAGCTGG - Intergenic
1146414626 17:32620483-32620505 GGATGGCGGGCTTCTCCAGCAGG + Intronic
1151342802 17:73482535-73482557 GGATGGCGGTGTTATCGAGCTGG + Intronic
1152424912 17:80213674-80213696 GGCAGGCCCTGTGCTGCAGCTGG - Intronic
1152548730 17:81018470-81018492 GGATGACGCTGTGTTCCAGCCGG - Intergenic
1152895752 17:82910228-82910250 GGATGGGGACGTGCAGCAGCAGG - Intronic
1154084557 18:11290377-11290399 GGAAGGTGGTGTGCTGGGGCAGG - Intergenic
1155203034 18:23534225-23534247 AGGTGGCAGTGTGCTGAAGCAGG - Intronic
1156929935 18:42629444-42629466 TGATGGCGTTGTGTTGCATCAGG - Intergenic
1158191033 18:54828709-54828731 GGAAGGCGGGCTGCTGCTGCTGG + Intronic
1160959993 19:1716472-1716494 GGGTGGCGGAGTGCGGCACCTGG + Intergenic
1161255916 19:3309435-3309457 GGTTGGGGGTGTGGTGCAGATGG + Intergenic
1162110802 19:8398626-8398648 GGATGTGGGTTTGCTGCACCAGG + Intronic
1163023573 19:14496366-14496388 GGAGGGGGGGGAGCTGCAGCTGG + Intergenic
1165336060 19:35170317-35170339 GGATGGCGGTGGGCGGTTGCAGG + Intergenic
1166251378 19:41573229-41573251 GGCTGGTGCTGTCCTGCAGCAGG - Intronic
926321735 2:11753109-11753131 GGGTGGGGGTGTGCTGGAGGAGG + Intronic
928234559 2:29528396-29528418 GAATGGCAGTGTGGTGCAGTGGG + Intronic
929932924 2:46272638-46272660 GGTTGGGGGTCTGCTGAAGCTGG + Intergenic
935064643 2:99636978-99637000 GCAGGGTGGTGTGCTCCAGCTGG + Intronic
939375128 2:141355462-141355484 GGATGGGGGTGTGGTGGAGGTGG - Intronic
946051321 2:216864754-216864776 GGAAGGCACTGTGGTGCAGCAGG - Intergenic
946448550 2:219760695-219760717 GGAGGGCAGGGTGCTGCTGCTGG - Intergenic
947298159 2:228656238-228656260 GGATGGATGTGTGCTGCTTCCGG - Intergenic
948829130 2:240589188-240589210 GGAAGGTGGTTTCCTGCAGCGGG - Intronic
948995473 2:241576148-241576170 GGAGGGTGGAGGGCTGCAGCGGG - Intergenic
1169145817 20:3251745-3251767 GGAAGGGGGCGTCCTGCAGCTGG - Exonic
1169252725 20:4072621-4072643 GGATGGCAGTTTGGTGCAACTGG + Exonic
1170759508 20:19237288-19237310 GGATGGCGGGGTCGTGCATCTGG + Intronic
1170939041 20:20833468-20833490 GGAAGGCAGTGTGGTGCAGTGGG + Intergenic
1173546138 20:43899677-43899699 GGAAGGCTGTGCGCAGCAGCAGG + Intergenic
1173925644 20:46779402-46779424 TGATGGCTCTGTGCTGCACCTGG + Intergenic
1174633003 20:51974649-51974671 GGATTGAGGTGTGCTGAGGCTGG + Intergenic
1180041630 21:45283234-45283256 GGGAGGCGGGGTGCTGCAGGGGG + Intronic
1182713276 22:32335699-32335721 GAATCGCTGGGTGCTGCAGCTGG - Intergenic
1183440182 22:37818569-37818591 GGCAGTCGGTGTGCTGCACCCGG + Intergenic
1185010852 22:48313158-48313180 GCACGGTGGTGGGCTGCAGCGGG - Intergenic
1185183898 22:49381165-49381187 GGATGGTGGTGTGCTGAGGCCGG - Intergenic
949522392 3:4868754-4868776 GGAAGGCGGCGTGCCGCGGCCGG + Intronic
951429442 3:22589016-22589038 ATATGGTGGTGTGCTGCTGCTGG + Intergenic
952796103 3:37240763-37240785 GGCAGGCCGTGTGCTTCAGCTGG + Intergenic
952897677 3:38088987-38089009 GAGTGGCAGTGTGCTGCAACAGG - Intronic
953741361 3:45541872-45541894 GGATGCCAGTGTGCTGCTCCAGG + Exonic
954707252 3:52487592-52487614 GGATGCGGATGTGCTCCAGCAGG - Exonic
954809985 3:53241699-53241721 GGGTGGTGGTGTGCTGTAGCAGG - Intronic
955223316 3:57040879-57040901 GGAGGGCACTGTGCAGCAGCAGG - Intronic
955531043 3:59873468-59873490 GAATGGGGCTGTGCTGCAGAAGG - Intronic
958584358 3:96068350-96068372 GCATGGCTGTGTGCTGTGGCTGG - Intergenic
961123524 3:124395227-124395249 GAGTGGCGGTCTGCTGCTGCTGG - Exonic
967912681 3:194555388-194555410 GGATGGGGGTGGGATGGAGCAGG - Intergenic
967989157 3:195118562-195118584 GAAGGGCTGTGGGCTGCAGCAGG + Intronic
968908378 4:3464654-3464676 GGATGGTGCTGGGCTGGAGCCGG + Intronic
969368608 4:6716227-6716249 GGATGGCGGAGCGCTGCCGGAGG + Exonic
969884213 4:10200874-10200896 GGATGGCAGTGTTGTACAGCTGG + Intergenic
970144474 4:13020642-13020664 GGCTGGCAGTGTGCTGCTGATGG - Intergenic
977030483 4:91876546-91876568 AGATAGCGGTGTGCTGCAGGGGG + Intergenic
980853988 4:138417279-138417301 GGAAGGCGGTGTGGTACAGCAGG - Intergenic
982207207 4:153005720-153005742 GGTTGGAGGTGTGTTGGAGCTGG + Intergenic
982603031 4:157475431-157475453 GGCTGGCTGTCTCCTGCAGCAGG + Intergenic
984172773 4:176380801-176380823 GGATGGGGGTGAGCTGGAGAGGG + Intergenic
992752546 5:79874613-79874635 GGATTGCAGAGTGCAGCAGCTGG - Intergenic
994756012 5:103794081-103794103 GCATGGCCCTGTCCTGCAGCTGG - Intergenic
995485018 5:112631404-112631426 CGATGTAGGTGTGCTTCAGCTGG - Intergenic
999978769 5:156938815-156938837 AGGTGGCTGTGTACTGCAGCAGG - Intronic
1001192583 5:169644341-169644363 AGATGGCGGTGGCTTGCAGCAGG + Intronic
1002441619 5:179267244-179267266 GGCTGGCTGTGGGCTGCAGGTGG + Intronic
1003569757 6:7248086-7248108 GCATTGCGATGTGGTGCAGCGGG - Intronic
1006727685 6:36211502-36211524 GGATGCAGCTGTGCTGGAGCAGG + Exonic
1010671700 6:78694483-78694505 GCAGGGCGGTGAGCTGAAGCAGG + Intergenic
1011089686 6:83583183-83583205 GGATGTGGGTGGGGTGCAGCTGG - Intronic
1011261067 6:85469895-85469917 GAATGTCTGTGTGCTTCAGCAGG - Intronic
1012855897 6:104501345-104501367 GGAAGGCAGTTTCCTGCAGCAGG + Intergenic
1015569174 6:134604281-134604303 GGATGGCTGGGGGCTGCAGTAGG + Intergenic
1015938895 6:138430144-138430166 GGATGGAGATGATCTGCAGCAGG - Intronic
1017253720 6:152309855-152309877 GGATGGCGGTGTGCTGCAGCCGG + Exonic
1019634653 7:2069091-2069113 GGAGGCAGGAGTGCTGCAGCCGG - Intronic
1022030651 7:26488899-26488921 GGATGTGGGTGTGCGGGAGCAGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024249536 7:47495846-47495868 GGAGGAAGGTGTGCTGCAGTTGG - Intronic
1032018001 7:128392136-128392158 GGGTGGGGGTGTGCTGGTGCAGG - Intergenic
1034133545 7:148743254-148743276 AGATGGTGATGTGCTGGAGCTGG + Intronic
1035038710 7:155911974-155911996 GGAGGGCGTGGTGCTGGAGCAGG - Intergenic
1036210504 8:6836462-6836484 GGATGGGGGTGGGGTGGAGCAGG + Intergenic
1038068004 8:23983596-23983618 GGATAGAGGTGTGCTGAATCCGG + Intergenic
1039468028 8:37797459-37797481 GGAGGGTGGTGTGCAGCGGCGGG + Exonic
1040319711 8:46286431-46286453 GGCTGGCAGTGGGCTGCAGGTGG - Intergenic
1045262049 8:100584859-100584881 GCATGGCAGCGTGCTGAAGCGGG - Intronic
1047752538 8:127892694-127892716 GTGTGACGGTGAGCTGCAGCAGG + Intergenic
1049376371 8:142291260-142291282 GGATGGCCTTGTGCTGGAGTAGG + Intronic
1049705872 8:144041726-144041748 GGTTGGGGGTGTGCGGCTGCTGG + Intronic
1049791600 8:144474954-144474976 ACAGGGCGGTGTTCTGCAGCCGG + Exonic
1050222425 9:3408361-3408383 GGATGGCCCTGTGCTCAAGCAGG - Intronic
1050653521 9:7799352-7799374 GGGAGGCGGGGTGCTGCCGCTGG - Intronic
1053600357 9:39603550-39603572 GTATGTCGGTGTGCTGGGGCCGG + Intergenic
1053858008 9:42357406-42357428 GTATGTCGGTGTGCTGGGGCCGG + Intergenic
1054253171 9:62738834-62738856 GTATGTCGGTGTGCTGGGGCCGG - Intergenic
1054567287 9:66773333-66773355 GTATGTCGGTGTGCTGGGGCCGG - Intergenic
1054906934 9:70420356-70420378 GGTTGGGGGTGTGCTGCGGCGGG - Intergenic
1055216799 9:73873282-73873304 GGGTGCAGGTGTGCTGCAGGTGG - Intergenic
1057188479 9:93072402-93072424 GGATGGCATTTGGCTGCAGCTGG - Intronic
1059087187 9:111317015-111317037 GGATGCCGCTCTGCTGCATCTGG + Intergenic
1059326557 9:113507350-113507372 AGATGGCGGGGTCCTGCGGCGGG + Exonic
1059902994 9:118949436-118949458 GGAAAGTGGTGTGCTGGAGCTGG - Intergenic
1061037386 9:128121201-128121223 GGATGTGCGTGTGCTGCATCAGG + Exonic
1185948256 X:4401795-4401817 GAGTGGCTGTGTCCTGCAGCAGG + Intergenic
1187564183 X:20432280-20432302 GAATGGCGGGATGCTACAGCAGG + Intergenic
1190474821 X:50815468-50815490 AGCCTGCGGTGTGCTGCAGCAGG + Intergenic
1198774372 X:140163969-140163991 GAAGGGCGGTGTGGTGCAGTGGG + Intergenic