ID: 1017254052

View in Genome Browser
Species Human (GRCh38)
Location 6:152313382-152313404
Sequence TAGGGGCCTGAATAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017254052_1017254061 26 Left 1017254052 6:152313382-152313404 CCCAGCCCCTATTCAGGCCCCTA 0: 1
1: 0
2: 1
3: 6
4: 140
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254052_1017254057 -9 Left 1017254052 6:152313382-152313404 CCCAGCCCCTATTCAGGCCCCTA 0: 1
1: 0
2: 1
3: 6
4: 140
Right 1017254057 6:152313396-152313418 AGGCCCCTACGAAGTCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017254052 Original CRISPR TAGGGGCCTGAATAGGGGCT GGG (reversed) Intronic
900158437 1:1212613-1212635 GAGGGGCCTGGCCAGGGGCTGGG - Intronic
900404407 1:2486144-2486166 ATGGGGCCTGGATAGGGGATTGG + Intronic
900802287 1:4744924-4744946 TAGGGCCCGGATTCGGGGCTGGG + Intronic
901088193 1:6624992-6625014 TTCGGGCCTGAATTGGGGCCCGG + Intronic
903322656 1:22552182-22552204 TAGGGGCCAGCAGAGGGACTGGG + Intergenic
904612336 1:31732488-31732510 TAGGGGCCTGGGCAGGGCCTGGG - Intronic
904786496 1:32987049-32987071 TTGGGGCCTGGATAGTGGTTGGG + Intergenic
904829005 1:33294852-33294874 TAGGGGCCAGAGTAAGGACTTGG + Intronic
904832065 1:33311781-33311803 AAGGGACCTGCCTAGGGGCTGGG - Intronic
906175386 1:43766953-43766975 GAGGGGCCTGGAAAAGGGCTGGG + Intronic
906557637 1:46726530-46726552 TAGAGGCCTCAAAAGGGTCTTGG + Intergenic
908128151 1:61050543-61050565 GAGGGGCCTAAAAGGGGGCTGGG + Intronic
912387426 1:109278813-109278835 CAGGGGCCTGAATAGGCCCTAGG - Intergenic
915937763 1:160098929-160098951 GAGGGGCCGGAACTGGGGCTGGG - Intronic
915955256 1:160215452-160215474 TATGGCCCAGAATAAGGGCTGGG + Intergenic
918257364 1:182761467-182761489 TAGGGGCCTGCATATGCACTAGG - Intergenic
919464901 1:197915412-197915434 AAGGGCCCTGAGGAGGGGCTGGG - Intronic
919989973 1:202702892-202702914 GGGGGGCCTGGAGAGGGGCTTGG - Intronic
920305478 1:205015583-205015605 TATGGGCCTCAGAAGGGGCTGGG + Intronic
920719042 1:208369902-208369924 CAAGGCCCTGAATAGGGGTTGGG + Intergenic
920728838 1:208463525-208463547 TAGGGACCTGCATAGGGAATGGG - Intergenic
920954870 1:210609666-210609688 TTGGGGCCTGTTGAGGGGCTAGG - Intronic
924947858 1:248858106-248858128 TAGGGGCCGGGAGAAGGGCTTGG - Intronic
1063351641 10:5362266-5362288 TGGGGGACTGAACAGAGGCTTGG - Intergenic
1065821752 10:29532277-29532299 TAGAGGCATGAAGAGGGGTTTGG - Intronic
1067049114 10:43001844-43001866 AAGTGGCCTGAACATGGGCTTGG - Intergenic
1067175013 10:43939498-43939520 CTGGGGCCTGGATGGGGGCTGGG + Intergenic
1070540481 10:77412104-77412126 TTGGGACCAGAGTAGGGGCTGGG + Intronic
1076141477 10:128081999-128082021 TTGGGGCCGGGACAGGGGCTTGG - Intronic
1076544788 10:131238128-131238150 TAGGGGCTGGAACAGGGGCGGGG - Intronic
1077216740 11:1398173-1398195 AAGGGGTCAGGATAGGGGCTGGG + Intronic
1077524725 11:3057286-3057308 TGGGGGCCTGACTGGGCGCTGGG - Intronic
1079984844 11:27189534-27189556 TGGGGTCCTGACTAGGGACTGGG - Intergenic
1081773632 11:45664275-45664297 CAGGTGCCTGAAGACGGGCTTGG - Intronic
1081992750 11:47346540-47346562 AAGGGAGCTGAAGAGGGGCTGGG + Intronic
1084005037 11:66317989-66318011 TAGGGGGCTGGGTGGGGGCTGGG + Intergenic
1085316440 11:75548014-75548036 TAGGAGCCTGAACAGAGGGTAGG + Intergenic
1085537356 11:77230742-77230764 TAGGGGCCTGCATATAGGTTTGG - Intronic
1088920638 11:114257876-114257898 GAGGTGAGTGAATAGGGGCTGGG + Exonic
1088922167 11:114268058-114268080 TGAGGGCCTGAAATGGGGCTGGG + Intronic
1091857834 12:3753323-3753345 TGGGAGCCTGAATCGGGGCAAGG - Intronic
1092174085 12:6391017-6391039 CAGGGGCCTGAGTAGGGCCCGGG + Exonic
1103567449 12:121823573-121823595 GCGGGGCCGGAAGAGGGGCTGGG - Exonic
1103918518 12:124387997-124388019 TAGGAGCCTGGCTGGGGGCTGGG + Intronic
1111465989 13:88611456-88611478 TCGGGGCCTGATAAGGGGCGAGG - Intergenic
1112587104 13:100728443-100728465 TAGGGGCGTGAATAGAGTCTGGG + Intergenic
1113842803 13:113369952-113369974 GAGGGTCCTGAATAGGGGCTGGG - Intergenic
1119000348 14:70876178-70876200 TGAGGTCTTGAATAGGGGCTGGG - Intergenic
1120186417 14:81398080-81398102 TAGGGCCCTAAAAAGAGGCTTGG - Intronic
1120298597 14:82677198-82677220 TATGGGCCTGACTTGGTGCTGGG - Intergenic
1121115825 14:91341863-91341885 GGGGGGCCTGAGTTGGGGCTGGG + Intronic
1121307742 14:92917582-92917604 TGGAGGCCTGATAAGGGGCTTGG + Intergenic
1122988688 14:105226032-105226054 TAAAGGTCTGAATAGGGGCCGGG + Intronic
1125056603 15:35365864-35365886 TTGGGGCTTGAATGGGTGCTGGG - Intronic
1125685706 15:41562028-41562050 AAGGGCCCTGAATGGGAGCTGGG + Intronic
1126468574 15:48983276-48983298 CAGGGGCTTGGAAAGGGGCTTGG - Intergenic
1127674848 15:61229029-61229051 TAGGAGGCTGGAGAGGGGCTGGG - Intronic
1130147177 15:81283012-81283034 CAGTGGCCTGGAGAGGGGCTGGG - Intronic
1131055524 15:89372193-89372215 AAGGGGCCTGGGTAGGGGCCTGG + Intergenic
1132163865 15:99566173-99566195 TAGGGGACCGAGTAGGGGTTGGG + Intronic
1134203735 16:12220383-12220405 TAGGGGCCTGCATAGGACCCAGG + Intronic
1135114120 16:19711343-19711365 GAGGGGCCTGAGGAGGGTCTGGG + Intronic
1135521750 16:23183096-23183118 AAGGGGGCTGAACAGGCGCTGGG - Intronic
1139951288 16:70672392-70672414 TAGGGTCCTGAATTGGGTCATGG + Intronic
1140096775 16:71882954-71882976 TAGCTGCCTGAACATGGGCTGGG + Intronic
1141097823 16:81175353-81175375 TAGTGGCCAGAATAGGGGGAGGG - Intergenic
1143090128 17:4445177-4445199 CAGGGGCCTGGACAGGGGCATGG - Intronic
1144731737 17:17530015-17530037 TAAGGACATGAAGAGGGGCTGGG + Intronic
1145907326 17:28523680-28523702 TAGGAGCCTCAGGAGGGGCTTGG - Intronic
1148530452 17:48385227-48385249 AAGGGGACTGAATAGTGACTGGG + Intronic
1148785589 17:50144716-50144738 TAGGCGCTGGAATAGGGGCTGGG - Intronic
1151470032 17:74312232-74312254 TAGGGGCCTGGACAGGGGTTGGG + Intronic
1156268404 18:35508820-35508842 TAGGTGCTCGAAGAGGGGCTGGG - Intergenic
1159033091 18:63251153-63251175 TATGGAACGGAATAGGGGCTTGG + Intronic
1160800430 19:965082-965104 TAAGGGCCTGTATGGGGCCTGGG + Intronic
1162582281 19:11538753-11538775 TAGGGGCCTGCCAAGGGGCGGGG - Exonic
1164715946 19:30390509-30390531 TGGGGACCAGCATAGGGGCTGGG - Intronic
1167294897 19:48644365-48644387 GATGGGCATGAATAGAGGCTGGG - Intronic
1167550009 19:50153989-50154011 GAGGGGCCGGAGAAGGGGCTGGG + Intronic
1167941157 19:52946666-52946688 GCGGGGCCTGAACAGGTGCTGGG - Intronic
1168276318 19:55280488-55280510 GAGGGGCCTGTAAAGGGGCCGGG - Intergenic
1168691824 19:58381983-58382005 TAGGAGCCGGACTAGGGGCCTGG - Intergenic
926312001 2:11681842-11681864 CAGAGGCCTGAACAGAGGCTGGG + Intronic
929568098 2:43002344-43002366 TAGGGCCGTGTAAAGGGGCTGGG + Intergenic
930709276 2:54534861-54534883 GAGGTGCAGGAATAGGGGCTGGG - Intronic
932047260 2:68362304-68362326 CAGGCGCCTGAATAGGTGCAGGG - Intergenic
932455825 2:71849364-71849386 TAGGGGCCTGAAGAGCTGTTAGG + Intergenic
934759307 2:96844676-96844698 TAGGGGCTTGTAGAGGGGCGGGG - Intronic
935783733 2:106530639-106530661 AAAGTGCTTGAATAGGGGCTAGG + Intergenic
937364292 2:121249513-121249535 GAGGGGCTTGATTAGGGTCTGGG - Intronic
938304231 2:130240128-130240150 TAGGGGCCTTAAAAAGTGCTGGG - Intergenic
938452455 2:131434162-131434184 TAGGGGCCTTAAAAAGTGCTGGG + Intergenic
938994334 2:136661421-136661443 TATGTGCCTGAACAGGGGCAAGG + Intergenic
940160019 2:150701769-150701791 TAGGGGCCTGATTAGCTGATGGG - Intergenic
941229820 2:162897920-162897942 TGTGGGCCTGGATGGGGGCTGGG - Intergenic
941766450 2:169302404-169302426 TAGGGGACTGAACAGGTGCAAGG - Intronic
946311927 2:218886759-218886781 TGGGGCCCTGAACAGGAGCTGGG + Intronic
948797348 2:240411847-240411869 ATGGGGACTGAATGGGGGCTGGG - Intergenic
1169550860 20:6699947-6699969 TAGGAGTCTGGATAGGGGTTTGG - Intergenic
1175125545 20:56748726-56748748 GAGAGGGCTGAAGAGGGGCTGGG + Intergenic
1175889281 20:62309301-62309323 CAGGGGCCTGACCAGGGGCCGGG + Exonic
1175900177 20:62356948-62356970 GAGGGGACTGAGTAGGTGCTAGG + Intronic
1176038212 20:63050526-63050548 TGGGGGACTGTATAGGGCCTGGG - Intergenic
1181022907 22:20112877-20112899 CAGGGGCCTGGGTGGGGGCTAGG - Intronic
1181024816 22:20122129-20122151 TTGGAGCCTGAAGAAGGGCTGGG + Intronic
1183433282 22:37778898-37778920 TAGGGGACTAAAGAGGAGCTGGG - Intergenic
1184353647 22:43963141-43963163 TAGGGGCAGGAATAGGGACCAGG - Intronic
950477082 3:13221297-13221319 GAGGGGCCTGCAGAGGGGCGTGG - Intergenic
950893021 3:16421905-16421927 GAGGGGCCTGCAGAAGGGCTGGG - Intronic
952369331 3:32705377-32705399 TTGGGGCTTGAATTGGGGATTGG + Intronic
953881761 3:46694540-46694562 TAGGGGGCTGAGTAGGGGGCTGG - Intergenic
971303817 4:25463327-25463349 TAGGGGCTTTTCTAGGGGCTCGG + Intergenic
974225587 4:59038914-59038936 TAGTAACCTGATTAGGGGCTGGG + Intergenic
980264947 4:130503267-130503289 TAGGGGACTGATTTGGGGCAGGG + Intergenic
982292325 4:153791779-153791801 TAGGTCCCTGGAGAGGGGCTTGG + Intergenic
982415527 4:155127378-155127400 AAGGGGGATGAAGAGGGGCTGGG - Intergenic
984441622 4:179778132-179778154 TAGGAGCTTGAATAGGAGCTGGG + Intergenic
985965293 5:3335158-3335180 GTGGGGCCTGAAGAGAGGCTGGG + Intergenic
986098184 5:4580733-4580755 GAGTGTCCTGAATAGGGGGTCGG + Intergenic
989228286 5:39055853-39055875 TAAGGGCCTGAATAAAGGCATGG + Intronic
1000362512 5:160461117-160461139 TATTGGCCTGAATTGGGTCTTGG + Intergenic
1007833838 6:44659176-44659198 TAGGGTCCAAAATGGGGGCTGGG - Intergenic
1007909225 6:45496647-45496669 TGGGGGCCACAATAGTGGCTTGG + Intronic
1017254052 6:152313382-152313404 TAGGGGCCTGAATAGGGGCTGGG - Intronic
1017913112 6:158812187-158812209 TTGGGACTCGAATAGGGGCTAGG - Intronic
1018225290 6:161622397-161622419 TAGGGGCCTGGGGAGGGGCAGGG - Intronic
1018980987 6:168601628-168601650 CAGGGGCCTCACTGGGGGCTGGG - Intronic
1019328906 7:453103-453125 TGAGGACCTGAAGAGGGGCTGGG + Intergenic
1019423573 7:962946-962968 TGGGGGCTGCAATAGGGGCTGGG - Intronic
1024148660 7:46544030-46544052 TAGCTGGCGGAATAGGGGCTGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1032503138 7:132414973-132414995 TAGGGGCCTGTGTAGGGCCAAGG - Intronic
1041097553 8:54364601-54364623 TAAGGGCATGACTAGGGGCAAGG - Intergenic
1042734202 8:71969406-71969428 TAGGGACCTGGAGAGGGGATTGG - Intronic
1042877355 8:73451430-73451452 TTGGGGCCAGAAAAGCGGCTGGG + Intronic
1045383870 8:101652650-101652672 TAGGGGTCGGCATATGGGCTTGG + Intronic
1049477976 8:142805709-142805731 TTGGGGCCTGAAAAGGGGCCAGG - Intergenic
1052074272 9:24121393-24121415 GAGAGGCATGAATAGAGGCTGGG - Intergenic
1057144561 9:92749284-92749306 GATGGGCCTGCAGAGGGGCTTGG - Intronic
1061683858 9:132259124-132259146 CAGGGGTCTGAAGAGGGGCAGGG + Intergenic
1062690345 9:137838178-137838200 GAGGGGGCTGAATAGGGCCCTGG + Intronic
1185679987 X:1880629-1880651 TAGGGTCCAGGAAAGGGGCTGGG + Intergenic
1187134875 X:16538347-16538369 CAGGTGTCTGAATAGGGGCAAGG - Intergenic
1189389450 X:40563835-40563857 TTGGGGCTTGGACAGGGGCTGGG - Intergenic
1193886249 X:86986233-86986255 TAGGAGCCTGAAAAAGTGCTTGG - Intergenic
1195388022 X:104331870-104331892 TAGGGCCCTTAATATGGGTTAGG - Intergenic
1195430101 X:104779496-104779518 TAGGGGTTTGAATAGTGCCTAGG + Intronic
1200814103 Y:7513876-7513898 TAGGGGCCTGTTTTGGGGTTGGG + Intergenic