ID: 1017254056

View in Genome Browser
Species Human (GRCh38)
Location 6:152313389-152313411
Sequence GACTTCGTAGGGGCCTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017254056_1017254061 19 Left 1017254056 6:152313389-152313411 CCTATTCAGGCCCCTACGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017254056 Original CRISPR GACTTCGTAGGGGCCTGAAT AGG (reversed) Intronic
919820982 1:201471842-201471864 GTCTTCCTGGAGGCCTGAATGGG + Intergenic
1062902031 10:1153858-1153880 GACATCGTAGGGGCCTGGGGTGG + Intergenic
1066826356 10:39584696-39584718 GACTTCTTTGAGGCCTTAATTGG + Intergenic
1066868635 10:40463410-40463432 GACTTCTTTGAGGCCTTAATTGG + Intergenic
1066922184 10:41518862-41518884 GACTTCTTTGAGGCCTTAATTGG + Intergenic
1078815939 11:14822757-14822779 TACTTCTTAGGGGTCTGTATGGG - Intronic
1085439521 11:76545932-76545954 GTCTTCTCAGAGGCCTGAATGGG - Exonic
1101330187 12:103751216-103751238 GACTTCCTGGAGGCTTGAATTGG + Intronic
1102015277 12:109644280-109644302 GACTTTGTGGGGGTTTGAATAGG - Intergenic
1109496510 13:63178741-63178763 GATTTGGCAGGGGCCAGAATTGG + Intergenic
1110596885 13:77329193-77329215 GGCTCCGTAGGGGCCTGTCTGGG - Intergenic
1114267480 14:21081499-21081521 GACTTCGTAGGCACATGAATGGG + Exonic
1114577098 14:23725454-23725476 GGCTTGGTATGGGACTGAATTGG - Intergenic
1122630388 14:103104903-103104925 GTCTGCGTAGGGACCTGATTGGG + Intronic
1129355255 15:74986544-74986566 GCCTTAGGAGGGGCCTGAGTAGG + Intronic
1135268979 16:21052806-21052828 GATATCCTAGGGGCCTGAAATGG - Intronic
1143129297 17:4666148-4666170 CAATTGGTAGGGGCCAGAATGGG - Intergenic
1143390598 17:6557006-6557028 GACTTCGTGGGGGCCTCCCTTGG - Intergenic
1144153742 17:12477598-12477620 GACTTTGTAGCGGCCTAAATGGG - Intergenic
1160196053 18:76756548-76756570 GACTCCTTAGGGGCCTGAGGTGG + Intergenic
927551362 2:24002932-24002954 GACTTCACAGTGCCCTGAATGGG + Exonic
946683904 2:222247166-222247188 TACTTCATTGAGGCCTGAATAGG - Intronic
1171100782 20:22381921-22381943 GGCTGGATAGGGGCCTGAATAGG - Intergenic
1173320220 20:41981019-41981041 GAGTTGATAGGGGCCTGAACTGG + Intergenic
1177558491 21:22720441-22720463 GAATTCCTAAGGGCCTGATTGGG + Intergenic
1183915766 22:41117519-41117541 GACTGCGTAGGACCCTGATTTGG - Exonic
950499749 3:13356085-13356107 GACTGATTAGGGGCTTGAATGGG - Intronic
953430477 3:42835678-42835700 GACTTCGTAGTGGCCACAGTGGG - Intronic
953906057 3:46868749-46868771 GACTTCTCAGGGGCCTGGACTGG + Intronic
972427452 4:38947242-38947264 TACAAGGTAGGGGCCTGAATAGG + Intergenic
974736383 4:65938745-65938767 GACTTCGTAGCCTCCAGAATTGG + Intergenic
975458587 4:74623525-74623547 GACTGCGTAGGGGACTGGACAGG + Intergenic
988198004 5:28031406-28031428 GACTTCTTATGGGTCTGATTAGG - Intergenic
1001493161 5:172169561-172169583 GAGTTGGCAGGGGCATGAATGGG + Intronic
1016848014 6:148588107-148588129 GACATTGTAGGGTTCTGAATTGG - Intergenic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1017372096 6:153723028-153723050 ACCTTGGTAGGGGCCAGAATTGG + Intergenic
1022201547 7:28122325-28122347 GACATGGTAGGAGCCTGGATTGG - Intronic
1023877087 7:44292609-44292631 GACTTCTCAGGGCCTTGAATGGG + Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1033864487 7:145672255-145672277 GACTGCTCAGGGGCCAGAATAGG + Intergenic
1051179710 9:14397618-14397640 GACTTCATATGGTCTTGAATAGG - Intronic
1186653722 X:11590105-11590127 GATTTCTTATGGTCCTGAATCGG + Intronic
1191091039 X:56621878-56621900 GCCTTTGTTGGGGCTTGAATTGG + Intergenic
1199723251 X:150558435-150558457 TACTTCCTAGGGGCCTGACAGGG + Intergenic
1200277530 X:154748873-154748895 CACTTCGACGGGGCCTGGATAGG - Intronic