ID: 1017254061

View in Genome Browser
Species Human (GRCh38)
Location 6:152313431-152313453
Sequence TGACATTAGAAAAAACACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 606}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017254059_1017254061 8 Left 1017254059 6:152313400-152313422 CCCTACGAAGTCACTCTGGTTCT 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254055_1017254061 20 Left 1017254055 6:152313388-152313410 CCCTATTCAGGCCCCTACGAAGT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254054_1017254061 21 Left 1017254054 6:152313387-152313409 CCCCTATTCAGGCCCCTACGAAG 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254060_1017254061 7 Left 1017254060 6:152313401-152313423 CCTACGAAGTCACTCTGGTTCTC 0: 1
1: 0
2: 1
3: 2
4: 116
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254058_1017254061 9 Left 1017254058 6:152313399-152313421 CCCCTACGAAGTCACTCTGGTTC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254052_1017254061 26 Left 1017254052 6:152313382-152313404 CCCAGCCCCTATTCAGGCCCCTA 0: 1
1: 0
2: 1
3: 6
4: 140
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254053_1017254061 25 Left 1017254053 6:152313383-152313405 CCAGCCCCTATTCAGGCCCCTAC 0: 1
1: 0
2: 2
3: 14
4: 207
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606
1017254056_1017254061 19 Left 1017254056 6:152313389-152313411 CCTATTCAGGCCCCTACGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG 0: 1
1: 0
2: 1
3: 52
4: 606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017254061 Original CRISPR TGACATTAGAAAAAACACAA TGG Intronic
900357677 1:2272569-2272591 TGACTTTAGAAAAATAATAATGG + Intronic
901478298 1:9505907-9505929 TGTCCTTATAAAAAACAGAAGGG - Intergenic
901736490 1:11315714-11315736 AGACATGAGAAAAAACAAGAGGG + Intergenic
904460525 1:30676468-30676490 TGAAATCAGGAACAACACAAGGG + Intergenic
906909597 1:49933817-49933839 GAACATCAGCAAAAACACAAAGG + Intronic
907063552 1:51456033-51456055 TTACATTTGAAAAGAAACAAGGG + Intronic
907836782 1:58116926-58116948 TGACTTTATAAAGAACACAAAGG + Intronic
908060505 1:60343102-60343124 TGAAATTAGGAACAAGACAACGG + Intergenic
908506053 1:64801519-64801541 TGACTTTAAAAAAAAAAAAAAGG - Intronic
908684961 1:66706548-66706570 TGACAAAAGAAAAAAGAAAAAGG + Intronic
909304798 1:74060545-74060567 TGACATTAGAAAATATAGATAGG - Intronic
909463196 1:75942869-75942891 TGAAATAAAAGAAAACACAATGG - Intergenic
909881219 1:80881041-80881063 TGACATTATAAAACATAAAAAGG - Intergenic
910627059 1:89318045-89318067 TAAGATTAGAAAAAAAAGAATGG + Intergenic
910886056 1:91964635-91964657 TACCATTATAAAAAACCCAATGG + Exonic
911143813 1:94533505-94533527 TCACATTAGAAAAAGTAAAAAGG + Intronic
911461562 1:98197616-98197638 TTTCATTAGGAAAAAAACAATGG - Intergenic
911493498 1:98599412-98599434 TGACAATACAAAAGACAGAAAGG + Intergenic
911766533 1:101682951-101682973 TGACAATAGAAAGCACACAATGG + Intergenic
911832465 1:102570272-102570294 TGACATCTGAAGGAACACAAAGG + Intergenic
911994233 1:104743538-104743560 TGACATTCGAAACAACTAAATGG - Intergenic
912476460 1:109940011-109940033 TGAGAATAGAAAATACACATGGG + Intergenic
912735716 1:112147721-112147743 TGAGAATAAAAAGAACACAATGG - Intergenic
912897036 1:113603145-113603167 AGACATTACAACAAACACCACGG + Intronic
912940571 1:114041109-114041131 TGAATTTAGACAAAGCACAATGG - Intergenic
913341472 1:117761750-117761772 AGACATTAGAACTAATACAAAGG - Intergenic
913398765 1:118404536-118404558 TAACAATAGAAAAAAGATAATGG + Intergenic
915317353 1:155036591-155036613 TGACATCAGAAGAACCAGAAAGG - Intronic
916424929 1:164671181-164671203 TGACTTTAAAAAAAAAAAAAGGG - Intronic
916911612 1:169354230-169354252 TGTCATTTGCAAAAACATAATGG + Intronic
918072686 1:181144697-181144719 TTATATTAGAAAATAAACAAAGG + Intergenic
918317249 1:183332289-183332311 TGAGATCAGAGAACACACAAAGG - Intronic
918454035 1:184688637-184688659 TGACATTAGAAAATGTAAAAAGG + Intergenic
918823094 1:189285022-189285044 TAACATCAGAAAAATCCCAATGG - Intergenic
918986943 1:191643293-191643315 ACATATTGGAAAAAACACAAAGG - Intergenic
919521881 1:198599273-198599295 TGACATTTGAATAAATACCAGGG - Intergenic
920294535 1:204947665-204947687 TGACCTTTGAAAAAAGCCAAGGG + Intronic
920948327 1:210550335-210550357 GTACAGTAGAAAAAGCACAATGG + Intronic
921435059 1:215108963-215108985 TTACATTTCAAAAAACAAAATGG - Intronic
921515069 1:216080618-216080640 AGACAAAAGAAAAAACACTAAGG + Intronic
921531729 1:216291144-216291166 TGACCTTAGATAAAAGCCAAAGG + Intronic
921649518 1:217659977-217659999 TGACATTAGATAAGAAGCAATGG - Intronic
921808465 1:219482466-219482488 CTTCATTAGAAAAAACACATCGG - Intergenic
921885842 1:220304518-220304540 GGACATTATAGATAACACAACGG - Intergenic
922915740 1:229256196-229256218 TGACAAGAGAAAAAATACATTGG + Intergenic
923702544 1:236314010-236314032 TGACATTAAAAAAAAAAACATGG + Intergenic
923797709 1:237174329-237174351 TGACATTAGTAAGAACAGACTGG - Intronic
923846489 1:237738773-237738795 TCACATTAGCAAAAACACAGAGG - Intronic
924011567 1:239670972-239670994 CTACTTTAGAAAACACACAATGG - Intronic
924600439 1:245483941-245483963 AGACATAAGGAAAAACATAAAGG - Intronic
1064465738 10:15579044-15579066 TTACATCAGAATAAACACCATGG + Intronic
1064600862 10:16991059-16991081 TTACATTAAAAAAAATACAATGG + Intronic
1064843009 10:19616650-19616672 AGTCATTACAAAACACACAAAGG + Intronic
1065096775 10:22288485-22288507 AGAAATTATAAAAAACACATTGG - Intergenic
1065244156 10:23740772-23740794 TGAGATTAAAAAAAAAAAAATGG + Intronic
1065395725 10:25235425-25235447 TGCCATTAAAAAAAAAAAAAAGG - Intronic
1066211783 10:33247353-33247375 GGACATGAAAAATAACACAATGG - Intronic
1067780605 10:49202600-49202622 TCACATTGGAAAATATACAAAGG - Intergenic
1068641660 10:59414496-59414518 AGTCATTATAAAAAACAGAATGG - Intergenic
1068951417 10:62781365-62781387 AGACAATAGAAAAGAAACAAGGG - Intergenic
1070296256 10:75163859-75163881 TGAAAATAGAAAAAAAACCAGGG + Intronic
1070370108 10:75774268-75774290 TGACATTAAGAGAAACAAAAAGG - Intronic
1071410975 10:85394936-85394958 TGACATGAGAAAGCAGACAAAGG - Intergenic
1071706315 10:88003138-88003160 TGAAATTATAAAAGACACAGTGG + Intergenic
1071994058 10:91129611-91129633 TCACATAAGAATAAACAGAAAGG - Intergenic
1072970937 10:100016825-100016847 TGACATTAAAAAAAAATCATTGG + Intergenic
1073318327 10:102598469-102598491 TGCCATTAGAACAAACAGGAAGG - Intronic
1073679234 10:105684097-105684119 TGAAATTAGAGAAAATAAAAGGG - Intergenic
1073707157 10:105998079-105998101 AGACATTACAAAAAACAGTATGG - Intergenic
1075193706 10:120335618-120335640 TAACATTAGAAAATAAAAAATGG - Intergenic
1075819464 10:125293699-125293721 TTACATTTGATAAAACACGAAGG + Intergenic
1075979722 10:126726589-126726611 TGAGATTAGAAACAAGATAAAGG + Intergenic
1077761837 11:5109447-5109469 TGCCATTATGAAAAACAAAATGG + Intergenic
1079042777 11:17074135-17074157 TGACACCAAAACAAACACAAAGG + Intergenic
1079115722 11:17639407-17639429 TCACATTCTGAAAAACACAAGGG - Exonic
1079373999 11:19875789-19875811 TAACATTAGAGAAAACTCAATGG - Intronic
1079744560 11:24108042-24108064 TGACAGTAACAAAAACACTATGG + Intergenic
1080998483 11:37636171-37636193 AGCCATTATAAAAAACAGAATGG - Intergenic
1081212843 11:40357347-40357369 TCACATTAGGAGATACACAAGGG + Intronic
1081280215 11:41200663-41200685 TGACGGTAGAGAAAACACAGTGG - Intronic
1081417414 11:42832621-42832643 TGACTTTAGAAAAAAGAAAAAGG + Intergenic
1081728468 11:45350978-45351000 TGAGAATAGAAAATACAAAATGG - Intergenic
1082103604 11:48195600-48195622 AAACATTAAAAAAAAAACAAAGG + Intergenic
1082229797 11:49749534-49749556 TGACATTATAAAAGAAAGAAAGG + Intergenic
1082815167 11:57503071-57503093 TGACATAAGGAAGAACACAAAGG + Intronic
1082822490 11:57553491-57553513 TCTCAGTAGAAAAAACAAAAAGG + Intronic
1083072665 11:60002626-60002648 AGCCATTATAAAAAACACTATGG + Intergenic
1084837792 11:71816492-71816514 TGACATGAGAGAACACACACTGG - Intergenic
1085121754 11:73971847-73971869 TGTCATTAAAAAAATCACCATGG + Intergenic
1086221463 11:84449773-84449795 TGCCATCCGAATAAACACAAGGG + Intronic
1086310069 11:85525652-85525674 AGGCATTGGAAAAAGCACAAAGG + Intronic
1086620278 11:88879591-88879613 TGACATTATAAAATAAAGAAAGG - Intronic
1087124721 11:94613651-94613673 GGTCATTTGAAAATACACAAAGG - Intronic
1087291886 11:96329080-96329102 AAACATTAAAAAAAACAAAAAGG - Intronic
1087465852 11:98504247-98504269 TGCTATTATCAAAAACACAAAGG - Intergenic
1087479673 11:98683360-98683382 GTACATTAGAATAAATACAATGG - Intergenic
1087702178 11:101447722-101447744 GGACATTAGAAAAAGAAGAAAGG + Intergenic
1087737277 11:101849237-101849259 TGACCTTAGAAATGACACATGGG + Intronic
1088099533 11:106140532-106140554 ATACATTAGAAAAAACTAAATGG - Intergenic
1088517788 11:110657411-110657433 TTACATTAAAAAAAACATAATGG + Intronic
1088739387 11:112754535-112754557 TCACATTAGAAAAAACTTACAGG - Intergenic
1088941214 11:114458503-114458525 AGACATTTTAAAACACACAAAGG + Intergenic
1089188922 11:116640386-116640408 TGTCATTTGCAACAACACAATGG - Intergenic
1090430409 11:126641482-126641504 TGACATTAGCAACAACAGGAAGG + Intronic
1090439747 11:126715678-126715700 TGAGATTAGAAATAAAAGAAGGG + Intronic
1090467218 11:126945217-126945239 TGCCATTACAAAAATCACATTGG - Intronic
1090887104 11:130887296-130887318 TGAGATTGGAAAAACCACTAAGG - Intronic
1090999733 11:131899516-131899538 TGACATTAGAAAGGTCACACTGG + Intronic
1091868901 12:3870392-3870414 TGAAATTAGCAAAATCACACAGG + Intronic
1092560004 12:9602726-9602748 TAATATTAGAAAAAATAAAAAGG - Intronic
1092573534 12:9752483-9752505 TAAAAGTAGAATAAACACAATGG - Exonic
1092671907 12:10872449-10872471 TTATATTAGGAAAAACACACTGG + Intronic
1092812394 12:12283994-12284016 TGTCTCTAAAAAAAACACAAAGG + Intergenic
1092898846 12:13039728-13039750 TGTCCTTTGATAAAACACAAGGG - Intergenic
1093322739 12:17734306-17734328 TGACACTAAAAAAAAACCAAAGG - Intergenic
1093346585 12:18043878-18043900 TGACAGTAAAAAAAATAGAATGG + Intergenic
1093369612 12:18352033-18352055 TGACAATAAAAATAAAACAAAGG - Intronic
1093631132 12:21411017-21411039 TGAAATTACAAATAACACAGTGG - Intronic
1093799307 12:23352788-23352810 TGAGATTAGAAAAAATATTACGG - Intergenic
1095181545 12:39152738-39152760 GGCCATTAGAAAATACACAGAGG - Intergenic
1095199329 12:39364109-39364131 TGACAGTAGGAAAAACAGCAGGG - Intronic
1095838129 12:46661196-46661218 GGAAATTAGAAAAAACACCAAGG + Intergenic
1096447685 12:51708773-51708795 TGACAGTATATAAAATACAAAGG - Intronic
1096942986 12:55368845-55368867 TGCCATTCCATAAAACACAATGG - Intergenic
1097018245 12:56002319-56002341 TGACATTGTAAAAGACACTAAGG - Intronic
1097699675 12:62807307-62807329 TGAGATTAGAAAAGAAATAAGGG + Intronic
1097805969 12:63965502-63965524 TTACATTAAAAAAAATACAGTGG + Intronic
1098097909 12:66979751-66979773 TGACATACGAAAAGACACACAGG + Intergenic
1098705378 12:73682286-73682308 AGACAATACAACAAACACAATGG + Intergenic
1099238096 12:80106014-80106036 TGACATCACTAAAAACAAAAAGG + Intergenic
1099321063 12:81149440-81149462 TGAAAGTATAAAAAACACGAAGG - Intronic
1099450007 12:82797154-82797176 TGCCATTTTAAAAAACATAATGG + Intronic
1100114874 12:91292345-91292367 AGAAATTAGAGACAACACAAAGG - Intergenic
1101072725 12:101093428-101093450 TGAAAGTAGTAAAAACACACTGG - Intronic
1101536597 12:105623571-105623593 TGAGACTAAAATAAACACAAAGG + Intergenic
1101620757 12:106385470-106385492 CAAAATTAGAAAAAAAACAAAGG + Intronic
1101787666 12:107899529-107899551 TGCAACTAGAAAAAACAAAATGG - Intergenic
1102072545 12:110033704-110033726 GTACATTAGAAAAAAAAGAAAGG - Intronic
1102588128 12:113937398-113937420 TCTGATTGGAAAAAACACAAAGG - Intronic
1102665106 12:114565058-114565080 TGACTGTGGAAAAAACAGAAAGG - Intergenic
1102800930 12:115733068-115733090 TTACTCTAGAACAAACACAATGG + Intergenic
1103077366 12:117995244-117995266 TGAAATTACAAAGCACACAAGGG - Intergenic
1106174283 13:27316223-27316245 AGACATTTAAAAAATCACAAGGG - Intergenic
1106637110 13:31540890-31540912 TGACATTAACAAAGTCACAAAGG - Intergenic
1106711406 13:32338759-32338781 TGACATAAGAAAGAACAAAATGG + Exonic
1106839379 13:33670222-33670244 TGACATTATTAGAAACACAGAGG - Intergenic
1107012197 13:35680280-35680302 TAACCTCAGAATAAACACAATGG - Intergenic
1108462593 13:50681996-50682018 TGAAATTAGAAAAAAAATCATGG - Intronic
1109382540 13:61583521-61583543 TTATATTAGAAAAAAAAGAAAGG + Intergenic
1109579305 13:64305054-64305076 TTACATTAGAAAAAAAATACAGG + Intergenic
1109703770 13:66061945-66061967 TGACATCAGAAATAAGTCAAGGG - Intergenic
1109776973 13:67053444-67053466 AAACAGTATAAAAAACACAAAGG + Intronic
1109820255 13:67643635-67643657 CCACATAATAAAAAACACAATGG - Intergenic
1109927517 13:69164399-69164421 AGACATTAACAAAATCACAAGGG - Intergenic
1110014133 13:70378811-70378833 GGAAATTAGAAAACACAAAATGG + Intergenic
1110121332 13:71885476-71885498 TGAAAATAGAAGAAACACACTGG - Intergenic
1110462284 13:75758190-75758212 TGAAATTAGCAAAAATAAAAGGG - Intronic
1110505820 13:76284876-76284898 TGGAATTAAAAAAAAAACAATGG + Intergenic
1110602676 13:77393983-77394005 TGACAATAAAAAGAAGACAATGG - Intergenic
1110964347 13:81673948-81673970 GTATATTAGAAACAACACAAAGG - Intergenic
1111445535 13:88342477-88342499 TAACATTAGAGGAAAAACAATGG + Intergenic
1111564808 13:90000680-90000702 TGATATTAGAATCAAAACAAAGG - Intergenic
1111663179 13:91236218-91236240 TGACATGAAAAAAAAAAAAAAGG - Intergenic
1111892584 13:94102501-94102523 TGAAATTAAAAAAAAAAAAAGGG - Intronic
1112188328 13:97149782-97149804 TGCCATTAGAAAAAACTGTAGGG - Intergenic
1112196678 13:97233424-97233446 GGACATTAGAAAAGAGACCATGG - Intronic
1112538904 13:100286746-100286768 AGACATTAAAAAAAAAAAAAAGG - Intronic
1112607952 13:100926556-100926578 CGGCACCAGAAAAAACACAAAGG - Intergenic
1112655052 13:101443302-101443324 TGGAATTAGAAAAAAAAAAAAGG - Intergenic
1113609612 13:111634512-111634534 TGAAATTAGAATATACAGAAAGG + Intronic
1113659296 13:112094368-112094390 TGACATTGGCAAAAACCCAAGGG - Intergenic
1113801623 13:113089583-113089605 TGACATCAGACAAATCAAAAAGG - Intronic
1114375045 14:22136403-22136425 TTACATTAGAAAAAGAAAAAAGG + Intergenic
1114393504 14:22335748-22335770 ATACATTAAAAAAAAAACAATGG - Intergenic
1114586089 14:23815312-23815334 TCAAATTAGAAACCACACAAAGG + Intergenic
1114854112 14:26416798-26416820 TGAAATATGAAAACACACAAAGG - Intergenic
1114893518 14:26956316-26956338 TGAGATGAGAACAGACACAAAGG - Intergenic
1115089342 14:29555197-29555219 ATAGATTAGAGAAAACACAAGGG + Intergenic
1115268366 14:31525422-31525444 GGACATAAGAAAATTCACAAGGG - Intronic
1115352660 14:32411965-32411987 TGGCTTTAAAAAAAACACATTGG + Intronic
1115534003 14:34355538-34355560 AGACCATAGAAAAAACAGAAAGG + Intronic
1115926191 14:38438071-38438093 TGACTTTATATAAAAAACAATGG - Intergenic
1115948381 14:38691629-38691651 TGGCATGAGGAAAAACACATAGG + Intergenic
1116153631 14:41174749-41174771 TATCATTAGAAACAACACAGCGG + Intergenic
1117497930 14:56324109-56324131 AGAGAGTAGAAAAAACAAAAGGG + Intergenic
1117877919 14:60275068-60275090 TGACCTTAAAAAAAAAAAAAAGG - Intronic
1117996172 14:61480146-61480168 GGACTTTAGAAAAACCAAAATGG + Intronic
1118125061 14:62892705-62892727 TGACAATTGCAAAAACCCAAAGG + Intronic
1118179087 14:63473074-63473096 TTACATTAGATATAACAGAAAGG + Intronic
1118260351 14:64240704-64240726 TGAAAAACGAAAAAACACAATGG - Intronic
1118556458 14:67028439-67028461 AGACATTATAAAAAACACTATGG - Intronic
1118927750 14:70208420-70208442 TGTCATGAAAAAGAACACAAAGG + Intergenic
1120419229 14:84261520-84261542 TGTGATTATAAAAAACATAATGG + Intergenic
1120727262 14:87958884-87958906 TAAAACTAGAAAAAAAACAAAGG + Intronic
1120783686 14:88510582-88510604 TGACAGTCCACAAAACACAATGG + Intronic
1120938586 14:89922765-89922787 TGACACTGGAAATAACACATGGG + Intronic
1122328886 14:100899705-100899727 TGATATTAAAAAAAAAAAAAAGG + Intergenic
1124498342 15:30202411-30202433 TGAAATGAGAACAAACCCAAGGG - Intergenic
1124745241 15:32336263-32336285 TGAAATGAGAACAAACCCAAGGG + Intergenic
1125085992 15:35729954-35729976 TGGCGTTAGAACTAACACAAGGG + Intergenic
1125175780 15:36820033-36820055 TGATCTTTGAAAAAACAAAAAGG + Intergenic
1126222676 15:46232466-46232488 TAACACTGGAAAAAACACGAAGG - Intergenic
1126418829 15:48449716-48449738 TGACAGTAGGAAAATCAGAATGG - Intronic
1127180858 15:56415882-56415904 AGAAATCAGAGAAAACACAACGG - Intronic
1127241326 15:57118160-57118182 TGTGCTTAGAAAGAACACAATGG - Intronic
1127370603 15:58335321-58335343 TGATTTTAGCAAAAACATAAAGG + Intronic
1127668880 15:61175351-61175373 TGAGATTTTACAAAACACAAGGG + Intronic
1128275718 15:66352059-66352081 TAACATTAGAAGAAAAACAATGG + Intronic
1128836946 15:70816727-70816749 TGGCATCAGAGAAAAGACAAAGG - Intergenic
1129837103 15:78715743-78715765 CTAGATTAGAAAAAACAAAAAGG + Intronic
1130074394 15:80676144-80676166 AGAAAATAGAAAAAACACATTGG + Intergenic
1131105452 15:89730984-89731006 TAACATTAAAAAATTCACAAAGG + Intronic
1131353483 15:91722966-91722988 TGAGAGTAGTAAAAACACACAGG - Intergenic
1133422879 16:5662215-5662237 TTACATTAGAAGACACTCAAAGG - Intergenic
1134754284 16:16652395-16652417 TGATATTAAAAAAAAGACAAGGG + Intergenic
1134776367 16:16857138-16857160 TGACATTGGACCAAACAAAAGGG - Intergenic
1134851057 16:17479401-17479423 TAAGAATAGAAAAAAAACAATGG - Intergenic
1136139399 16:28278923-28278945 TGACATTAGAAAGGAAAAAAGGG + Intergenic
1137727028 16:50663832-50663854 TGAAATTAAAAAAAGCAGAAAGG - Intergenic
1137822211 16:51457022-51457044 TGCCCTTAAAAAAAACACAATGG + Intergenic
1137852570 16:51761437-51761459 TGACATGAGTAAAAACACTGGGG - Intergenic
1137965153 16:52924685-52924707 TGACATTATGGAAAACACTATGG - Intergenic
1138081065 16:54091973-54091995 CAACATTAGAAAAAAGAAAAAGG + Intronic
1138338718 16:56273367-56273389 AGACATTAAAAAGAACAAAAGGG - Intronic
1138836137 16:60437365-60437387 TCCCATTAGAAAAAAGACTATGG + Intergenic
1138903299 16:61300386-61300408 TGACACAAGATAAAACAAAATGG - Intergenic
1139114243 16:63929968-63929990 GGACATTAAATAAAACAAAATGG + Intergenic
1141078272 16:81028545-81028567 TGAAATTAAAAAAAAAAAAAAGG - Intronic
1141450263 16:84094984-84095006 TCACATTAGATAAAACATGAAGG + Intronic
1142171810 16:88626691-88626713 TGACTTTTGAAAAAAAAAAATGG + Intronic
1142280013 16:89143103-89143125 GGAAATTAGAAATAACACACAGG + Intronic
1142305771 16:89284412-89284434 TGAAATTAGAAGAAAAAGAATGG - Exonic
1143643173 17:8211325-8211347 TGACACAAGAATAAACACACAGG - Intergenic
1143943628 17:10569678-10569700 GGACATAAGAAAAAAAAAAAGGG - Intergenic
1144098081 17:11919807-11919829 TGAAATTAGAAAAAAACGAAGGG + Intronic
1146040172 17:29445401-29445423 AAAGATTAGAAATAACACAAAGG - Intronic
1146243859 17:31260211-31260233 TGACATTAGACAAAGCAAAAAGG - Intronic
1147039074 17:37703349-37703371 GGAAATTAGAAAGAACAAAATGG + Intronic
1147510138 17:41061095-41061117 TGGCATTATGAAAAAGACAAGGG + Intergenic
1149265481 17:54923401-54923423 GGCCATTAAAAAAAACACAATGG - Intronic
1149516448 17:57284451-57284473 TGTCAAGAGAAAAAACACACAGG - Intronic
1150419779 17:65022395-65022417 TGACATTAAAAAAAAAAAAAAGG + Intronic
1150668249 17:67165554-67165576 TGAGATTAAAAAAGAAACAAAGG + Intronic
1150892246 17:69166331-69166353 TGAGATTACAAAAAAAAAAAAGG + Intronic
1150995949 17:70317850-70317872 AGATATTAAGAAAAACACAAGGG + Intergenic
1151019355 17:70596272-70596294 TGACCTCAGAAATAAAACAAAGG - Intergenic
1151466092 17:74286386-74286408 GGCCATTAGAAAAAACATGAAGG - Intronic
1151994693 17:77601193-77601215 TGACTTTGCAAAAAACACAGCGG - Intergenic
1152504503 17:80738983-80739005 TGAAATTAGAAACAAAAAAAAGG - Intronic
1152907860 17:82979056-82979078 CCACATTAGAAAAACCACAAAGG + Intronic
1153060986 18:994947-994969 TGACATTAGAAATAAAAGAGGGG + Intergenic
1153459441 18:5317509-5317531 TGACATTAGAAAAGACTTCATGG + Intergenic
1155276397 18:24192110-24192132 AGACATTTGAACACACACAAGGG + Intronic
1155698309 18:28711177-28711199 TGTCATTAGAGAAAACAAATTGG + Intergenic
1156750064 18:40441517-40441539 TCACATAAGAGAAAACCCAAAGG - Intergenic
1156753488 18:40491209-40491231 TGACATTTGAAAAGACACTGAGG + Intergenic
1156805972 18:41182466-41182488 TAAAATTATAAAAATCACAAGGG - Intergenic
1156870179 18:41936969-41936991 TGACATTGGGAAGAACAGAAAGG + Intergenic
1156924548 18:42559716-42559738 GGACATTAGAAAGCACACAGTGG - Intergenic
1157967302 18:52222729-52222751 TGACAGAAAAACAAACACAAGGG - Intergenic
1158445713 18:57518660-57518682 TGACAACAGAAAAAAATCAAAGG + Intergenic
1158466834 18:57698153-57698175 GGACATAAGCAAAAACAAAAGGG - Intronic
1158997658 18:62939637-62939659 TGACATTAAAAAAAAAAAAAAGG - Intronic
1159539602 18:69758396-69758418 TATCATTAGAAAAAGTACAAAGG - Intronic
1159684118 18:71395055-71395077 AGACAGAAGAAACAACACAATGG - Intergenic
1160359177 18:78256259-78256281 TGATATTAGATAATTCACAAAGG + Intergenic
1160382239 18:78468633-78468655 TCATATTAGAACAAAAACAAGGG + Intergenic
1161688325 19:5715259-5715281 TGACATTAATAAAAGCAGAATGG - Intronic
1162040913 19:7970581-7970603 TTAAATTCTAAAAAACACAAGGG - Intronic
1162998410 19:14350880-14350902 GGAAATTAGAAAAAGCAAAAGGG - Intergenic
1163641143 19:18462797-18462819 TGACTTTAGAAAAACAAAAATGG - Intronic
1163926386 19:20348435-20348457 TAAGATTAGAAAAAAGAAAACGG - Intergenic
1164130838 19:22360277-22360299 TTATCTTAGAAAAAACAAAAAGG - Intergenic
1165703983 19:37961940-37961962 AGAAATTAGAAAAAAAGCAATGG - Intronic
1166621250 19:44303353-44303375 TGTCATTTTAAGAAACACAAAGG + Intronic
1167726034 19:51213186-51213208 TGACATTGGCAAAAACCAAAAGG - Intergenic
1167819578 19:51914674-51914696 CTACATCAGAAAACACACAAAGG - Intronic
1167819588 19:51914842-51914864 TGACATCAGAAAACACATACAGG - Intronic
1168351131 19:55676318-55676340 TTACATTAAAAAGAATACAAAGG - Intronic
1168554633 19:57327643-57327665 TGGCATTATAGAAAAAACAAAGG - Intronic
925168990 2:1739460-1739482 TGACATATGAAAAAACACAGAGG + Intronic
925314031 2:2907735-2907757 TGAGATTGGAACAAACACTAAGG + Intergenic
925373797 2:3367101-3367123 TGAAATTAAAAAAAAAAAAAAGG + Intronic
926522461 2:13932290-13932312 TCACATTATGGAAAACACAAAGG + Intergenic
926877011 2:17492135-17492157 TGAGAGAAAAAAAAACACAATGG + Intergenic
927345943 2:22040268-22040290 TGAAATGAGAAAATACACAAAGG + Intergenic
927482070 2:23461974-23461996 TGTCATTAAAAAAAAAAAAATGG - Intronic
928456021 2:31422978-31423000 AGACAGTAGAAAAGACAGAATGG - Intergenic
928561793 2:32496177-32496199 TGATATTTGAAAAACTACAAAGG - Intronic
928669860 2:33591820-33591842 TCACATTAGGAGAAGCACAACGG + Intronic
930181563 2:48364418-48364440 TGGCATTAAAAAAACCCCAAAGG - Intronic
930384140 2:50671925-50671947 TGACAATAGAAGATACAGAAAGG - Intronic
930563575 2:52991603-52991625 TCAGATTACAAAAAACACAGTGG - Intergenic
930841756 2:55855120-55855142 GGTCATTAGAAATAACACCAAGG + Intergenic
930932855 2:56909680-56909702 AGACTTTAGAAAAACCAGAATGG + Intergenic
931100110 2:58989293-58989315 TAACATCATAAAAATCACAAGGG + Intergenic
932548329 2:72739335-72739357 TTACATAAGAAGAAATACAAAGG - Intronic
933037599 2:77420049-77420071 TGTCATTAGAATTAACCCAAGGG + Intronic
933173002 2:79144258-79144280 TTATAATAGAAAAAACGCAAGGG - Intergenic
933233184 2:79832871-79832893 CGAGAATAGTAAAAACACAATGG - Intronic
933420478 2:82039330-82039352 CAACATTATAAAAAACAAAAAGG + Intergenic
933492016 2:82997328-82997350 TATCAATAGGAAAAACACAATGG + Intergenic
933575357 2:84061008-84061030 TGACATTAGAAGAAGCAAAAGGG - Intergenic
935134101 2:100284247-100284269 TGACATTTATAAAAGCACAAGGG + Exonic
935526426 2:104173795-104173817 TGAATTTAGAAAAAACTCATTGG + Intergenic
935791079 2:106590803-106590825 TGTCATTTGAATAAACACACAGG + Intergenic
936265546 2:111003137-111003159 TGAAATCAGAAAATACACACAGG - Intronic
937713450 2:125004942-125004964 GATTATTAGAAAAAACACAATGG + Intergenic
937768273 2:125687231-125687253 TGACAATTGAAAAAACTCACAGG + Intergenic
938412802 2:131079174-131079196 TGTCCTTATAAAAAACACACAGG + Intronic
938600656 2:132835516-132835538 TGACATTAGAAATTACAAAATGG - Intronic
938673776 2:133610169-133610191 TACCATGAGAAAGAACACAATGG + Intergenic
938889738 2:135692208-135692230 TCACCTTAGAAAAAAAAAAATGG - Intronic
938911726 2:135891516-135891538 TGACAATACTAAGAACACAAAGG + Intergenic
939614680 2:144349080-144349102 TGATATTAGAAAAAGCCCAGAGG + Intergenic
939623955 2:144453570-144453592 TGAGATTTAGAAAAACACAAAGG + Intronic
939762711 2:146202503-146202525 TCACATTAAAAAAAAAAAAAAGG + Intergenic
939921433 2:148119123-148119145 TTACATTTCAAAAAACATAATGG + Intronic
940163270 2:150738230-150738252 TGAAAATAGAAACAACAAAATGG + Intergenic
940562728 2:155321851-155321873 TGAGAGTAGAAAATACAAAAAGG + Intergenic
940679017 2:156760754-156760776 TAACATTAGAAACAACTCACAGG + Intergenic
940685516 2:156845475-156845497 TGATTTTAGAAAGCACACAAAGG - Intergenic
940783405 2:157957536-157957558 TAAAATCAGAAAAAAGACAATGG - Intronic
941528085 2:166630863-166630885 TGGCATTAAAAAAAAGATAAAGG - Intergenic
941576913 2:167244158-167244180 AGACATTAGAAAAGATAAAAAGG + Exonic
942026532 2:171916239-171916261 TTACATTAAAAGAAAGACAATGG + Intronic
942553266 2:177143838-177143860 TGAAATTAAAAAAAAAAAAAAGG + Intergenic
942700944 2:178709795-178709817 AGACAGTAGAAGAAACAGAAGGG - Exonic
942969823 2:181944564-181944586 GGACTTTAGACAAAAGACAAGGG + Intergenic
943971725 2:194417468-194417490 TGGAATTAGAAAATACTCAATGG + Intergenic
944299737 2:198109754-198109776 TGAAATTAGAAAGAACCCAAGGG + Intronic
944425062 2:199572441-199572463 TTATTTTAGAAAAAAAACAAAGG + Intergenic
944485225 2:200198506-200198528 TGCCAAAAAAAAAAACACAATGG + Intergenic
945010639 2:205459390-205459412 TAACATTAAAAAAAAGATAAGGG - Intronic
945552073 2:211232784-211232806 TGAATTTAGAAATAACACTAAGG + Intergenic
945620881 2:212135561-212135583 TGAAAATAGGAAAAACAGAAAGG + Intronic
945660542 2:212680444-212680466 AGACAATGGAAAAAACACTAGGG + Intergenic
946679800 2:222201689-222201711 TGCCACTAGGTAAAACACAAGGG - Intronic
946696644 2:222366603-222366625 TGACATGCGAAAACACACATAGG - Intergenic
946703120 2:222432306-222432328 TGACAATAGAAGTATCACAAAGG - Intronic
947559529 2:231135671-231135693 TGACATTAGACAAATCACTTGGG - Intronic
947976762 2:234373372-234373394 TGACATTTGAGAAATCAGAAGGG - Intergenic
1169461193 20:5797154-5797176 TGAAATAAGGAAAAACAAAAGGG + Intronic
1169462002 20:5803568-5803590 TAACATTTAAAAAAAAACAAGGG + Intronic
1170209378 20:13833433-13833455 TGTCATTATAAATAACACCAGGG + Intergenic
1170901854 20:20471352-20471374 TGACATGACAAAAGTCACAATGG + Intronic
1172008451 20:31832839-31832861 AGACTTTAGAAAAAAAATAAGGG + Intronic
1172089618 20:32420039-32420061 TCACATTAAAAAAAAAAAAAAGG - Intronic
1172939567 20:38645148-38645170 TGCCCTTAGAAAAAAAAAAAAGG - Intronic
1173381488 20:42547685-42547707 TAATATTAAAGAAAACACAAAGG + Intronic
1174254013 20:49240728-49240750 AGCCATTAAAAAAAACAAAAAGG - Intronic
1174637804 20:52016978-52017000 TCACATTACAAAACACAAAAAGG - Intergenic
1174721376 20:52816605-52816627 TGTCCTTATAAAAGACACAAGGG - Intergenic
1175095363 20:56537152-56537174 TTAAATTAGAAAAAAAAAAAAGG + Intergenic
1177271984 21:18861041-18861063 TAACACTTTAAAAAACACAATGG + Intergenic
1177616586 21:23529772-23529794 TGGCTTTATAAAAAAGACAAAGG + Intergenic
1178427450 21:32490463-32490485 TGAGATTAGAAAGACCACAGTGG + Intronic
1178591881 21:33917721-33917743 GGTCATTAGAAGAAACAAAAAGG + Intergenic
1179227668 21:39469537-39469559 TGACATTAGAGAAGAAAAAAAGG - Intronic
1181857090 22:25789675-25789697 AGAAATCAGAAAAAACACAAGGG + Intronic
1182087021 22:27568399-27568421 TGACATTAGAAATAAAGAAATGG + Intergenic
1182656196 22:31892133-31892155 TGACCTATGAAGAAACACAATGG - Intronic
1183030494 22:35100348-35100370 TTACAATGGAAAAATCACAATGG + Intergenic
949192372 3:1265827-1265849 TGATATTTCAAAAAACACAAAGG - Intronic
950671200 3:14526575-14526597 CAACATTTGAAGAAACACAAGGG - Intronic
951901382 3:27660952-27660974 TTAAATTAGAAAAAAAAAAAAGG - Intergenic
952249537 3:31637985-31638007 TCTCATTAGAAAAATCCCAAAGG + Intergenic
952489737 3:33856370-33856392 TGACATGGGAAAGAGCACAAAGG + Intronic
953453375 3:43022152-43022174 GTACATTAGAGAAAACATAAGGG - Intronic
953627340 3:44581450-44581472 TGACATCAGATAAATCACACGGG + Intronic
954850896 3:53599483-53599505 TGACATTAAAAAAAACAAAAGGG + Intronic
955952216 3:64253815-64253837 TGACCTTGGAAAAAAATCAAAGG + Intronic
956070280 3:65442106-65442128 TGATATTAAAAGAAACCCAAAGG - Intronic
956397880 3:68845267-68845289 AAAGATTAAAAAAAACACAAGGG - Intronic
956554804 3:70508034-70508056 TGACGTTTGTAAAATCACAAAGG + Intergenic
957263781 3:77934301-77934323 CGACATTAAAAATAAGACAATGG + Intergenic
957438178 3:80206991-80207013 TGACATAAAAACAGACACAAAGG - Intergenic
957742851 3:84295521-84295543 GGAAATTAGAAAAAATATAAAGG + Intergenic
957784485 3:84864181-84864203 TAACAATGGAAAAAACACAAGGG + Intergenic
957901527 3:86500128-86500150 TGAAACTAGAAACAACACAGGGG + Intergenic
958439377 3:94137108-94137130 TCACATTAAAAAAAACACTCTGG - Intergenic
958469613 3:94500397-94500419 TGACATTAGAAAAATCCTGAAGG + Intergenic
958973503 3:100639393-100639415 TCAAAGTAGAAAAAGCACAAAGG + Intronic
959016519 3:101140323-101140345 TGACATTTACAAAAACACGAAGG - Intergenic
959436951 3:106327193-106327215 TGCCCTTAAAAGAAACACAAGGG + Intergenic
959932587 3:111999851-111999873 TCTCATTAGAAAAATCAAAAGGG - Intronic
960145862 3:114201410-114201432 TGAAATTAGAGAAAACAGAAAGG - Intergenic
960165979 3:114401782-114401804 TGATTTTTGAAAAATCACAAAGG + Intronic
960758000 3:121039389-121039411 TGATATTAACAATAACACAAAGG - Intronic
961062293 3:123840596-123840618 AGACATTATAAAAAAAACCATGG + Intronic
961154913 3:124671474-124671496 TGAAAATACAAAAAACAAAACGG - Intronic
962045506 3:131755707-131755729 TCCCATTACAAAACACACAAAGG - Intronic
962288815 3:134112276-134112298 TAACATCAGGAAAAAGACAAAGG + Intronic
962289825 3:134124578-134124600 TGAAATTGGAAAAAAAAAAAAGG + Intronic
963377050 3:144480781-144480803 TGACCTTAGGAAAACCCCAAAGG + Intergenic
963525927 3:146413269-146413291 GGAGATTAGTAAAAATACAAGGG - Intronic
963834172 3:150039389-150039411 TGACATTAAAAAAAAAAACAGGG + Intronic
963967322 3:151387198-151387220 TGACTCTAGAAAAAAAAAAACGG - Intronic
964544416 3:157817896-157817918 TGAATTTTGCAAAAACACAATGG - Intergenic
964544417 3:157817930-157817952 TGACATCAGATAAAGCAAAATGG + Intergenic
964599572 3:158482581-158482603 TGAGATTACAAATAAAACAAAGG - Intronic
964786926 3:160406932-160406954 TACGATTATAAAAAACACAATGG - Intronic
965072780 3:163937333-163937355 TGAGATTTATAAAAACACAAAGG + Intergenic
965290688 3:166874884-166874906 TAAGATTAGAAACAAGACAAGGG + Intergenic
966243461 3:177780070-177780092 TGACATTTTAAAAAATACAGGGG - Intergenic
966442849 3:179965649-179965671 GGACTCTAGGAAAAACACAAAGG - Intronic
966657915 3:182380426-182380448 TGACAATAGGAATAACAAAATGG - Intergenic
966953688 3:184850065-184850087 TTACTTTAAAATAAACACAAAGG - Intronic
967168795 3:186807616-186807638 GGACAGTATAAAAAACACACAGG + Intergenic
967366282 3:188689941-188689963 TGACCTTAGAAAATCCAGAATGG + Intronic
967573251 3:191057003-191057025 GGACATTAGAAAGAAAATAAAGG - Intergenic
967703040 3:192617264-192617286 AGTCATTGGAAAAAACATAATGG + Intronic
969642767 4:8409061-8409083 TGACAGTAGGAAAAACACTTTGG + Intronic
969684138 4:8660172-8660194 TAAAATTAGAAACAAGACAAGGG - Intergenic
969821643 4:9725282-9725304 TGCCATTAAAAAAAAGAAAAAGG - Intergenic
970133830 4:12900127-12900149 TGAGATTGAAAACAACACAATGG + Intergenic
970144326 4:13018435-13018457 GGACATTATCAAAAAGACAAGGG + Intergenic
970483521 4:16501812-16501834 TACAATTAGAAAACACACAAAGG + Exonic
970790497 4:19852669-19852691 TGACATTAGAAATATCACTGTGG - Intergenic
970817376 4:20173339-20173361 TGCCTTTAGTAAAAACACAGAGG + Intergenic
970902866 4:21179809-21179831 TGACATTTGAAAGGACACAAGGG - Intronic
971099607 4:23449785-23449807 TGAGATTAGAAAAGAAGCAAGGG - Intergenic
971607023 4:28670737-28670759 TGACATTCGTTAAAACACTAAGG - Intergenic
971645395 4:29193705-29193727 TGACCTTAGAGAAAACACGAAGG - Intergenic
971656325 4:29350332-29350354 GGACATTAAAAAGAACACACAGG + Intergenic
971666403 4:29492086-29492108 TGAAATTTAAAAAAACTCAATGG - Intergenic
972186599 4:36535462-36535484 TCACATTGGAAAAAATAAAATGG - Intergenic
972256975 4:37367237-37367259 TCAAAGTAGAAAAATCACAAGGG + Intronic
972850636 4:43045692-43045714 AGATATTAGAAGATACACAAAGG - Intergenic
973131166 4:46650534-46650556 TGAGACTAGAAAAATTACAAAGG + Intergenic
974092583 4:57327547-57327569 TGACACTAGAAAAAAAGCCAAGG + Intergenic
974337899 4:60575188-60575210 TGATATAAGAGAAAACACAAAGG + Intergenic
974561649 4:63530361-63530383 TGGCAATAGAAAAAAGAAAATGG + Intergenic
974762550 4:66296717-66296739 TAACATTAGAAAAAGAACCATGG - Intergenic
975637832 4:76467998-76468020 TGACATTTGAATTAACATAAGGG + Intronic
976360677 4:84174512-84174534 TGACCTTAGCAACAACACTAGGG - Intergenic
976966282 4:91045342-91045364 TGAGATTACATAAAACACAAAGG - Intronic
977087692 4:92624387-92624409 TGTCATTTGAGAAAACACCATGG - Intronic
977596137 4:98883305-98883327 TAATATTTGAAAAATCACAAAGG + Intronic
978490904 4:109310913-109310935 TGACATGAGAAAAAAATTAATGG + Intergenic
978610379 4:110531578-110531600 TGATAAAAGAAAAAACAAAAAGG - Intronic
979065312 4:116124149-116124171 TGTCCTTATAAAAGACACAAAGG - Intergenic
979816643 4:125114177-125114199 TGAAATTATACAAAATACAATGG - Intergenic
979866593 4:125762941-125762963 TGACATGAAAAAAAATCCAAGGG - Intergenic
981592104 4:146375695-146375717 TGAGAATAGGAAAAACACTAGGG - Intronic
982471614 4:155798264-155798286 TGAATTTAGAAAAAACTTAATGG + Intronic
982496136 4:156094614-156094636 TCACATGAAAAAAAATACAATGG - Intergenic
983001121 4:162415695-162415717 TGACATAAGAAAAAATATAGGGG + Intergenic
983120690 4:163881057-163881079 TGACAGTAGAGAAAAGACATGGG + Intronic
983246570 4:165294508-165294530 TGAAATTAAAAAAAAAAAAAGGG - Intronic
983465251 4:168079769-168079791 TAACATTAGAACAAACTCTATGG - Intergenic
983584655 4:169342121-169342143 TGATATGAGAAAAGAAACAATGG + Intergenic
985194296 4:187411574-187411596 TGTTATTCTAAAAAACACAAAGG - Intergenic
985297795 4:188454248-188454270 TGCCATTAGAGAATACACAGGGG - Intergenic
985929386 5:3044783-3044805 CCAAATTAGAAAAAACAAAAAGG + Intergenic
986833604 5:11609665-11609687 TGACAAGTGAAACAACACAAAGG + Intronic
986834343 5:11618153-11618175 TGTCATTTGAAAAATCTCAAAGG + Intronic
986885352 5:12226899-12226921 TTCCATTAAAAAAAACAAAAAGG + Intergenic
988391915 5:30645046-30645068 AGACATTAAAAAAGACATAAAGG + Intergenic
988594397 5:32578762-32578784 TGACGGTAGATAAAATACAAGGG + Intronic
988612091 5:32736391-32736413 TGTAATTAGAAAACACACATAGG - Intronic
989205202 5:38803050-38803072 AGACACTAGAAAGAACCCAATGG + Intergenic
989338311 5:40345696-40345718 TGCCATTAGAAAAAATAGATAGG + Intergenic
990160415 5:52932820-52932842 TCACATAAGACAGAACACAAAGG - Intronic
990209199 5:53463991-53464013 TGACATGAGTGGAAACACAAGGG + Intergenic
990754117 5:59049162-59049184 TGACATTAGAAAAGTCATACAGG - Intronic
991339221 5:65587699-65587721 TGACAGTAGAAAGAAAACCATGG - Intergenic
991509042 5:67356556-67356578 TGACATAGGAAAAAAAAAAAGGG - Intergenic
992344584 5:75864087-75864109 AGACATGAGAAACAACATAAAGG + Intergenic
992359148 5:76018373-76018395 TGAAATTAGAAGGAAAACAAAGG - Intergenic
993220151 5:85084964-85084986 TAACAGGAGAAAAAATACAAGGG + Intergenic
993617764 5:90134772-90134794 TGACTTTAGAAAAATGACAGTGG + Intergenic
994234398 5:97344053-97344075 TGAAATTAAAAAAAATACAATGG + Intergenic
994438633 5:99771356-99771378 AGACATTAGCAGAAAAACAAAGG - Intergenic
994932158 5:106203403-106203425 TGACAATGGAAAAAAAGCAAAGG + Intergenic
996319022 5:122192967-122192989 TGAAATTAGAAAAAAAAAATGGG - Intergenic
996826895 5:127693166-127693188 TGACACAACAAAAATCACAAAGG - Intergenic
997061320 5:130506747-130506769 GGATACTATAAAAAACACAAAGG - Intergenic
997379245 5:133423550-133423572 TGACAGTAGTAAAGGCACAAAGG + Intronic
998538616 5:142958033-142958055 TAACATTTGAAAAAACTGAAAGG + Intronic
998567283 5:143226708-143226730 TGACATAAGAAAACACATATTGG - Intronic
998874551 5:146586231-146586253 TGGCATTATTAAAAACACACCGG + Intronic
999350574 5:150866529-150866551 TAACATTACCAAAAAGACAATGG - Intronic
999384869 5:151146940-151146962 TGTCTCTAGAAAAAATACAAAGG - Intronic
1000358458 5:160423758-160423780 GGACTTTAGAATAAACACCATGG - Intronic
1000642995 5:163726950-163726972 TCACACTAGGAAAAACAAAAGGG - Intergenic
1000752006 5:165108371-165108393 TTGCATTAGAAAAAGCACCAAGG - Intergenic
1001734470 5:173987763-173987785 TGACAAAAGAAAAAAAAAAAAGG + Intronic
1001988642 5:176097254-176097276 TGACATTATAGAAAACCCAATGG - Intronic
1002010037 5:176272040-176272062 AAAAATTAGAAAAAAAACAAGGG + Intronic
1002228226 5:177740880-177740902 TGACATTATAGAAAACCCAATGG + Intronic
1002983199 6:2162522-2162544 TGAGACTAGAAAAAACAATAAGG - Intronic
1003602673 6:7532172-7532194 AGACAATAGAAAACATACAAAGG - Intergenic
1003670942 6:8158848-8158870 AGTCATTACAAAAAACACTAAGG - Intergenic
1003702598 6:8485595-8485617 TGACATGATAGAAAACACAGAGG + Intergenic
1003815209 6:9832646-9832668 AGAAATTAAAAAAAATACAAAGG + Intronic
1004332408 6:14733893-14733915 TGACCTTAGAAATAGCGCAAGGG - Intergenic
1004930680 6:20460216-20460238 TGAAAATAGAATAAAAACAAAGG - Intronic
1005221161 6:23590621-23590643 TGACATTAGATGAAAATCAATGG + Intergenic
1005279196 6:24253073-24253095 TAATATTAGGAAAAAAACAAGGG + Intronic
1005287175 6:24340331-24340353 TTAAAATAGAAATAACACAAGGG + Intronic
1005804666 6:29462977-29462999 TGACAGTAAAAAGAACAGAATGG - Exonic
1006719652 6:36142068-36142090 TGAGATTAGAGAGAACACAAGGG - Intronic
1008593193 6:53014125-53014147 TTAGATAAGAAAAATCACAAGGG - Intronic
1009361051 6:62815404-62815426 TGAAATTAGAAATAAAACAAAGG - Intergenic
1009682393 6:66913644-66913666 GGATATTAGGAAAACCACAAGGG - Intergenic
1010265543 6:73861949-73861971 TGAGAGAAGAAAAAACAAAAAGG - Intergenic
1010699601 6:79027093-79027115 TGACATTAGAAAGAACTCAGAGG + Intronic
1011469995 6:87699270-87699292 TGACATTACAAAAAACATACAGG + Intronic
1011678891 6:89763763-89763785 TGAGATGAGTAAAAACCCAATGG + Intronic
1011918473 6:92540629-92540651 TTGCTTTAGTAAAAACACAATGG - Intergenic
1011960554 6:93083650-93083672 AGACATTGGAAACAAAACAAAGG - Intergenic
1012248191 6:96950800-96950822 TGATATTAGTAACAAGACAAGGG + Intronic
1012361017 6:98380200-98380222 TGTAATAAAAAAAAACACAATGG - Intergenic
1012607734 6:101178847-101178869 AGACAGTAGATAAAAGACAAGGG + Intergenic
1012813751 6:103995261-103995283 TTACATTAGAAATAAGCCAAGGG + Intergenic
1013225046 6:108114848-108114870 TGTCATTAAAAAAAAAAAAAAGG + Intronic
1013544969 6:111147227-111147249 TTACATGAGAAAAAAATCAAAGG + Intronic
1013640174 6:112067517-112067539 TTACATATGAAAAAACAGAATGG - Intronic
1014524549 6:122486532-122486554 TGAAATTAGAAGGAACATAATGG - Intronic
1015071156 6:129094818-129094840 TGTCTTTAGAAAAGAAACAATGG + Intronic
1015298089 6:131621981-131622003 TGATATAAGAAAAAAGACATGGG + Intronic
1015784532 6:136908435-136908457 TGACATTACAGAAAAAAAAATGG - Intronic
1015807207 6:137122503-137122525 TGCCATTTGAAATAACACAAAGG - Intergenic
1016230019 6:141791506-141791528 TGAAATAAAAAAACACACAATGG + Intergenic
1016508877 6:144817253-144817275 TCCCATTAGATCAAACACAAGGG - Intronic
1016703271 6:147077728-147077750 TTACATGAGAAGAACCACAAAGG - Intergenic
1016785343 6:148005437-148005459 TGATGTTAGAAAAAACAAAAAGG - Intergenic
1017254061 6:152313431-152313453 TGACATTAGAAAAAACACAATGG + Intronic
1017317303 6:153046553-153046575 TGAAATAAGAAAAGACATAACGG + Intronic
1017350549 6:153436495-153436517 TAACAATAGTGAAAACACAAAGG - Intergenic
1017394228 6:153978551-153978573 TGATATTAGACATAATACAAAGG - Intergenic
1017499229 6:155007951-155007973 TCACATTAGAAAATTCACTAAGG + Intronic
1017980108 6:159394013-159394035 GGACATTGAGAAAAACACAACGG + Intergenic
1018142963 6:160858219-160858241 TGAACCTAGAAAAAACACAATGG - Intergenic
1020597552 7:10227665-10227687 TGACTTTTGAAATAAAACAATGG + Intergenic
1022755518 7:33284063-33284085 TGACATCAGAAGAACCAGAATGG - Intronic
1022779787 7:33568619-33568641 TGACATTGGCAAAACCACTATGG - Intronic
1023321665 7:39004893-39004915 TAACATGTGAAAAGACACAATGG + Intronic
1023563328 7:41498240-41498262 AGACATTAAAAAATACCCAAAGG + Intergenic
1024412978 7:49068242-49068264 TAACATCAGAAATAATACAAAGG - Intergenic
1024567172 7:50690910-50690932 TGAGATTTGAAAAATTACAAAGG + Intronic
1024926101 7:54617417-54617439 TGTCATGAGAAAAAAAAAAAAGG + Intergenic
1025915621 7:65863138-65863160 TGAAATTAAAAAAAAAAAAAAGG - Intergenic
1026392971 7:69920978-69921000 TGGCATTATAAAAACCACGAGGG - Intronic
1027240807 7:76326972-76326994 TAACATGACAAAAAGCACAAAGG + Exonic
1027331655 7:77102310-77102332 AGTCATTAGAAAACACAAAATGG + Intergenic
1027461603 7:78461073-78461095 AGAGATTAAAAAAAACTCAATGG - Intronic
1027759122 7:82255283-82255305 TCACATTGGGAAAAACACAGTGG - Intronic
1027821311 7:83048816-83048838 TGAAATTTGAAAAAACATAAAGG - Intronic
1028961427 7:96753677-96753699 TAAAATTAAAAAAAAAACAAAGG + Intergenic
1029784117 7:102769029-102769051 AGTCATTAGAAAACACAAAATGG - Intronic
1030013413 7:105194289-105194311 TAAGATTAGAAACAAGACAAGGG + Intronic
1030958269 7:115882690-115882712 TTACATAATAAACAACACAAAGG - Intergenic
1031233383 7:119139938-119139960 AGACATTTGAAAACATACAATGG - Intergenic
1031714683 7:125094113-125094135 TCACACTAGAAAAAAGACAATGG - Intergenic
1031797835 7:126199001-126199023 TAAGATTTGAAAAAAGACAAGGG + Intergenic
1031946848 7:127851205-127851227 TGACAGTATAAAAAGCAAAAAGG - Intronic
1032317624 7:130854560-130854582 AGACATAAGGAAAATCACAATGG - Intergenic
1032660530 7:133978940-133978962 TGACAACAGACAAAGCACAAGGG + Intronic
1033106014 7:138524299-138524321 TGAGATTAGGAACAACATAAGGG + Intronic
1033129665 7:138735113-138735135 TGACATGAGGAAAAGCACACTGG + Intronic
1033350202 7:140555858-140555880 AAACATTATAATAAACACAATGG - Intronic
1033715227 7:143995290-143995312 AGACATTAGAAACAACACTAAGG + Intergenic
1035682862 8:1501232-1501254 TGACGTTTGAAGAAATACAAAGG + Intergenic
1035744673 8:1953136-1953158 TCACAATATAAAACACACAAAGG - Intronic
1035768161 8:2125442-2125464 TGACATTAGAACAGACAGATCGG - Intronic
1035984641 8:4413684-4413706 TGACATTGGAAAATACTCACTGG - Intronic
1037175476 8:15941958-15941980 TGACATTGGAAGATACAAAAAGG + Intergenic
1038244148 8:25838699-25838721 AGAAATTAGAAGGAACACAAAGG + Intergenic
1040057755 8:43075391-43075413 GGACATTATAAAAAAGATAATGG - Intronic
1041640521 8:60194962-60194984 GAACTTTAGAAAATACACAAAGG - Intronic
1041676046 8:60540868-60540890 TGACATTATATAAGACACAATGG + Intronic
1042026565 8:64430440-64430462 TGACATTACAAAAAAAAAACAGG - Intergenic
1042780834 8:72489564-72489586 TGACATAAGAATATAAACAATGG + Intergenic
1043265141 8:78257243-78257265 TGACATTAGAAAAGTGAAAAAGG - Intergenic
1044192866 8:89340933-89340955 GGACATTTGAAAATACACAGAGG - Intergenic
1044375370 8:91464017-91464039 TGGCATGAAAAAAAACAAAAAGG - Intergenic
1044500830 8:92953709-92953731 TGAAATTAGAGAAATAACAAAGG + Intronic
1045271404 8:100664912-100664934 TGACATTTGATTAAACCCAAGGG + Intergenic
1045731053 8:105241235-105241257 TAACAGTAGACAAAACAAAATGG + Intronic
1046134504 8:110009620-110009642 TGACAGGAGAAACAGCACAAAGG - Intergenic
1046316222 8:112505979-112506001 GGACATTAGAAATATCAAAATGG - Intronic
1046328718 8:112684849-112684871 TCACATTAGTGAAACCACAATGG - Intronic
1046581480 8:116098426-116098448 TGAAATTAAAAGAAACATAATGG - Intergenic
1046690431 8:117278405-117278427 TCACAGAAGACAAAACACAATGG - Intergenic
1047545449 8:125811975-125811997 GCACATTAGAATGAACACAACGG + Intergenic
1047758761 8:127938726-127938748 GGACATTAGTAAAAACAGACTGG - Intergenic
1047862578 8:128984607-128984629 TGCCATAAAAAAACACACAATGG - Intergenic
1048442197 8:134468372-134468394 TGACATTTTATAAAACTCAAAGG - Intergenic
1048622947 8:136154576-136154598 TGCTATTAGAAAAAAAAAAAAGG - Intergenic
1048696149 8:137030511-137030533 TTATATTAGAAAAAAAATAAAGG + Intergenic
1048739779 8:137542410-137542432 TGACCTTAGAAAAAAGACTTTGG + Intergenic
1049022566 8:139967833-139967855 TGTTTTTAAAAAAAACACAATGG + Intronic
1050009061 9:1166957-1166979 TGTCTTTAGAAAAAACTAAAAGG + Intergenic
1050696292 9:8282935-8282957 TGACATTAGCAAAAACTGAGTGG - Intergenic
1050798959 9:9584732-9584754 TGTCATTAGAAAAAGCATAAAGG - Intronic
1050930526 9:11318078-11318100 GGACATTAGTAGAAACACTAGGG + Intergenic
1050943487 9:11488936-11488958 TGAGAATAGCAAAATCACAAAGG + Intergenic
1051642836 9:19238962-19238984 AGACATTAAAAAAAGAACAAAGG - Intronic
1051855280 9:21558890-21558912 AGTCATTAAAAAAAACACAGCGG - Intergenic
1051917611 9:22226484-22226506 TGTAATTAGAAAAAAGAAAAAGG - Intergenic
1051992441 9:23168595-23168617 TGGCATTAAAACAAACACATAGG + Intergenic
1052130237 9:24835923-24835945 TTACATAAGAAAAAACCTAATGG - Intergenic
1055049757 9:71966618-71966640 TGACTATAAAAAAAACGCAAAGG + Intronic
1055124015 9:72698147-72698169 TGAAAATAGAAACAACCCAATGG + Intronic
1055225891 9:73994847-73994869 GGACAATAGCAAATACACAATGG - Intergenic
1055473991 9:76643371-76643393 TGAAAATAGAAACAAAACAAAGG - Intronic
1055773762 9:79745642-79745664 TTGCAATAGAAAAAACAGAAGGG + Intergenic
1055775015 9:79758355-79758377 GGACATTAGAAAATACCAAAGGG - Intergenic
1055842372 9:80520169-80520191 TGAAATTAAAAAAGACACACTGG + Intergenic
1056223447 9:84472125-84472147 TGACATTTGAAAAATGAAAATGG + Intergenic
1058078976 9:100681586-100681608 GGACATTAGAAAAGATAAAATGG + Intergenic
1058682003 9:107448262-107448284 TGACATAAGAGAAATAACAAAGG - Intergenic
1059011860 9:110469952-110469974 TCACACTATAAAAAACCCAACGG + Intronic
1059611689 9:115904215-115904237 TGACAGAAGAGAAAACATAATGG - Intergenic
1060761276 9:126251473-126251495 TTAAATTAGAAGAAACACAAGGG - Intergenic
1061638526 9:131931331-131931353 TCAAATTAGAAAATATACAATGG + Intronic
1061748662 9:132758797-132758819 TCACAAAAGAAAAAACACAAGGG - Intronic
1062405970 9:136396750-136396772 TGAGCTCAGAAAAAACCCAAGGG + Intronic
1203703232 Un_KI270742v1:13382-13404 GGACATTAGGAAAAATACCATGG + Intergenic
1185915424 X:4029229-4029251 ATACATTAGAAAAAAAACCACGG + Intergenic
1186329833 X:8519962-8519984 TTACAGTACCAAAAACACAATGG - Intergenic
1186529589 X:10281929-10281951 TCACATTAAAAAAAACATTACGG - Intergenic
1186539398 X:10384873-10384895 TAACATTAAAAAAAAGAAAATGG - Intergenic
1186757025 X:12682358-12682380 TGACTCTAGAAACAACACAGAGG - Intronic
1186933071 X:14416084-14416106 TGAAATTAGAAATTACATAATGG + Intergenic
1187037565 X:15557938-15557960 TGACATTATAGAAAAGACAATGG - Intergenic
1187059441 X:15771736-15771758 TGTCAATTGAAAAAACACACTGG - Intronic
1187926984 X:24259696-24259718 AAACATTAGGAAAAACAAAAGGG - Intergenic
1188708427 X:33363882-33363904 AAACTTTAGAAAAATCACAAGGG + Intergenic
1188717786 X:33481752-33481774 TCCCATTAGAAAATAGACAAAGG + Intergenic
1189676793 X:43468699-43468721 TGAAAATAGAAAAATCATAAAGG - Intergenic
1190756715 X:53407807-53407829 TGAGAGTAGAAAAAACACTTTGG + Intronic
1190828145 X:54036696-54036718 TTACATTAGAAAAGAAAGAAAGG + Intronic
1190939629 X:55027859-55027881 TGAAATTGGAAAAGACAGAAGGG + Intronic
1191644584 X:63466789-63466811 TGCCATTAGAATAAAGATAAGGG + Intergenic
1192679472 X:73237027-73237049 TGATATTAAAAAAAAAAGAAAGG - Intergenic
1193372821 X:80717903-80717925 TAACAATATGAAAAACACAAAGG - Intronic
1193893009 X:87074807-87074829 TAACATTAGAAATAACAAAGAGG + Intergenic
1194135683 X:90138226-90138248 TTACTTTAGATAAAACCCAAGGG + Intergenic
1194168416 X:90551673-90551695 AGACAAGAGAAAAAAAACAAAGG + Intergenic
1194230200 X:91312652-91312674 TGACATTAGAAAATACAATTAGG - Intergenic
1194534617 X:95090634-95090656 TTAAATTTGAAAAAACATAAAGG + Intergenic
1194557157 X:95374230-95374252 AGACATTACAAACAACACCACGG + Intergenic
1194682840 X:96874731-96874753 TAACATTAGAGGAAACAAAAAGG - Intronic
1194870330 X:99123911-99123933 AAACAGTAAAAAAAACACAATGG + Intergenic
1195038867 X:100995348-100995370 TGACATGAGAAAAAAGGCAAGGG - Intergenic
1195158539 X:102147763-102147785 TGAAATTAGAAAACACTAAATGG - Intergenic
1195329048 X:103781607-103781629 AGACATTAGGAGAAACAGAAGGG - Intronic
1195777999 X:108428808-108428830 TGAAATGAAAAAAAACACACAGG + Intronic
1196189559 X:112780521-112780543 TGACATTTGGAACGACACAAAGG + Intronic
1197048908 X:122034663-122034685 TGAGAACAGAAAAAAGACAAAGG - Intergenic
1197076613 X:122361497-122361519 AAAGATTAAAAAAAACACAAAGG - Intergenic
1197278463 X:124507321-124507343 TGAAATTAGAAGAGTCACAAGGG - Intronic
1197600972 X:128529468-128529490 AGAAATCAGAAAAGACACAAAGG + Intergenic
1199478380 X:148271396-148271418 TGAAATTGGTAAAAACCCAAAGG - Intergenic
1199954353 X:152731718-152731740 TAACATCAGAAAAAAAAAAACGG + Intronic
1200481449 Y:3708307-3708329 TTACTTTAGATAAAACCCAAGGG + Intergenic
1201623343 Y:15985009-15985031 TGTCTTTAGAAAAAAAAAAATGG - Intergenic