ID: 1017257533

View in Genome Browser
Species Human (GRCh38)
Location 6:152350671-152350693
Sequence GGTGCAGGACGTCACTTTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017257533_1017257539 24 Left 1017257533 6:152350671-152350693 CCTTTAAAGTGACGTCCTGCACC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1017257539 6:152350718-152350740 TCTCTCACTGACTTTACTGATGG 0: 1
1: 0
2: 1
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017257533 Original CRISPR GGTGCAGGACGTCACTTTAA AGG (reversed) Exonic
902914292 1:19627010-19627032 GCTGCAGGACTTGACTTCAATGG - Exonic
903479893 1:23645379-23645401 GGTGCAGGAAGAGACTTCAACGG + Intergenic
907814918 1:57908918-57908940 GGTGCTGCTCTTCACTTTAAAGG + Intronic
916833708 1:168520213-168520235 GATGCAGGAATACACTTTAAAGG + Intergenic
920593924 1:207249834-207249856 GGAGCAGGACATCAGGTTAAGGG + Intergenic
922562884 1:226581868-226581890 GGTGCAGGATGTCCCTGGAATGG - Intronic
1063025096 10:2170342-2170364 GGTGAAGGATGTAAATTTAATGG - Intergenic
1063952721 10:11239239-11239261 GGTGTACGACGTGATTTTAATGG + Intronic
1065024982 10:21533680-21533702 AGTCCAGGACGTGAATTTAATGG + Intergenic
1082720425 11:56668599-56668621 GGTGCAGGAATTCAGATTAAAGG - Intergenic
1085378488 11:76090056-76090078 GGTGCAGGAAGTCTTTCTAAAGG - Intronic
1085978478 11:81692167-81692189 GGTGCAGGAAGTTATTTCAAGGG - Intergenic
1091796515 12:3300392-3300414 GGTGCAGGACATCAGTCTCAAGG + Intergenic
1099565827 12:84245086-84245108 GCTGCAGGACCTCATCTTAAAGG - Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101743902 12:107523191-107523213 GGTGCAGGCCGTAAGTTTAATGG - Intronic
1112571091 13:100594247-100594269 GGTGCAGAACTTCCCTTAAAGGG - Intergenic
1115809385 14:37089864-37089886 GATGGAAGATGTCACTTTAAAGG - Intronic
1125083407 15:35701861-35701883 GGTGCAGAACATAACTTTAATGG + Intergenic
1129661199 15:77554050-77554072 GGTGCTGGCAGTCACTTGAAGGG - Intergenic
1134250704 16:12571923-12571945 GGTGAAGGAAGACACTTTCAGGG + Exonic
1138834253 16:60414009-60414031 GAAGCAGGATGTCACTTTATTGG + Intergenic
1154100234 18:11466212-11466234 GGGGCAGGATGTCCCATTAAGGG + Intergenic
1156508814 18:37617630-37617652 GGTTCAGGAGGTCACTTACAGGG + Intergenic
1163093888 19:15041602-15041624 GGGGCTTGAAGTCACTTTAAGGG - Intergenic
1163813324 19:19448170-19448192 GCTGTAGGACGTCACTGTGAGGG - Intronic
927101354 2:19789912-19789934 GATCCATGAAGTCACTTTAAAGG + Intergenic
931147502 2:59535200-59535222 GGTGAAGGATGTGACTTTTAGGG - Intergenic
931516546 2:63053536-63053558 GGTGCAGGACATCGATTTAGAGG - Intronic
933001800 2:76934486-76934508 GTTGCAAGACTTCAATTTAATGG + Intronic
937147139 2:119657030-119657052 GGAGCAGGAGGTCACTGCAAGGG + Intronic
937692788 2:124775116-124775138 GCTGTTGGAGGTCACTTTAATGG + Intronic
941931214 2:170941510-170941532 TGTGCAGGATGTCACTGGAAAGG - Intronic
948536984 2:238653830-238653852 GGTGCAGGATGGCCCTTTGAAGG - Intergenic
1174859272 20:54075177-54075199 GGTGCATGACCACACTATAATGG - Intergenic
1174922424 20:54718018-54718040 GGTGCAGGAAGCCACTCCAAAGG + Intergenic
1177738052 21:25118255-25118277 GGTGCAGAAAGTAAATTTAAAGG + Intergenic
965707545 3:171524236-171524258 GGTGCAGGCCATCACCTTAAGGG - Intergenic
968558974 4:1266532-1266554 GGTCCAGGAGGTCACTAGAAGGG - Intergenic
974706590 4:65525531-65525553 GGTGCAGTAGGTTACTTAAATGG - Intronic
977413030 4:96691926-96691948 GGTGCAGGTCCTTGCTTTAAAGG - Intergenic
988729368 5:33955158-33955180 GGTGGAGGAAGCCACTTGAAAGG + Intronic
992516228 5:77495635-77495657 GGTCCAGGACTTCACTTTTTTGG - Intronic
993035033 5:82747219-82747241 GGAGCAAGATGTCACTTTAGAGG + Intergenic
1008824434 6:55676177-55676199 TGTGCAGGATTTTACTTTAATGG - Intergenic
1014683415 6:124463947-124463969 GGTGCAGGAAATCATTTGAATGG + Intronic
1017257533 6:152350671-152350693 GGTGCAGGACGTCACTTTAAAGG - Exonic
1024272597 7:47653981-47654003 GAGGCAGGAAGTCAGTTTAAAGG - Intergenic
1036765452 8:11546987-11547009 GCTGCGGGAAGTCACTTTGAAGG - Intronic
1040974249 8:53172326-53172348 AGTGCATGTCCTCACTTTAATGG + Intergenic
1042267222 8:66921259-66921281 GGTGCAGGACGAAAAATTAATGG + Exonic
1042377416 8:68069115-68069137 GATGCAGGACGTGATTTCAAAGG + Exonic
1043358009 8:79436451-79436473 GGTGCAGTCAGTTACTTTAAAGG + Intergenic
1053044002 9:34898757-34898779 GGTGCAAGACGTCAGGCTAATGG - Intergenic
1190532858 X:51396760-51396782 GATCCAGGGCGTCACTTAAATGG - Intergenic