ID: 1017258081

View in Genome Browser
Species Human (GRCh38)
Location 6:152357181-152357203
Sequence ATTTCATCCACAGAGTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017258081_1017258085 22 Left 1017258081 6:152357181-152357203 CCTTACAACTCTGTGGATGAAAT 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1017258085 6:152357226-152357248 GCCTGAAGTCACCTAGTGTTGGG No data
1017258081_1017258084 21 Left 1017258081 6:152357181-152357203 CCTTACAACTCTGTGGATGAAAT 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1017258084 6:152357225-152357247 TGCCTGAAGTCACCTAGTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017258081 Original CRISPR ATTTCATCCACAGAGTTGTA AGG (reversed) Intronic
902669415 1:17962269-17962291 TTTTAATCCACTGAGTTGTGAGG + Intergenic
903151706 1:21414543-21414565 ATTTCTTCCACAGAGATACAGGG - Intergenic
905729813 1:40289490-40289512 ATTGGATCCACTGAGTTATAAGG + Intronic
906782906 1:48588449-48588471 ATCTCTTTCACAGAGTTGTGAGG + Intronic
907948413 1:59156826-59156848 ATTACATGCACAGCATTGTATGG + Intergenic
911353799 1:96791199-96791221 ATTTCATACACAGTGATGAAGGG + Intronic
912501379 1:110124570-110124592 ATTTGATCCCCAGTGTTGGAGGG + Intergenic
914584068 1:149045258-149045280 ATTTCTTCCAAAGAGATGTAGGG - Intronic
916161460 1:161920199-161920221 ATTGCATCCAGACAGTTGAATGG + Intronic
917202959 1:172536681-172536703 TTCTCATCCACAGAATTGTAAGG - Intronic
917380630 1:174402563-174402585 ATTCCTGCCACTGAGTTGTAGGG + Intronic
917495012 1:175532583-175532605 TTTTCAACCACTGAGTTTTAGGG - Intronic
921465244 1:215478902-215478924 ATTTCAACCTGAGATTTGTATGG + Intergenic
924030072 1:239877649-239877671 AATTCTTTCACAGAGCTGTACGG - Intronic
924127221 1:240867495-240867517 ATTTCATCCATAAAGTTTTCTGG + Intronic
924423308 1:243929420-243929442 ATTTCTTCCACTCTGTTGTATGG + Intergenic
1063273419 10:4537464-4537486 AGATCACCCACAGAGTTGGAGGG + Intergenic
1064672832 10:17733494-17733516 ATTGCATCCATAGAATAGTATGG + Intergenic
1065291402 10:24233406-24233428 ATTTGATCCCCAAAGTTGAAGGG - Intronic
1066589835 10:36982704-36982726 ATTGAATTCACAGTGTTGTAAGG + Intergenic
1068846304 10:61678910-61678932 ATTTCATCTACAGTGGTGTCAGG - Intronic
1070578594 10:77700991-77701013 TTTTAATCCTCAGAGATGTATGG + Intergenic
1071224723 10:83515573-83515595 ATTTTATACACATAGTTTTAAGG - Intergenic
1071231289 10:83589006-83589028 ATCTCGTCCACTGTGTTGTAAGG - Intergenic
1071729027 10:88229572-88229594 AGTACATCCACAGAATTGTGTGG + Intergenic
1071831628 10:89378052-89378074 GGTTCATCCACAGAGTTCTAGGG - Exonic
1072053550 10:91730256-91730278 ATTTCATCCACAAATTAGTTGGG - Intergenic
1075110669 10:119578923-119578945 AATTCATCTACTGATTTGTATGG - Intronic
1077646999 11:3934092-3934114 TTTTCTTTCACAGAGTTGTCAGG + Intronic
1077823043 11:5770018-5770040 ATTTCATCCACTTAGTTTGAAGG + Intronic
1077952114 11:6970913-6970935 AGTTCCCCCACAGGGTTGTATGG - Intronic
1079327564 11:19507305-19507327 ATTTCCCCCAAAGAATTGTATGG + Intronic
1079653510 11:22960456-22960478 ATTTTATATACAGAGTTGTTTGG + Intergenic
1081111096 11:39134404-39134426 ATCTCATCCACAGCATTGTTTGG + Intergenic
1087722861 11:101686628-101686650 ATATCATCCAAAGAGCTGTAGGG - Intronic
1087761417 11:102107875-102107897 ATTTCAACCACGGTGTAGTAGGG - Intergenic
1090605407 11:128418202-128418224 TTTTCATCCACATAAATGTATGG - Intergenic
1091089315 11:132754888-132754910 GATTCATCCACAGTGTTCTAGGG + Intronic
1094277426 12:28693822-28693844 ATTTCTTCCACAGAGTAGTACGG - Intergenic
1095929555 12:47612044-47612066 ATTTGATCCCCAGTGTTGGAGGG + Intergenic
1096236629 12:49932610-49932632 ATTTGAGCCACAGCTTTGTACGG + Intergenic
1097571515 12:61338774-61338796 ATTTGACCCACAGAGTAGAAAGG + Intergenic
1097780964 12:63704033-63704055 ATTTCAGCCACAGACAGGTAAGG + Intergenic
1097954252 12:65467245-65467267 TTTTTACCCACAGAGTTTTATGG - Intronic
1098579013 12:72076636-72076658 ATTTCATTCACAGGGTGGTTAGG - Intronic
1101208429 12:102512489-102512511 TTCTCCTCCACAGAGTTGTTTGG + Intergenic
1101248174 12:102904770-102904792 ATTTCATTCACAAAGATGTTGGG + Intronic
1101693186 12:107100122-107100144 ACTTCTTCCACAGAGGGGTAGGG + Intergenic
1107419814 13:40235662-40235684 AATACATACACAAAGTTGTAAGG + Intergenic
1109315717 13:60746982-60747004 ATATCATCCAGAGAGTGGTATGG - Intergenic
1113199725 13:107853898-107853920 GTTTCACCCACTAAGTTGTAAGG + Intronic
1113457589 13:110459409-110459431 GGTTCATCCACAGTGTGGTATGG - Intronic
1113738385 13:112693999-112694021 ATTTCCTCTTCAGAGCTGTAAGG + Intronic
1114377108 14:22158900-22158922 ATTTCTTCCATAAAATTGTAAGG - Intergenic
1114813580 14:25929071-25929093 TTTTCTTCCACAGAGTTGTGTGG - Intergenic
1114986366 14:28234167-28234189 TTTCCATCCATAGAGTTGAAGGG - Intergenic
1115484416 14:33896426-33896448 ATCTCATTCACTGAGTTATATGG + Intergenic
1115748476 14:36462697-36462719 ATTTCATCCACATATTCGTGAGG - Intergenic
1116300635 14:43177262-43177284 ATCTCCTTCCCAGAGTTGTATGG - Intergenic
1119867692 14:77987837-77987859 AATTCATCCACAAAGTTGCAAGG - Intergenic
1127564295 15:60171487-60171509 ATTCCTCCAACAGAGTTGTAAGG + Intergenic
1127565724 15:60186340-60186362 ATTTGATTCATAGACTTGTAGGG - Intergenic
1130359915 15:83173733-83173755 ATTTCATCCCTAGAGTTCAAAGG - Intronic
1130747957 15:86676263-86676285 ATTTCACCCAGACATTTGTATGG + Intronic
1130757086 15:86775373-86775395 ATTTCATCAAGAGAAGTGTATGG - Intronic
1131021798 15:89105444-89105466 ATTTCTTCCACAAAGTCATAAGG - Intronic
1132261658 15:100430447-100430469 ATGTCATTCCCAGAGGTGTAAGG - Intronic
1135944133 16:26850210-26850232 ATTTCCTCCACTGAATTGTTTGG - Intergenic
1137390430 16:48076669-48076691 AGTTCATTCAAAGAGTGGTAGGG - Intergenic
1137415489 16:48274265-48274287 GTTTCATCTCCACAGTTGTATGG - Intronic
1137904418 16:52305771-52305793 ATTTCATAAAGATAGTTGTATGG - Intergenic
1148858787 17:50593370-50593392 TTTCCCTCCACAGAGTTGCACGG - Intronic
1149155377 17:53622878-53622900 ATTTTATCTACAGAGTTCTTGGG + Intergenic
1149227504 17:54491510-54491532 ATTTGCTCCACAGAGTTATCAGG - Intergenic
1149723554 17:58869335-58869357 ATTTGATCCCCAGCGTTGGAGGG + Intronic
1155234698 18:23807537-23807559 ACTTGATTCACACAGTTGTAGGG + Intronic
1155393861 18:25366026-25366048 ATTTCAATGTCAGAGTTGTAAGG + Intergenic
1156194011 18:34752613-34752635 ATTTTATCCCCAGAGTTTTCTGG - Intronic
1159360389 18:67394288-67394310 TTTTCAACCACAGTGATGTAAGG + Intergenic
1163216023 19:15878442-15878464 GGTTCATCCACAGTGTAGTAGGG + Exonic
1163354582 19:16801742-16801764 ATTTAATCCCCAGTGTTGGAGGG + Intronic
1165840925 19:38788901-38788923 ATTTTATCCACAGACATGTTGGG - Intergenic
926566467 2:14480785-14480807 ATTTCATAAACAGATATGTAGGG + Intergenic
927046448 2:19283596-19283618 ATTTCTTCCCCAAAGATGTATGG + Intergenic
927370196 2:22345577-22345599 ATTTCCTCCACTGAGTTGAGTGG + Intergenic
928125087 2:28609989-28610011 ATTGCATCCACAGAAGTCTAAGG - Intronic
928246904 2:29638374-29638396 CTTTCATCCACAGCCTTGTTAGG - Intronic
929317525 2:40497799-40497821 ATTTTATCCTGAGAGTTATAGGG + Intronic
929626351 2:43412460-43412482 ATTTCATCAGCAGATTTCTATGG + Intronic
931012847 2:57937725-57937747 ATTTGATCCTCTGAGTTGGAAGG - Intronic
931354915 2:61528289-61528311 ATTTCATGAATAGGGTTGTACGG + Intronic
931930386 2:67126888-67126910 ATTTGATCCACAAACTTGTGTGG - Intergenic
934147143 2:89106407-89106429 AGTTGATCCTCAGAGTTATAAGG - Intergenic
934222126 2:90094187-90094209 AGTTGATCCTCAGAGTTATAAGG + Intergenic
935741208 2:106150313-106150335 CTTTGATACACAGAGTAGTATGG + Intronic
935862245 2:107345631-107345653 ATTACATCAACAGAGTATTAAGG + Intergenic
936911886 2:117602091-117602113 AACTCTTCCACAGAGTTTTAGGG + Intergenic
939948378 2:148438501-148438523 ATCTCTTCCACAGTGTTGTGAGG + Intronic
939952435 2:148490904-148490926 ATTTCATACACAGAGGAGGAAGG + Intronic
940723578 2:157308856-157308878 AGTTCATTCACAGAGATGCATGG + Intronic
946644537 2:221818666-221818688 ATTTCATTCACATCGTTGTCAGG + Intergenic
1169537665 20:6562720-6562742 ATTTCATCCAGAAAGTAATAGGG - Intergenic
1170418860 20:16172522-16172544 ATTGCATCCACATATTTGGAAGG + Intergenic
1172941783 20:38659262-38659284 ACTTCATCCACAGACTTGCAGGG + Intergenic
1173387492 20:42602503-42602525 ATTTCCCTCACAGAGTTGTCAGG - Intronic
1175088462 20:56481716-56481738 AGTACATTCACAGTGTTGTACGG + Intronic
1177313880 21:19431192-19431214 GTTTCTTTCACAGGGTTGTATGG - Intergenic
1179383962 21:40924631-40924653 ATTTCATTCACAGAGGTGATAGG + Intergenic
1182162544 22:28137584-28137606 AATTCATCCACCATGTTGTAAGG - Intronic
1183766886 22:39885889-39885911 ATTACATTCACAGTGTTGTGCGG - Intronic
1184964749 22:47963112-47963134 ATTTCATCTGCAGAGGGGTAAGG + Intergenic
1185075740 22:48681159-48681181 ACATCATGCTCAGAGTTGTAGGG + Intronic
951112114 3:18816170-18816192 ATTTTATTCTAAGAGTTGTATGG + Intergenic
952096093 3:29956272-29956294 ATTTGATCCACAGAGATGGCAGG - Intronic
952859416 3:37800525-37800547 ATTTGATCCACAGCTTTTTAAGG + Intronic
953125367 3:40087277-40087299 ATTTCATCCACAGCACTGTGAGG - Intronic
953199731 3:40768098-40768120 ATTTTATACTCGGAGTTGTAAGG + Intergenic
953713110 3:45291847-45291869 ATGTCATCCTCATAGTTGTTAGG + Intergenic
953854480 3:46490330-46490352 ATTTCATCAACAAAGTTTTGTGG - Intergenic
954111872 3:48438233-48438255 ATTATATTCACAAAGTTGTATGG - Intronic
956322390 3:68011304-68011326 ATTTTATCGACAGGGGTGTACGG + Intronic
959135535 3:102414557-102414579 AAATCATCCCCAGATTTGTAAGG - Intronic
960330255 3:116350987-116351009 ATTTCTTCCACAGAGAAGGAGGG + Intronic
960513788 3:118580679-118580701 ATCTCATCCACAGAGCTGGAAGG + Intergenic
962339949 3:134574100-134574122 ATTTCCTCTGCAGAGTTGCAGGG + Intronic
962345367 3:134614805-134614827 ATTTCAGCCACACAGCTGTTGGG - Intronic
962527155 3:136247158-136247180 AGTTCTACCTCAGAGTTGTAAGG - Intergenic
962738277 3:138344975-138344997 ATTTAATCCACAGAGGTCCAAGG - Intergenic
962984728 3:140524474-140524496 ATTTCAGCCACACAATTGTGAGG + Intronic
963926982 3:150961132-150961154 ATTTCTTCCACACAGTTGGGGGG - Intronic
964516619 3:157516695-157516717 AGTTCATGCACATATTTGTAGGG + Intronic
965937354 3:174130551-174130573 ATTCACTCCACAGAGTTTTAAGG + Intronic
967520939 3:190432526-190432548 ATTTCATTCACAGATTTTCATGG - Intronic
971868972 4:32211016-32211038 ATTTCAGCCACTGAGTTGATAGG - Intergenic
974335583 4:60540227-60540249 ATTTCATCCACAGGGTAGTAAGG + Intergenic
974665311 4:64953778-64953800 TTTTCATCCTCAGACTTCTAAGG + Intergenic
976162476 4:82218292-82218314 ATTTCATCCAGACAGATGTAGGG - Intergenic
976419814 4:84828321-84828343 GTTTCATATACACAGTTGTAAGG + Intronic
977423079 4:96828340-96828362 ATATCACCCACAGAATTGTGTGG + Intergenic
977574580 4:98662705-98662727 TTTTCAACCTCAGAGTTATAAGG - Intergenic
978003660 4:103589689-103589711 TATTCATCCACAGAGGTATAGGG + Exonic
978985428 4:115006278-115006300 ATTTCATCCTCAAAGTAATAGGG + Intronic
979201969 4:117989259-117989281 ATTTCCTCTACAGAGTCATAGGG + Intergenic
979887883 4:126054040-126054062 AGTTGATCCACAGAGTTCTAAGG + Intergenic
979989378 4:127356439-127356461 ATGTAATCTACAGAGATGTAAGG - Intergenic
980263817 4:130490132-130490154 ATTTTATCAACACAGTTATAGGG - Intergenic
980678597 4:136125314-136125336 ATTTCAACCTCAGATCTGTAGGG - Intergenic
983004226 4:162463668-162463690 TTTTCATACACAAATTTGTAAGG - Intergenic
984820871 4:183881015-183881037 ATATAATCAACAGAGCTGTAGGG + Intronic
986173714 5:5334221-5334243 TGGTCAGCCACAGAGTTGTAAGG + Intergenic
993666345 5:90702036-90702058 ATTTCACCTACAGTGTTGTCTGG - Intronic
993832181 5:92774034-92774056 ATTATATACACATAGTTGTAGGG + Intergenic
998279436 5:140791065-140791087 ATTTCATCCACAAACTAGTAAGG + Intronic
998326628 5:141286600-141286622 ATTTGATCCCCAGTGTTGGAGGG - Intergenic
999046114 5:148471509-148471531 CTTTCCTCCACATAGTTCTATGG - Intronic
1000767945 5:165315385-165315407 ATTTCATCCTGAGAATTGGAGGG + Intergenic
1001879277 5:175229182-175229204 ATTTAATCCCCAGTGTTGGATGG - Intergenic
1003267339 6:4577431-4577453 ATTTAATCCAAATAATTGTATGG + Intergenic
1004311258 6:14547314-14547336 ATTTCCTTCACAGAGTTGTCAGG - Intergenic
1004639053 6:17496238-17496260 ATTTCACCCACAGTTTTCTAAGG - Intronic
1005099269 6:22152443-22152465 AGTTCTTCCCCAAAGTTGTAAGG - Intergenic
1005281003 6:24273734-24273756 AATTCATCCTCAGAGTTATGAGG - Intronic
1006620596 6:35361207-35361229 ATTTAATCCCCAGAGGTGGAGGG - Intronic
1007182393 6:39938986-39939008 ATTTGATCCCCAGTGTTGGAGGG - Intergenic
1007964905 6:45995239-45995261 ATTTAATACATAGAGTTGTGGGG + Intronic
1010226090 6:73490690-73490712 ATTTCATCCTAAAATTTGTATGG - Intronic
1010729577 6:79375702-79375724 TTTTCCTCCACAGAGTTTTCAGG - Intergenic
1013316442 6:108947578-108947600 ATTTCATTCACAGGCTTGTGGGG + Intronic
1013841177 6:114396497-114396519 ATCTCTTCCACTGTGTTGTAAGG + Intergenic
1015438889 6:133224308-133224330 ATTTCATCCCCAGAGTCTCATGG + Intergenic
1017258081 6:152357181-152357203 ATTTCATCCACAGAGTTGTAAGG - Intronic
1020854716 7:13404471-13404493 ATTTCATCCATACTGTAGTAGGG + Intergenic
1022939546 7:35220093-35220115 ATTTCAGCCACAGACAGGTAAGG + Intronic
1026429548 7:70330623-70330645 AGCTGATCCACAGATTTGTATGG - Intronic
1027361986 7:77418305-77418327 ATTCCGGCCACTGAGTTGTAAGG + Intergenic
1028905323 7:96147856-96147878 ATTTCTTCCACATGGTGGTAGGG - Intronic
1029198641 7:98824121-98824143 ACTTTATCCAAAGAGTGGTATGG + Intergenic
1032470213 7:132172894-132172916 ATCCCATCCACAGAGTAATATGG + Intronic
1033149450 7:138900578-138900600 ATTTCAACCAGAGAGTTGGAGGG - Intronic
1033681028 7:143596930-143596952 ATTACAATCACAGAGTTGTTTGG + Intergenic
1033703864 7:143864883-143864905 ATTACAATCACAGAGTTGTTTGG - Intronic
1033902019 7:146155040-146155062 ATTGCTTCAACAGAGTTTTATGG + Intronic
1036051868 8:5207518-5207540 ATTTTATCCACAGTGTCATATGG - Intergenic
1038046890 8:23773107-23773129 TGTTAATCCACAGAGTTGTGTGG - Intergenic
1038130747 8:24728552-24728574 AATTCACCCACAGAATTGTCAGG + Intergenic
1041397493 8:57406575-57406597 ATTTCTTCCAGATAGTTCTATGG - Intergenic
1042957279 8:74264732-74264754 AATGCATCCACAGATTCGTAGGG + Intronic
1044000571 8:86874661-86874683 ATTTTATTCAAAGAGTTTTAAGG + Intronic
1046104903 8:109653541-109653563 CATTCATCCACAGGGTTGTGGGG - Intronic
1047753402 8:127899597-127899619 ATTTCATCCACAGAGACATCTGG + Intergenic
1048001611 8:130383865-130383887 ATTTCTCCCACAGAGGTGAAAGG + Intronic
1048025633 8:130584161-130584183 ATTTGATCCACAGTTTTGAAGGG - Intergenic
1048146988 8:131854724-131854746 ATCTGAGCCACACAGTTGTATGG - Intergenic
1048638510 8:136326446-136326468 ATAACACCCACAGAGTTTTATGG + Intergenic
1050562559 9:6849276-6849298 ATTTCTACCAGATAGTTGTATGG + Intronic
1051165026 9:14252776-14252798 TTTTCCTCCACAAAGTTGTATGG - Intronic
1051909671 9:22138936-22138958 ATTCAATCCAAAGAGTGGTAAGG - Intergenic
1055906216 9:81295966-81295988 ATTGAATCCACAGATATGTAGGG + Intergenic
1055920015 9:81450524-81450546 ATTTACTCCACAGAGTTATTGGG + Intergenic
1056460355 9:86803924-86803946 ATATCATTCTCAGAGTAGTATGG - Intergenic
1061984435 9:134121700-134121722 ATTTGATCCCCAGTGTTGGAGGG - Intergenic
1185672800 X:1825631-1825653 ATCTCATCCCCAGTGTTGGAGGG - Intergenic
1186776179 X:12866863-12866885 ATTTGGTCTACAGAGTTGTTTGG + Intergenic
1187170262 X:16844154-16844176 ATTTCATCCTCAGACTTGTTAGG + Exonic
1188238439 X:27756213-27756235 ATTTCAACATCAGATTTGTAGGG + Intergenic
1192526585 X:71850850-71850872 TTTTCATCCTCAGACTTGTTAGG - Intergenic
1193824597 X:86207397-86207419 ATTGCATCCACAGAATTGACTGG + Intronic
1195017637 X:100794848-100794870 ATTTCTTCAACAGACTTATACGG - Intergenic
1198234895 X:134727503-134727525 GTTTCATCAAAAGAGTTGTGGGG + Intronic
1200987151 Y:9314105-9314127 ATTTCACACACACAGTTGAATGG + Intergenic