ID: 1017258085

View in Genome Browser
Species Human (GRCh38)
Location 6:152357226-152357248
Sequence GCCTGAAGTCACCTAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017258081_1017258085 22 Left 1017258081 6:152357181-152357203 CCTTACAACTCTGTGGATGAAAT 0: 1
1: 0
2: 2
3: 16
4: 191
Right 1017258085 6:152357226-152357248 GCCTGAAGTCACCTAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017258085 Original CRISPR GCCTGAAGTCACCTAGTGTT GGG Intronic
No off target data available for this crispr