ID: 1017258245

View in Genome Browser
Species Human (GRCh38)
Location 6:152358869-152358891
Sequence TACGTCCAAATCTTCATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017258245 Original CRISPR TACGTCCAAATCTTCATTTA AGG (reversed) Intronic
901319702 1:8332254-8332276 TACATCCAAGTCTTCATGGACGG + Intronic
905949404 1:41935931-41935953 TACCACTAAATCTTCAGTTAGGG + Intronic
909394988 1:75160607-75160629 TACCCCCAAATCTTTATTTGGGG - Intronic
909980653 1:82096263-82096285 TGCTTCAAAATCTTCTTTTATGG - Intergenic
910097908 1:83545353-83545375 GATGTCCAAATCTTCAATTGAGG - Intergenic
910783589 1:90969191-90969213 TATGTCCTAATCTTCTTATAAGG - Intronic
911713479 1:101101674-101101696 TACATCCCACTATTCATTTAAGG + Intergenic
912030278 1:105232742-105232764 CAAGTTTAAATCTTCATTTAAGG + Intergenic
918632342 1:186732642-186732664 TGCATCCAAAGCTTCATTTTAGG - Intergenic
921811666 1:219521734-219521756 TTCATCCAAAGCTTCATATAAGG - Intergenic
1064319689 10:14292886-14292908 TACTTACAAATCTTCTTTAATGG - Intronic
1065877554 10:30010563-30010585 TAAACCCAAATCTGCATTTACGG - Intergenic
1067122731 10:43488200-43488222 TAAGTCCAAAGTTTTATTTAAGG - Intergenic
1069316356 10:67108376-67108398 TAGGTACAAATTTTCATTCACGG + Intronic
1074481883 10:113830050-113830072 TACGTGAAAATCATCATTTGTGG - Intergenic
1081074295 11:38650159-38650181 TATGTCCAAGTCCTCATTTACGG - Intergenic
1081140832 11:39497325-39497347 TACATCAAAATCTTCAGTTTTGG - Intergenic
1083497478 11:63069785-63069807 TACAGCCATATCTTCATTTGTGG - Intergenic
1086481106 11:87240443-87240465 TACTTCCAAATATGTATTTATGG + Intronic
1088717048 11:112558009-112558031 TATGTCCATATTTTCATTTCCGG + Intergenic
1089043980 11:115482877-115482899 AACTTCCAAATCTTAATATAAGG - Intronic
1093346541 12:18043244-18043266 CACTTCCCAATCTTCATTCAAGG + Intergenic
1093643683 12:21557061-21557083 TAGGTCAAAATCTACATTTGGGG + Intronic
1094046690 12:26175031-26175053 TGCCTACAAATCTTCATTTGTGG + Intronic
1106441167 13:29772764-29772786 TTCTTCCAAGTCTTCATTTTGGG - Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108546664 13:51501950-51501972 TGAGTCCTGATCTTCATTTAAGG + Intergenic
1111657331 13:91170308-91170330 TAGGTCTAAATCTTAGTTTATGG + Intergenic
1112520793 13:100093341-100093363 TTCTTCCAAATCCTAATTTAGGG - Intronic
1121744020 14:96273994-96274016 TATTTCCAAAGCTTCACTTAGGG + Intergenic
1129592882 15:76932353-76932375 TTCATCCACATCTTCCTTTAGGG - Exonic
1130448381 15:84025952-84025974 TACGTGCATATATTCATTTAAGG - Intronic
1130629930 15:85556896-85556918 CAAATCCAAATCTTCACTTAAGG - Intronic
1131946170 15:97624287-97624309 TAGGTTCAAATCTTAATTTTAGG + Intergenic
1143880206 17:10024196-10024218 TACCTTCAAGTCTTCACTTAAGG + Intronic
1144435406 17:15235397-15235419 AACGTGCAAATCTTCCTTTTAGG + Intronic
1153049563 18:888852-888874 TAAGCCCAAATTTTTATTTAAGG + Intergenic
1158402682 18:57135012-57135034 CTCGTCCTAATCTTCCTTTAGGG - Intergenic
1158861002 18:61592368-61592390 GATGTCCAAATCCTCATTTCTGG - Intergenic
1159303248 18:66605816-66605838 TACTTCCAAGTCTTCATTCTTGG - Intergenic
1161099437 19:2414051-2414073 TACGTGCCTATCTTGATTTAGGG + Intronic
1161653852 19:5501161-5501183 TGGGTCCAAATCTTCAATTCTGG + Intergenic
1164108894 19:22136240-22136262 TACGTCATAATCTTCTTTGAGGG - Intergenic
1164187469 19:22883203-22883225 TAGGTCCCTACCTTCATTTAAGG + Intergenic
1166473923 19:43104188-43104210 TAGGTCCCTATGTTCATTTAAGG - Intronic
1168564223 19:57409699-57409721 TATGTCCATATCTTTATTTGTGG + Intronic
925530663 2:4858089-4858111 TACTTTCATATCTACATTTAGGG - Intergenic
927235553 2:20871326-20871348 TACTTCCAAATGTTCAGTCAAGG - Intergenic
929307922 2:40386699-40386721 TAAGTCCATATATTCATGTACGG + Intronic
929951819 2:46417029-46417051 AACGTCCAAAGGTTCATTCAGGG + Intergenic
930575832 2:53147263-53147285 TAATTGCAAATCTTCATTCATGG - Intergenic
931314856 2:61119358-61119380 GAAGTCCAATTTTTCATTTATGG - Intronic
935024218 2:99261055-99261077 TACCTCCAAATGAACATTTATGG - Intronic
937784651 2:125881935-125881957 TACCTCCTAATGTTCATTTTTGG + Intergenic
937811486 2:126204336-126204358 TACGTCAATATTTCCATTTACGG - Intergenic
939593651 2:144098192-144098214 TACGTCAAAATTTTCAGTTAAGG + Intronic
943487520 2:188505018-188505040 TACTTCCAAAAATTTATTTAAGG - Intronic
944163866 2:196696058-196696080 TAAGTCTAAATCTTCTTATATGG + Intronic
1169391192 20:5192580-5192602 TACATTCAAATCTTCATGAATGG + Exonic
1178314048 21:31554505-31554527 TACACCCAAGTCTTCCTTTAAGG + Intronic
1178777599 21:35567059-35567081 AACATCCAAATCTTCATAAAGGG + Intronic
1181446675 22:22981784-22981806 AACAACCAACTCTTCATTTAAGG - Intergenic
1182096965 22:27632540-27632562 TACTTCCAATGCTTCCTTTACGG - Intergenic
1182867977 22:33621470-33621492 TTGGTGCAAATTTTCATTTAAGG - Intronic
1185309356 22:50145576-50145598 TACGTCTAAGTCATGATTTAAGG - Intronic
951510272 3:23492672-23492694 TAAGTCTAAATCTTGATTGAAGG - Intronic
951723253 3:25724880-25724902 TACCTCCAGATTTTCATTCATGG + Intronic
951799074 3:26575151-26575173 CACGTGCAAATCTTTTTTTAGGG - Intergenic
952019004 3:28994572-28994594 TAGGTACAAATCTTCACTTCAGG + Intergenic
956858771 3:73301993-73302015 TACATCTAAAGCTTCATTTTCGG + Intergenic
970083552 4:12319001-12319023 TACGTTCAATTGTTCACTTATGG + Intergenic
971676623 4:29638753-29638775 TGCTTGCAAATCTGCATTTATGG - Intergenic
974305690 4:60136644-60136666 TACGTCTAAATATTTATCTAAGG - Intergenic
981345454 4:143671421-143671443 TACTTCCAGCTCTTTATTTATGG + Intronic
982222535 4:153137266-153137288 AACTTCCAGACCTTCATTTATGG - Intergenic
982602810 4:157472985-157473007 TACGTGGAAATCTTGTTTTAGGG - Intergenic
987069678 5:14323925-14323947 TACGTGAAAGTCTTCCTTTATGG + Intronic
989474046 5:41853989-41854011 TCCATCCAAATCTTCATTTTGGG - Intronic
995008804 5:107234196-107234218 TACTTCCAAATCTTTAATTTTGG + Intergenic
1000210520 5:159103218-159103240 TACTTCTAAATCTTCATGTGAGG + Intergenic
1004583962 6:16981377-16981399 TAGGTCCAAATGTTCATTTGGGG + Intergenic
1005019461 6:21403960-21403982 TACGTCCAAAACTTCAATATGGG + Intergenic
1012661064 6:101892663-101892685 TAAGTTTAAATCATCATTTATGG + Intronic
1013026634 6:106280311-106280333 TATGTCCATATGTCCATTTAAGG + Intronic
1013750089 6:113395704-113395726 AAACTTCAAATCTTCATTTACGG + Intergenic
1014860416 6:126460257-126460279 TACTTACAAATCTTAAATTAAGG - Intergenic
1016125934 6:140403359-140403381 TAGGTGAAAATATTCATTTATGG + Intergenic
1017062442 6:150497237-150497259 TATGTCCAAATGCTAATTTAGGG + Intergenic
1017258245 6:152358869-152358891 TACGTCCAAATCTTCATTTAAGG - Intronic
1017657940 6:156647894-156647916 TACTTCCAAAGCTTTATTCATGG - Intergenic
1018399577 6:163409408-163409430 TACCTCTAAAGTTTCATTTAGGG + Intergenic
1020727092 7:11829690-11829712 AACTTCTAAATTTTCATTTATGG + Intronic
1021173495 7:17423100-17423122 TACTTCCAAATCTTTAATTTGGG - Intergenic
1027718291 7:81703524-81703546 TACATGCATATATTCATTTATGG + Intronic
1031125031 7:117763903-117763925 TATTTCCCAATCTTCTTTTAGGG + Intronic
1031967595 7:128038620-128038642 AACTTTCAATTCTTCATTTAAGG + Intronic
1033822832 7:145154448-145154470 TACATCCTAATATTCACTTATGG + Intergenic
1035636297 8:1147061-1147083 AATGTCCAAATTTTAATTTACGG - Intergenic
1037118757 8:15257723-15257745 TTAGTCCAACTCTTCTTTTATGG + Intergenic
1040656511 8:49516440-49516462 TGCATCCAAATCTTTATTTCAGG - Intergenic
1040728757 8:50416745-50416767 GATGTCAAAGTCTTCATTTATGG - Intronic
1041713845 8:60915900-60915922 TACTTCCAAATTGTCATTTCTGG + Intergenic
1045770088 8:105726809-105726831 TACTTCCAAAACTTAATTCACGG - Intronic
1046304227 8:112341628-112341650 TACTTCCAAATAATCATGTATGG + Exonic
1046570237 8:115954526-115954548 TATGTATAAATCTTCAGTTATGG + Intergenic
1047493420 8:125392065-125392087 TACATGCAAATCTTCATCTCAGG + Intergenic
1048826388 8:138431682-138431704 TTCCTCAAAATCTTCATTTATGG - Intronic
1050083887 9:1943711-1943733 TATCTCTAAAACTTCATTTAGGG + Intergenic
1050298987 9:4237631-4237653 TACTTCTAAATGTACATTTATGG - Intronic
1052045777 9:23792615-23792637 TACATACAGACCTTCATTTAAGG + Intronic
1061524863 9:131151674-131151696 TACGTCCAAATCTTTCTGTTTGG - Intronic
1062016521 9:134293880-134293902 CACGTCCAAATCCCCATTTCTGG + Intergenic
1188279825 X:28252683-28252705 TACAACCAAATCTTTATTTTGGG + Intergenic
1196628948 X:117913326-117913348 TAAGTCCAATTATCCATTTATGG - Intronic
1198816238 X:140594027-140594049 TACTTCCAAGTCTTCATTGGCGG + Intergenic