ID: 1017258543

View in Genome Browser
Species Human (GRCh38)
Location 6:152361946-152361968
Sequence ATGGATCTACATGGTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017258543 Original CRISPR ATGGATCTACATGGTTTTCC TGG Intronic
900098055 1:948368-948390 ATGGACCTTCATGGTCTCCCAGG - Intronic
903197017 1:21697841-21697863 ATGGATCTAAAGGCTTTTCCTGG + Intronic
906707400 1:47904707-47904729 GTGAATCAACATGGCTTTCCAGG - Intronic
907071226 1:51536763-51536785 AGGGATTTACATATTTTTCCAGG + Intergenic
908800654 1:67876833-67876855 AGGGAGCTACAGGGGTTTCCAGG + Intergenic
908862172 1:68501463-68501485 ATGTATTTACATGGTTTTGAAGG - Intergenic
909548895 1:76876795-76876817 ATGGTTCTGCATGGTTATGCAGG - Intronic
910077892 1:83301691-83301713 ATGTATTTACATGGTTTTGAAGG - Intergenic
910540857 1:88355305-88355327 ATGGATCTTCAGGGTTTTTGTGG - Intergenic
911318098 1:96378994-96379016 ATGTATTTACATGGTTTTGAAGG - Intergenic
912877259 1:113372577-113372599 ATAGATTTAAATGGTTTGCCTGG - Intergenic
912912111 1:113772833-113772855 AGAGATTTACATGTTTTTCCAGG - Intronic
918045764 1:180940085-180940107 ATGGGTCTCCTTGGTTTTCATGG + Intronic
918314330 1:183310501-183310523 AGGGGTCTTCCTGGTTTTCCTGG - Intronic
922151310 1:223007217-223007239 TTAGATCTGCATGTTTTTCCAGG + Intergenic
1065344974 10:24739988-24740010 ATGGAACTACCAGGTTTTCTGGG + Intergenic
1067179004 10:43970918-43970940 CTGGATCTACAAGGATGTCCAGG + Intergenic
1067759345 10:49031857-49031879 ATGGATCTCCATGTGTTTCCTGG + Intronic
1068172839 10:53418643-53418665 ATGTATTTGCATGGTTTTGCGGG + Intergenic
1068939937 10:62670785-62670807 ATGGATCTAAATGGAATTCCAGG + Exonic
1071484913 10:86093079-86093101 ATGGATTTGCATGGTTTTGAAGG - Intronic
1072768886 10:98119838-98119860 ATGAGTCTTCAGGGTTTTCCAGG + Intergenic
1075150120 10:119921231-119921253 ATGGATATTTAAGGTTTTCCTGG + Intronic
1078576223 11:12504820-12504842 ATGGTTCTCCATGGTTTGCAGGG - Intronic
1078830536 11:14973035-14973057 AGGGATCTACAAGAGTTTCCTGG + Intronic
1079134552 11:17768999-17769021 TTGCTTCTACATTGTTTTCCTGG + Intronic
1081010752 11:37809687-37809709 ATCTATCTACATTGTTTTTCAGG + Intergenic
1081020584 11:37942994-37943016 AGGGATCTTCAGGGTTTTCTGGG + Intergenic
1083375405 11:62216260-62216282 TTGGATATACCTGGCTTTCCAGG - Intergenic
1084291532 11:68172929-68172951 GAGGAGCTACATGTTTTTCCTGG + Intronic
1090428535 11:126627326-126627348 ATGCTTCAACATGGTTTTCAAGG - Intronic
1091877761 12:3950562-3950584 ATGGATCTACCTGGTTTCCTGGG - Intergenic
1093488473 12:19678937-19678959 ATGTATTTGCATGGTTTTCAAGG + Intronic
1094164222 12:27425729-27425751 CTGGATCAACTTGGTTTACCTGG + Intergenic
1096522706 12:52193170-52193192 CTGGATCTGCATGTCTTTCCTGG + Intergenic
1098350857 12:69558505-69558527 AAGGAACTACCTGGTTCTCCTGG + Intronic
1098468245 12:70813835-70813857 CTTGCTCTACAGGGTTTTCCTGG + Intronic
1099624061 12:85046116-85046138 ATGGATGAACATGTTTTACCAGG + Exonic
1099864756 12:88265559-88265581 ATGAATCTACATTGATTTCTGGG + Intergenic
1100918771 12:99458124-99458146 ATGTATTTGCATGGTTTTCAGGG - Intronic
1101295202 12:103415977-103415999 ATGGGTCTACATGATTTAGCAGG + Intronic
1101568747 12:105934094-105934116 ATGGATGTCCATGGTCTTCCTGG - Intergenic
1103218326 12:119221331-119221353 ATAGATATACATAGTTTTGCTGG + Intergenic
1108106510 13:47016483-47016505 ATGGATACACATGGAATTCCAGG + Intergenic
1110257435 13:73447147-73447169 GTGGACCTAAATGGTTTTTCAGG + Intergenic
1110635193 13:77759332-77759354 ATGAATCTTCAGGGTTTTCTAGG + Intronic
1111600073 13:90461622-90461644 TTGGATCTAAATGTGTTTCCAGG - Intergenic
1114942791 14:27636398-27636420 ATGGATCTACCTGTTTTTTTAGG + Intergenic
1116213026 14:41972323-41972345 ATGGAAGCACATGGATTTCCAGG - Intergenic
1116633074 14:47358072-47358094 ATGGATCCAACTGGTTTTCTGGG - Intronic
1118165854 14:63335261-63335283 ATGGATTTGCATGGTTTTGAAGG - Intergenic
1121709867 14:96029962-96029984 ATGGATCTTACAGGTTTTCCAGG - Intergenic
1125234456 15:37496449-37496471 ATGGATGTGAATGGTTTTCTGGG + Intergenic
1125277547 15:38009242-38009264 ATGGATTTATTTGGCTTTCCTGG - Intergenic
1128238989 15:66087522-66087544 ATGTATTTACATGGTTTTGAAGG - Intronic
1130052633 15:80496587-80496609 CTGGTTCTATATGGTTATCCAGG - Intronic
1130744833 15:86639807-86639829 ATTAATATACATGGGTTTCCCGG - Intronic
1132014422 15:98303110-98303132 ATGGCTCTTCTTGGGTTTCCTGG - Intergenic
1132326687 15:100976200-100976222 CTAGGTCTACATGGTTTTACTGG + Intronic
1133434310 16:5766142-5766164 ATAGATATTCATGGTATTCCAGG + Intergenic
1138969531 16:62128126-62128148 CTGGATCTAAAAAGTTTTCCAGG + Intergenic
1139131409 16:64150752-64150774 ATGAATATACATGGTCTTCTAGG + Intergenic
1139967852 16:70755572-70755594 ATGAATCCACATGGTGGTCCAGG - Intronic
1140884452 16:79230513-79230535 TTTGTACTACATGGTTTTCCAGG - Intergenic
1141285052 16:82663669-82663691 ACGGATCTTAATAGTTTTCCAGG - Intronic
1144278132 17:13696802-13696824 ATGTATTTACATGGTTTTGAAGG + Intergenic
1144314727 17:14048913-14048935 AAGGATCTTCATGGCTTCCCAGG - Intergenic
1149577373 17:57723844-57723866 ATGGATCCACAGGGTTTCTCAGG + Intergenic
1150426892 17:65084389-65084411 ATGGCTCTTCCTGGGTTTCCGGG - Intergenic
1153782955 18:8510197-8510219 ATGGATCTAGATTTCTTTCCAGG + Intergenic
1155841439 18:30648849-30648871 ATGAATCTAAATGTTTTTCCAGG + Intergenic
1156327048 18:36084016-36084038 ATGAATCTTTATGGTTTTCTAGG - Intergenic
1156558503 18:38094485-38094507 ATGGATTGGCATGGCTTTCCAGG + Intergenic
1158046284 18:53159192-53159214 ATGTTTTTACATGGATTTCCTGG + Intronic
1159822114 18:73158522-73158544 GTAGATCCACATGGTTTTTCCGG - Intronic
1163908005 19:20164286-20164308 ATGGATTTGCATGGTTTTGAGGG - Intergenic
1165646717 19:37445538-37445560 ATGAATCTTTAGGGTTTTCCAGG - Intronic
926395433 2:12436968-12436990 ATGAATCTCCCTCGTTTTCCTGG + Intergenic
927036481 2:19182748-19182770 ATGTATTTTCATGGTTTTCAGGG + Intergenic
927409267 2:22806135-22806157 ATGGAAATACATGGATGTCCAGG - Intergenic
933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG + Intergenic
937561377 2:123228816-123228838 ATGTATGTACATGGTTTTGAAGG + Intergenic
941247077 2:163112295-163112317 TTGGATCTAAATGTTTTTCTTGG - Intergenic
942405557 2:175650405-175650427 ATGCATTTACATGGTTTTGAGGG - Intergenic
944140072 2:196446504-196446526 CTGGACCTACATGGTTTTCTTGG + Intronic
947477493 2:230463962-230463984 ACGGATTTTCAAGGTTTTCCAGG + Intronic
948731913 2:239970066-239970088 ATGCATCTGCGTGGTTTTCTTGG - Intronic
1170214629 20:13878246-13878268 ATTGCTCTACATGGTTTCCAAGG - Intronic
1171048047 20:21829545-21829567 CTGGATCTAGATGTTATTCCCGG + Intergenic
1174649186 20:52110320-52110342 AAGGCTCTCTATGGTTTTCCAGG - Intronic
1177364215 21:20113342-20113364 ATGAGTCTTCAGGGTTTTCCAGG + Intergenic
1178303344 21:31470764-31470786 CTGTTTCTACATGGTTTTCCCGG - Intronic
1178444977 21:32631458-32631480 TTGGCTCTAAATGGGTTTCCAGG + Exonic
1183794566 22:40105026-40105048 ATATGTCTACATGGTTTTCTAGG + Intronic
949893679 3:8753147-8753169 CTGGATCTACATGCTGTTCACGG - Exonic
951137888 3:19125405-19125427 ATTGATCTAAATTTTTTTCCTGG + Intergenic
951658090 3:25031559-25031581 ATGAATCTACTTAGTTTTCAAGG - Intergenic
952997472 3:38898841-38898863 ATGGAACCACAGGTTTTTCCTGG - Intronic
953185518 3:40634180-40634202 ATGTATTTGCATGGTTTTCAGGG - Intergenic
954984825 3:54780568-54780590 ATGGACCTGCATGTTTTTCCTGG - Intronic
955223138 3:57039587-57039609 ATGGGTCTACATGGCCTTGCAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957130644 3:76219192-76219214 ATGGTTTTACATGGTTTTTAAGG - Intronic
957273716 3:78063541-78063563 ATAGATCTCCATGTTTTTCTTGG - Intergenic
959424052 3:106164101-106164123 ATGTATTTACATGTTTTTCAGGG - Intergenic
959507406 3:107171394-107171416 ATGGAAATACCTGGATTTCCAGG + Intergenic
965874146 3:173297058-173297080 ATGTATTTACATGGTTTTGAAGG + Intergenic
970346493 4:15157952-15157974 ATGTATTTGCATGGTTTTCAAGG + Intergenic
971554741 4:27999733-27999755 ATGTATTTGCATGGTTTTCAGGG + Intergenic
972273365 4:37534292-37534314 ATGGATTTACATGACTTTCCTGG - Intronic
972853203 4:43074641-43074663 GTTGTTCTACTTGGTTTTCCAGG - Intergenic
973725786 4:53774235-53774257 AAGGATCTACTTGGTTTCCATGG + Intronic
975617354 4:76259804-76259826 ATGAATCTTCAAGGTTTTCTGGG - Intronic
978134787 4:105244351-105244373 ATGGATATATATTATTTTCCAGG + Intronic
978426732 4:108591201-108591223 GTAGATCTAAATGGTTTTCTGGG + Intergenic
979984702 4:127299250-127299272 ATGTATTTACATGGTTTTGAGGG - Intergenic
980523842 4:133963688-133963710 ATGTATTTTCATGGTTTTGCAGG - Intergenic
983147738 4:164239024-164239046 ATGGATCACCATTGTTTTTCAGG + Intronic
983291869 4:165817461-165817483 ATAGACCCACATGGTTTTCTAGG - Intergenic
984234225 4:177136990-177137012 ATGGATTATCTTGGTTTTCCTGG - Intergenic
984266421 4:177502735-177502757 ATGTATTTGCATGGTTTTCAAGG + Intergenic
984859687 4:184226854-184226876 ATGTATCTTCATGATTTACCTGG - Intergenic
985304317 4:188522078-188522100 ATGGAAATACCTGGTTGTCCAGG + Intergenic
986027327 5:3863376-3863398 AAGGGTCTACATCATTTTCCTGG - Intergenic
986259238 5:6128669-6128691 ATGTATTTACATGATTTTCAGGG - Intergenic
988098151 5:26644324-26644346 CTGGATCAACATTGTTTTTCTGG - Intergenic
988121711 5:26972442-26972464 TTTGATATACATGGGTTTCCTGG - Intronic
988619949 5:32812691-32812713 ATGGATATGCATGGTTCTTCAGG - Intergenic
994220933 5:97193745-97193767 ATGGATTCTCTTGGTTTTCCTGG + Intergenic
997668579 5:135651803-135651825 ATGGATCTACATAGATTTATAGG + Intergenic
999348156 5:150842708-150842730 TTTGATCCACATTGTTTTCCGGG + Intergenic
1000639510 5:163685026-163685048 TTGGCTCTTCCTGGTTTTCCAGG - Intergenic
1006935753 6:37716313-37716335 ATGGACCTCCCTGGTTATCCTGG - Intergenic
1008889422 6:56469799-56469821 TTTGATCTCCATTGTTTTCCAGG - Intronic
1009693753 6:67069341-67069363 ATGGAAATACCTGGATTTCCAGG + Intergenic
1010323626 6:74540850-74540872 ATGGCTCTGCATGATTTTCAGGG + Intergenic
1010355594 6:74928755-74928777 ATGTATCCACATTGTTTGCCTGG - Intergenic
1014337066 6:120149886-120149908 ATGTATTTGCATGGTTTTCAAGG - Intergenic
1014917713 6:127172519-127172541 ATGAAGGTAAATGGTTTTCCAGG + Intronic
1015644035 6:135367069-135367091 ATGTATTTACATGGTTTTGAGGG + Intronic
1015663070 6:135598028-135598050 ATGTATTTACATGGTTTTGAAGG + Intergenic
1016289726 6:142515903-142515925 ATGTATTTGCATGGTTTTCAAGG + Intergenic
1017258543 6:152361946-152361968 ATGGATCTACATGGTTTTCCTGG + Intronic
1020348814 7:7195465-7195487 ATGTATTTACATGGTTTTGAGGG + Intronic
1022021781 7:26406569-26406591 ATGGCTCCACATGGGTCTCCTGG - Intergenic
1022551339 7:31242356-31242378 ATGGGTCTACATTGTTTTCCAGG + Intergenic
1023271195 7:38464629-38464651 ATTGAACTACATGGTTTCCAAGG - Intronic
1023320764 7:38995039-38995061 ATGAATATGCATGGCTTTCCAGG - Intronic
1023537505 7:41229033-41229055 ATGGATTTCCATGGTTTTGAGGG + Intergenic
1024168742 7:46762291-46762313 ATGGAACTGCATTGTTTTCTGGG + Intergenic
1024455984 7:49607416-49607438 ATGTATTTACATGGTTTTGAGGG - Intergenic
1024729225 7:52235922-52235944 ATGGAAATACATGGATATCCAGG + Intergenic
1026777741 7:73241415-73241437 ATGGATGTGCATTTTTTTCCTGG - Intergenic
1027018591 7:74794807-74794829 ATGGATGTTCATTTTTTTCCTGG - Intergenic
1027069437 7:75151130-75151152 ATGGATGTGCATTTTTTTCCTGG + Intergenic
1027562963 7:79755415-79755437 ATGTATTTACATGGTTTTGTGGG + Intergenic
1030210496 7:106991058-106991080 ATGATTTTAAATGGTTTTCCTGG - Intergenic
1030414749 7:109229032-109229054 ATGTACATACATGATTTTCCAGG + Intergenic
1032256010 7:130297615-130297637 ATGGCTCTTCAGGGTTTTGCTGG - Intronic
1032333784 7:131005407-131005429 GTGTGTCTACATGCTTTTCCAGG - Intergenic
1033022339 7:137739046-137739068 GTGGCTCTGCATGGTTTTGCTGG - Intronic
1035827499 8:2660260-2660282 ATGTATCTACATTGTATTCTGGG - Intergenic
1038661860 8:29504387-29504409 ATGGATATACTCGCTTTTCCAGG + Intergenic
1039775677 8:40733837-40733859 ATGAATCCCCATGGTATTCCAGG + Intronic
1043686295 8:83090781-83090803 ATGGATATACACGGACTTCCAGG + Intergenic
1044903562 8:96974712-96974734 ATGTATTTACATGGTTTTAAGGG - Intronic
1044976736 8:97672536-97672558 AGGGATAAATATGGTTTTCCTGG - Intronic
1047379135 8:124340159-124340181 ATGGATCCAAATTGTTTTTCTGG - Intronic
1048670250 8:136711169-136711191 ATGGAAGTATATGGTTTTCTAGG - Intergenic
1050105959 9:2167160-2167182 AGCAATCTACATGCTTTTCCAGG + Intronic
1050147628 9:2586047-2586069 ATGTATTTACATGGTTTTGACGG - Intergenic
1050187253 9:2987461-2987483 ATGCATGTACATGTTTTTGCAGG - Intergenic
1051455718 9:17255768-17255790 ATGGGTCTAGATGGTTTCACTGG - Intronic
1052307468 9:27026671-27026693 ATGTATCTGCATGGTTTTTAAGG - Intronic
1052564810 9:30135861-30135883 ATGTATTTACATGGTTTTGAGGG - Intergenic
1052583032 9:30385891-30385913 ATGAATATACATGGTTATCTGGG - Intergenic
1053740941 9:41137264-41137286 ATGTATCTGCATGGTTTTGAAGG + Intronic
1054443929 9:65293406-65293428 ATGTATCTGCATGGTTTTGAAGG + Intergenic
1054486344 9:65728100-65728122 ATGTATCTGCATGGTTTTGAAGG - Intronic
1054687409 9:68294033-68294055 ATGTATCTGCATGGTTTTGAAGG - Intronic
1056166554 9:83946693-83946715 ATGGAGTTTCATCGTTTTCCAGG - Intronic
1056856671 9:90136121-90136143 ATTCATCTATTTGGTTTTCCTGG + Intergenic
1059164899 9:112068284-112068306 ATAGAACTACATGGAGTTCCTGG + Intronic
1186730422 X:12403598-12403620 AAGGATATACAGGGTTTTCAGGG - Intronic
1186943401 X:14538027-14538049 ATGGACCCACAAGGTTTTTCAGG + Intronic
1189931956 X:46021949-46021971 ATGTATTTACATGGTTTTGAAGG - Intergenic
1190159898 X:48024198-48024220 ATTGATCTATATGTTTATCCTGG + Intronic
1191954397 X:66628034-66628056 ATGTATCTGCATGGTTTTGAAGG - Intronic
1191955977 X:66642674-66642696 AAGGAGCTTCATGGTTATCCAGG + Intergenic
1193541004 X:82772725-82772747 ATGTATCCACATGGTTTTGAAGG + Intergenic
1194466377 X:94239099-94239121 ATGTATTTACATGGTTTTGAAGG - Intergenic
1194902024 X:99523756-99523778 ATGTATATACATAGTTTTCATGG - Intergenic
1197132689 X:123022841-123022863 ATGTATTTGCATGGTTTTGCAGG - Intergenic
1197476081 X:126927258-126927280 ATGTATTTACATGGTTTTGAAGG + Intergenic
1197545649 X:127820471-127820493 ATGTGTCTTCATGGTTTTCCAGG - Intergenic
1198921486 X:141733551-141733573 ATGCATCACCATGTTTTTCCTGG - Intergenic
1198950213 X:142061343-142061365 ATGAGTCTTCATGGTTTTCTAGG + Intergenic
1201242038 Y:11968482-11968504 ATAGATTTTCATAGTTTTCCTGG - Intergenic