ID: 1017261154

View in Genome Browser
Species Human (GRCh38)
Location 6:152389361-152389383
Sequence CACTGGTGCCTCCTTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3464
Summary {0: 1, 1: 36, 2: 332, 3: 931, 4: 2164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017261154 Original CRISPR CACTGGTGCCTCCTTGAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr