ID: 1017272315

View in Genome Browser
Species Human (GRCh38)
Location 6:152522213-152522235
Sequence TTGGAGACTCAGAAGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 11, 2: 79, 3: 221, 4: 626}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017272315 Original CRISPR TTGGAGACTCAGAAGGATGA GGG (reversed) Intronic
900724415 1:4206233-4206255 ATAGAGACTCAGAAGTGTGAGGG - Intergenic
900781053 1:4617424-4617446 TTAGAGACTGAGAAGTTTGAGGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904574795 1:31498421-31498443 TGGGAGACTGAGCAGGAGGATGG - Intergenic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
907303498 1:53502060-53502082 GTGGAGACAGAGGAGGATGAAGG + Intergenic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
907960361 1:59274148-59274170 TTAGAGACTCAGAAGGCAGGGGG + Intergenic
908775899 1:67639648-67639670 TGAGAGACTAAGAAGGAAGAGGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911425686 1:97708083-97708105 CTGGCTACTCAGAAGGCTGAGGG - Intronic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
913576250 1:120178075-120178097 TTAGAGACTTAGAAGGCGGAGGG - Intergenic
913613589 1:120533027-120533049 TTGAAGACTGAGAAAGTTGAAGG + Intergenic
914430137 1:147613216-147613238 TTTGAGACTCAGAGGGAAGTAGG + Intronic
914577483 1:148988224-148988246 TTGAAGACTGAGAAAGTTGAAGG - Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915414710 1:155732529-155732551 TTGGAGACAAAGAAGCATCAAGG - Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916790199 1:168118442-168118464 ATGGAGACTCACGAGGGTGAGGG + Intronic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919412527 1:197264130-197264152 ATGGAGACTTGGAAGGTTGAGGG - Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920341898 1:205280357-205280379 GCTGAGGCTCAGAAGGATGAAGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922664387 1:227456188-227456210 TTGGAAATTCTGAAGGAGGATGG - Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923822014 1:237455225-237455247 TTGGAGACTACGAGGGTTGATGG + Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
923944843 1:238873026-238873048 TTGGAGACTCGGTAGGGAGAGGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
924716857 1:246583352-246583374 TTTGAGAGTCAGAGGAATGAAGG - Intronic
1063078507 10:2741425-2741447 ATGGAGACTGGGAAGGGTGAGGG - Intergenic
1063281520 10:4634289-4634311 TTGGAGACTGAGAAGGAGGGAGG + Intergenic
1063288539 10:4716137-4716159 TTGGAGACCCAGAAGCGTGGAGG - Intergenic
1063518552 10:6720322-6720344 TTGGAGACTAGGAAGGACGAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064072995 10:12246680-12246702 TGGGAGACTGAGAAGCATCAAGG - Intronic
1064148820 10:12846266-12846288 TTGGAAACTGACAAGGTTGAAGG + Intergenic
1064235569 10:13571079-13571101 TTAGAGATTCAGAAGGAAGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067010882 10:42712521-42712543 TTGGAGACTCATAAGCAGGGAGG - Intergenic
1067312627 10:45128652-45128674 TTGGAGACTCATAAGCAAGGAGG + Intergenic
1067550337 10:47229835-47229857 TTGGAAACTCAGAATCAGGAAGG - Intergenic
1067760200 10:49039251-49039273 TTGGGGTCTCAGCAGGATGAGGG + Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1067968518 10:50942282-50942304 ATGGAGCCTCAGAAGTGTGAGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072270471 10:93771504-93771526 TGGGAGACTGAGAAGGGTGGGGG + Intronic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1074357748 10:112801022-112801044 CTGGAGGCTGAAAAGGATGAGGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075166707 10:120074567-120074589 GTGGTGGCTGAGAAGGATGAGGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079252897 11:18800409-18800431 CTGGAGACTTGGAAGGGTGAAGG + Intergenic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1083065622 11:59921218-59921240 TTGGAGAGTAATAAGAATGAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084740527 11:71136475-71136497 CAGGAGACTCAGAAGGGTGGTGG + Intronic
1085048866 11:73369190-73369212 TTGGAGACCCAGAAGAGTGCTGG + Intergenic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1086845091 11:91739005-91739027 TTGATGACTCAGAAGCAGGAGGG + Intergenic
1087745519 11:101941224-101941246 TTGGAGACAGATAATGATGATGG - Intronic
1088202981 11:107360115-107360137 ATAGAGACTCAGAAGAATAAGGG - Intronic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1088793629 11:113248748-113248770 GTGGCGACTCAGAAGGAGAAGGG + Intronic
1089666444 11:120023310-120023332 GTGGAGTCTCAGATGGATGCCGG - Intergenic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092614378 12:10203050-10203072 TAGGAGTCTCAGAGAGATGATGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093379702 12:18477752-18477774 TTTGTGACTCTGAAGAATGAAGG + Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094057332 12:26280593-26280615 CTGGAGACTTGGAAGGATAAGGG + Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094415903 12:30214547-30214569 TTGGAAACTCAGAAGGGTGGTGG - Intergenic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1096196140 12:49649975-49649997 TTGGAGAATAAAAGGGATGAGGG - Intronic
1096629719 12:52918345-52918367 TTGGAGCCTCAGAAACATGCAGG + Intronic
1096756994 12:53808098-53808120 TTAGAGACTCATAAGTTTGAAGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097924736 12:65114866-65114888 GTGGAGATTCAGAAAAATGAAGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098300740 12:69051867-69051889 TTGGAGACTCAGTGGGAAAAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099054687 12:77824473-77824495 TTGGAGCCCTAGAAGGAAGAGGG + Intergenic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101831750 12:108263277-108263299 TTCCAGACTCAAAAGGAGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102724327 12:115045909-115045931 TTGGATACTAAGAATGACGATGG + Intergenic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1104190393 12:126476799-126476821 TTGGAGACTTGGAAGGGTCAGGG + Intergenic
1104244449 12:127024313-127024335 TTAGAGACTCTGAAGGAGGAAGG + Intergenic
1104584090 12:130033926-130033948 TGAGAGCCTCAGAAGGAAGATGG - Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1107709592 13:43138657-43138679 TTGGAGACTCAAGAGAAAGAGGG + Intergenic
1107959191 13:45543621-45543643 TTGGAGCCTCTGGAGGATGGTGG + Intronic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108252135 13:48577931-48577953 TTTGTGTCTCAGAAGGAGGAAGG - Intergenic
1108605344 13:52031812-52031834 TCTGAGACTCAGAAAGATAAAGG - Exonic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108956107 13:56159371-56159393 AGGGAGTCTCAGAAGGCTGAAGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110054890 13:70955129-70955151 TTGCAGACTGAGAAGTGTGATGG - Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1110796944 13:79649952-79649974 TTGGAGACTCGGAAGTAGGGAGG - Intergenic
1110889923 13:80686381-80686403 TTAGAGATTCAGAAGGTTAAAGG + Intergenic
1111164542 13:84441853-84441875 TTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115251413 14:31352471-31352493 TTGTAGCCTCAGCAGAATGATGG - Intronic
1115371366 14:32618351-32618373 TTGGCGACTCAGAAGCAGGGAGG - Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116142921 14:41023104-41023126 ATGGTGACTCAGAGGAATGAGGG - Intergenic
1116342859 14:43748281-43748303 TTGGATACTCAAAAGGGTGAGGG + Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1116941760 14:50797926-50797948 TGGGAGACTGAGGAGGAGGAGGG + Intronic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1117749717 14:58908613-58908635 CTGGAGACTTGGAAGGGTGAGGG + Intergenic
1118133276 14:62991982-62992004 TTGGAGACTTGGGAGGGTGAAGG - Intronic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118586042 14:67354049-67354071 CTGGAGGCTGAGAAGGGTGAGGG - Intronic
1118918136 14:70125330-70125352 TTGGAGACTCGGAAGGGTGGGGG - Intronic
1119080479 14:71688647-71688669 GGGGAGAGTCAGATGGATGAGGG - Intronic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1119817081 14:77579332-77579354 GTGGAGACTTGGAAGGGTGAGGG - Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120918864 14:89736083-89736105 TTGGAGACTCAAAAGGTTTGTGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122328350 14:100896383-100896405 ATGGAGACTGAGCAGGACGAGGG + Intergenic
1123540800 15:21288183-21288205 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
1124064913 15:26333387-26333409 CTGGAGACTCTAAAGGATGGGGG + Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124814617 15:32976913-32976935 TTGCAGAGTCACAAGGATGAAGG - Intronic
1125141817 15:36417418-36417440 TTTGAGAGTCTGAGGGATGATGG - Intergenic
1126225308 15:46262611-46262633 TTGGACACTCTGAAGCCTGAAGG + Intergenic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127823350 15:62680736-62680758 TTAGAGACTCAGAAGGGAAAGGG - Intronic
1128691618 15:69728440-69728462 TTGAAGACTCAGAAGCAGGGAGG - Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1130636020 15:85620805-85620827 TTGGTGTCTAAGCAGGATGAGGG + Intronic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1131499018 15:92942902-92942924 TTTGACACTGAAAAGGATGAAGG + Exonic
1131572089 15:93548780-93548802 TTGGAGACTCAGAAGGGTACAGG + Intergenic
1132345649 15:101107199-101107221 TTGGAGACTCAAAACAATGATGG + Intergenic
1202949113 15_KI270727v1_random:15325-15347 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133578486 16:7118412-7118434 TCAGAGACTCAGAAGGAGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133712036 16:8410780-8410802 TTGGAGACTCAGAAGCAGAGAGG + Intergenic
1134016300 16:10890856-10890878 TTGGCAACTCACAAGGATTAGGG - Intronic
1134747348 16:16598543-16598565 TTGGGGAGTCAGAAGCAGGAAGG + Intergenic
1134998123 16:18755115-18755137 TTGGGGAGTCAGAAGCAGGAAGG - Intergenic
1135118838 16:19747644-19747666 GTGAAGACTCGGAAGGGTGAAGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1137915614 16:52426744-52426766 GTGGAGACTGGGATGGATGAGGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138215869 16:55204886-55204908 TTGGATACTCGGAAGAACGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138701215 16:58865577-58865599 TTTGAGTCTCTTAAGGATGAGGG + Intergenic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1138862997 16:60781861-60781883 TTTGAGGCTCAGAAAGATGACGG - Intergenic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139232953 16:65304239-65304261 TTGGAGTCTTAGATGGAAGAGGG + Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139500534 16:67360712-67360734 TTAGAGCCTCAGATGGATGGAGG + Intronic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141235857 16:82215616-82215638 TCAGATACTCAGAAGGCTGAGGG - Intergenic
1141515235 16:84539704-84539726 AGGGAGACTCGGGAGGATGAGGG + Intronic
1141986396 16:87583007-87583029 TTGGAGGCTCAGGAGGAGGTGGG + Intergenic
1142944871 17:3416979-3417001 TTGGAGGCTGGGAAGGGTGAGGG - Intergenic
1143816674 17:9522031-9522053 TTGGAGACCCAAAAAAATGATGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147173319 17:38634694-38634716 TTGGAGACTAAGAAGCAGAATGG - Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149857992 17:60101474-60101496 TTTGAGAGTCCGAAAGATGATGG - Intergenic
1150006680 17:61474119-61474141 GGGGAGGATCAGAAGGATGATGG + Intronic
1150351611 17:64449232-64449254 TTCGAGCCTCAGAATGATAAGGG - Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1153014634 18:572532-572554 TTGCCAACTCAAAAGGATGAGGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154138898 18:11805513-11805535 CAGGAGACTCAAAAGGGTGAGGG - Intronic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155898184 18:31354929-31354951 TTGAAGACTCTCTAGGATGATGG - Exonic
1156422850 18:36974327-36974349 TTGGAGACTCAGAAGAGTGGAGG - Intronic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1157551000 18:48581958-48581980 GAGTAGACCCAGAAGGATGATGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1158272696 18:55733763-55733785 TTGGAGGGTCAGAAGCAGGAAGG + Intergenic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158667947 18:59449705-59449727 TTGTAGACTTGGAAGGATGAAGG - Intronic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158859440 18:61578030-61578052 GTGGACACTCAGAAGGGTGGAGG + Intergenic
1159075850 18:63681133-63681155 TTAGAGGCTGAGAAGGATAAAGG + Intronic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1159838845 18:73372888-73372910 TTGTAGTCTCTGAAGGATGGTGG - Intergenic
1159950258 18:74477986-74478008 TTGGAGACACAGAACTATGGGGG - Intergenic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1162154563 19:8668475-8668497 TAGGTGACTCAGAAAGATAAAGG - Intergenic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163431121 19:17268403-17268425 TTGGTTACTAAGAAGGAAGAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164773295 19:30830039-30830061 TTGGATACTCAGAAGGTAGGAGG - Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1166168672 19:41010798-41010820 GTGAAGACTCAGAAGAGTGAGGG - Intronic
1166207366 19:41280199-41280221 ATGGAGACTCAGAAGTGTTAGGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168572177 19:57480438-57480460 TGGGAGAATCAGAAGCATGTTGG + Intergenic
925010260 2:479606-479628 TGTGAGACTCAGACGGATGCAGG - Intergenic
925572799 2:5330045-5330067 TTATTGACTCAGAAGGAGGAGGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926211960 2:10878013-10878035 TTGGAGGCTCAGCAGGGTGTGGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
928276194 2:29902371-29902393 ATGCAGATTCAGCAGGATGATGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
932089503 2:68792413-68792435 ACAGAAACTCAGAAGGATGAGGG - Intronic
932126086 2:69146663-69146685 GTGGACTCTCAGAAGGATCATGG + Intronic
932182221 2:69657494-69657516 TTGGAGAATAAGTAGGATGATGG - Intronic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934476541 2:94597282-94597304 TTGGAACCTCAGAAGCAGGAGGG + Intronic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936867117 2:117087527-117087549 TTGGGGAGTCAGCATGATGAGGG - Intergenic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939742036 2:145920011-145920033 TTGCAAACTCAGAAGGAAAAGGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941398272 2:164998054-164998076 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
941586962 2:167371678-167371700 TTGGAAACTGAAAAGGAAGATGG + Intergenic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942478041 2:176349976-176349998 TTAGAGGCTGAGAAGGATGGGGG - Intergenic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943924284 2:193752004-193752026 ATGAAAACTCAGAAGGGTGAGGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
946906740 2:224424621-224424643 TTTGAGACTGAGAAGGATGGAGG + Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948885926 2:240884637-240884659 TGGGGGACTCAGAAGGCTGTTGG - Intergenic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1168936833 20:1672983-1673005 TTAGAGAATCAGAAAAATGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170360720 20:15543147-15543169 TTGGAGTTTTAGAATGATGATGG + Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1170997443 20:21376784-21376806 TTGGAAACCCAGGAGGGTGAAGG + Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172921657 20:38488460-38488482 TTGGTGATTCAGAATGATCAAGG + Exonic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173461749 20:43248534-43248556 TTGCAGACTCAGCAGGTTTAGGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1175003254 20:55653373-55653395 TAGGAGACTCAGAGGGCTGGTGG - Intergenic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1177112192 21:17042023-17042045 ATGGAGGCTCAGAAGGATTGGGG + Intergenic
1177832357 21:26153130-26153152 TTAGAGACTCACGAGGAGGAGGG + Intronic
1178434745 21:32548083-32548105 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1179182413 21:39057169-39057191 CTGAAGACTCAGTAAGATGAAGG + Intergenic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1181331747 22:22098281-22098303 TTGATGACTGAGGAGGATGAAGG - Intergenic
1181906406 22:26200674-26200696 CTGGAGGCTGAGAAGGCTGATGG - Intronic
1182208144 22:28649196-28649218 TTGGAGACTCAGGAGGTAGGAGG + Intronic
1182859963 22:33551033-33551055 ATGGAAACTCAGAAGGGTAAAGG + Intronic
1184235700 22:43181981-43182003 GGGGAGACTCAGGGGGATGAAGG + Intronic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
951823662 3:26843109-26843131 TTGGAGACTTTGAAGGGTGGGGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
952899868 3:38103144-38103166 ACGGAGACTCGGAAGGGTGAGGG - Intronic
953028974 3:39163967-39163989 TTGAAGACTCAGAAGTAGGGGGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953804287 3:46054529-46054551 ATGGACACTCAAAAGGACGAGGG + Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954141063 3:48605804-48605826 TTTGAGACTGAGAAGAATAATGG - Exonic
954141371 3:48608149-48608171 GTGAAGACTTGGAAGGATGAAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955399272 3:58579669-58579691 TTGGAGAGTAAGAAGGATCCTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956390480 3:68767628-68767650 TTTGGGACACAGAAAGATGAGGG + Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957481023 3:80793961-80793983 GTGGAGACTTGGAAGGGTGAGGG + Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958580270 3:96009209-96009231 ATAGAGACTTAGAAGTATGAGGG + Intergenic
958859930 3:99434354-99434376 TTGGTGACTCAGAAGGAGAAGGG - Intergenic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959871087 3:111329334-111329356 TTGAAGACCAAGAGGGATGAAGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960211601 3:114974365-114974387 TTTGGGACTCTGAAGGCTGAAGG - Intronic
960412560 3:117345769-117345791 AGGGAAACTCAAAAGGATGATGG - Intergenic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960639478 3:119812336-119812358 CAGGAGACTCAGAAGGTTTAGGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961715149 3:128852870-128852892 GTGTAGACTCAGAAGGCTGGGGG + Intergenic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
961955577 3:130799608-130799630 TCAGAGACTCAGAAGGAGGATGG + Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962727247 3:138242759-138242781 TTTGAAACTCAAAAGCATGAGGG - Intronic
963971370 3:151432790-151432812 TTGCAGATTCAGAAGTGTGAAGG - Exonic
964285454 3:155113013-155113035 TTGGAGTCACAGAAGCATCAGGG + Intronic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
966674960 3:182575280-182575302 TTAGAGACTGGGAAGGATGGGGG + Intergenic
966846488 3:184134727-184134749 TTGAACTCTCAGAAGGATGAAGG - Intergenic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970305347 4:14725947-14725969 TTGGTGATTAAGAAGAATGAGGG - Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971876322 4:32313571-32313593 TTGCAGACACAGAAGGACAATGG + Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972366070 4:38375891-38375913 GTGGAAACTCTGAAGGGTGAGGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
975536244 4:75454278-75454300 TTGGAGTCTGAGAAGCATAAGGG + Intergenic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977306593 4:95330971-95330993 ACAGAGACTCAGAAGGATGCAGG - Intronic
977388659 4:96379781-96379803 TTCCAGACTTAGTAGGATGAGGG - Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978772485 4:112471407-112471429 TCAGAGACTCAGAAGGCAGAAGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979578412 4:122323875-122323897 TTGGAGTCTAAGATGGATAATGG - Intronic
979760787 4:124401229-124401251 TTGGAGACTCAGAATAGTGGGGG - Intergenic
980546232 4:134266742-134266764 TTGGAGAATGATAGGGATGATGG - Intergenic
980548569 4:134302958-134302980 TTGGAGACTCAAAAGCATGGAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982039455 4:151381337-151381359 TTGGAGACTCAGAAGGGTATAGG + Intergenic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982873458 4:160613761-160613783 ATGGATACTGAGAATGATGAGGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983506969 4:168564016-168564038 ATGGAGACTGGGAAGGGTGAAGG - Intronic
983898523 4:173107108-173107130 TAGGAGACTCAGGAAGAAGAAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984475424 4:180228880-180228902 TTGGAAACACAGTAAGATGAAGG - Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986879008 5:12147283-12147305 TTGAAGACTCAGAAGGGTGGGGG - Intergenic
987130002 5:14851345-14851367 TTCGGGGCTCAGAAGGAAGATGG + Intronic
987262838 5:16221071-16221093 GTGGAGACTAGGAAGGGTGAAGG + Intergenic
987401295 5:17479908-17479930 TAGGAGACTTAGAAGTATGTTGG + Intergenic
987615573 5:20269705-20269727 TTGTAGACTTAGAAGGGTGAAGG + Intronic
988113599 5:26854874-26854896 TTGGAAACTCAGAAGTAGGGAGG + Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988422230 5:31020334-31020356 TTGAAGACTCAGAAGGGTACAGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989392227 5:40912957-40912979 TTGGAGACTCAGAAGAGTTGGGG - Intronic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
990623994 5:57591228-57591250 TTAGAGAATCAGAACCATGATGG - Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
990979296 5:61587340-61587362 TTGGTGACTCAGATGCAAGACGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992276388 5:75124803-75124825 CTGGAGACTCAGAAGGGTAGGGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992948939 5:81837852-81837874 TTGCAGACTGAGCAGGATGCTGG + Intergenic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993262598 5:85679015-85679037 TTGGAGACTTAGAAGTCTGGGGG + Intergenic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994014798 5:94952793-94952815 TTGGAGCATGAGAAGGGTGAAGG - Intronic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
996077568 5:119214930-119214952 TTGGCGACAGAGAAAGATGATGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996444985 5:123537412-123537434 GTGGAGACTTGGAAGGGTGAGGG + Intronic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
997162566 5:131624726-131624748 TGGGAGACTGAGAAGGAAAAAGG + Intronic
998934058 5:147215760-147215782 ATTGAGACTCAGGAGCATGAAGG - Intergenic
999386609 5:151157965-151157987 TCTGAGACTGAGAAGGATTAGGG + Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1001111563 5:168900937-168900959 ATGGAGCCTCAGAAGCGTGAGGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004478836 6:15999820-15999842 ACTGAGACTCAGAAGGATAAAGG + Intergenic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005141328 6:22634881-22634903 TGGAAGACTCAGAAGGGAGAGGG - Intergenic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1005514022 6:26537642-26537664 TGGAAGACTCAGAAGCAAGAGGG + Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006725245 6:36195528-36195550 TTCTAGAGTCAGAAGGATGAAGG - Intergenic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007350064 6:41265870-41265892 ATAGAGACTCAGAAGAGTGAGGG + Intergenic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1008496946 6:52143730-52143752 CCTGAGCCTCAGAAGGATGAGGG - Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010828423 6:80501167-80501189 ATAGAGACTCCGAAGGATGAGGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1012533017 6:100261328-100261350 GTGGACAATCAGAAGGATGTGGG - Intergenic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1013064740 6:106672792-106672814 TTGAAGACTTAGAATAATGAAGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013943246 6:115691448-115691470 TTGGAGACAGACAAGCATGAAGG + Intergenic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015112925 6:129614070-129614092 TTGTGTTCTCAGAAGGATGAGGG - Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015365920 6:132398052-132398074 ATAGAGACTCAAAAGGGTGAAGG - Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017375630 6:153764496-153764518 TTAGAGGCTCAGAAGGAGCAGGG + Intergenic
1017589585 6:155964361-155964383 TTGGGGATTCAGAAATATGAGGG - Intergenic
1017616578 6:156252583-156252605 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1019098440 6:169607612-169607634 CTGGAGACTCAGAAGGGTAGAGG + Intronic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019978215 7:4601483-4601505 CTGGAGACTCTGAAGGGTGGGGG + Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026086560 7:67267853-67267875 TTCCAGACTCAGCAGGATGGAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026610758 7:71857852-71857874 TTGGAGTCTCTGAACCATGAAGG - Intronic
1026690579 7:72547005-72547027 TTCCAGACTCAGCAGGATGGAGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027479363 7:78675779-78675801 TTGGAAAACAAGAAGGATGATGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028308381 7:89295985-89296007 TTAGAGACTCGGAAGGAGTAGGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030417080 7:109258580-109258602 TTGGACAAATAGAAGGATGAAGG - Intergenic
1030654902 7:112156265-112156287 TTTTAGACTGAGAAGGATGAAGG - Intronic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032319262 7:130870542-130870564 TTGGCTATTCAGAATGATGACGG - Intergenic
1033023502 7:137750767-137750789 TTGGGGACTCAGGAAGATAAAGG + Intronic
1033075464 7:138246144-138246166 TTGGAATCCCAGAAGGATAAAGG + Intergenic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033937767 7:146609043-146609065 TTGGAGACACTCAAGGATTATGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034407755 7:150916607-150916629 GTGGTGGCTCAGGAGGATGAGGG + Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035289871 7:157831043-157831065 TTGGTGACTCTGGAGGAAGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036278994 8:7382936-7382958 TTAGAGACTCAGAAGGCCGCAGG - Intronic
1036342526 8:7928934-7928956 TTAGAGACTCAGAAGGCCGCAGG + Intronic
1036405151 8:8448147-8448169 TTAAAGACTCAGAAGGCAGAGGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037712393 8:21365314-21365336 TTGGAGACTTGGAAGGGTGGAGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039004969 8:33025864-33025886 TTGGGGATTCAGATGGATAAAGG - Intergenic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039180913 8:34864959-34864981 TTGGAGACCTTGAAGGATGAAGG - Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040883920 8:52238842-52238864 TGGGAGACTCGGAAGGGTGGGGG + Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042012384 8:64261818-64261840 TTGCAAACACAGAAGGATGTAGG - Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042434771 8:68750712-68750734 TTGGAGAATCAGAATGCTTAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043196304 8:77296478-77296500 TTGGAGACACAGCTGAATGATGG + Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043366521 8:79539454-79539476 TTGGAGACTCAGAAGGGTAGTGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1046083641 8:109403938-109403960 TTGGGTACACAGTAGGATGAGGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046730569 8:117721263-117721285 TTGGAGACTCAGAAGGGTTGGGG - Intergenic
1046742667 8:117845692-117845714 TTGGGGACTGGGAAGGATGTGGG - Intronic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1046985686 8:120385801-120385823 TTGGCAACTCAGAAGGGTGAAGG - Intronic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047633817 8:126737490-126737512 TTAGAGACTCAGAAGGAGAAGGG - Intergenic
1047981027 8:130182310-130182332 TTGAAGACAAAAAAGGATGACGG + Intronic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1048878496 8:138855059-138855081 GCTGAGACTCAGAAGGATGCTGG - Intronic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054783117 9:69184516-69184538 TTTGAGATTTGGAAGGATGAAGG - Intronic
1054866087 9:70003215-70003237 TTGGATTCTCAGAAAGATGGTGG - Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055023742 9:71697124-71697146 TTGCTGACTCAGTAGGATGAGGG + Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055862409 9:80768406-80768428 TCAGAGAGTCAGAAGGAAGACGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058549453 9:106098311-106098333 TTGGAAATTCACAAGAATGAAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1059218410 9:112589238-112589260 TGGGAGAATCAGAAAAATGAGGG - Intronic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059638106 9:116190429-116190451 TTCAAGATTCAGAAAGATGAAGG + Intronic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059864823 9:118502616-118502638 TTGGAGATTTAGAAGGCTGAGGG - Intergenic
1059990082 9:119856775-119856797 ATGGAGACTGGGAAGGGTGAAGG - Intergenic
1060045429 9:120336711-120336733 GTGGGGAGTCAGAAAGATGAGGG + Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1062066505 9:134530486-134530508 TTGGGGTCTCATAAGGTTGAAGG + Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1203375609 Un_KI270442v1:373678-373700 ATGGAGACTCGGCAGGGTGAGGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186014871 X:5180109-5180131 TTGGGGAGTAAGAGGGATGAAGG + Intergenic
1186792424 X:13011940-13011962 TCTGAGGCTCAGAAAGATGAAGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187065424 X:15832245-15832267 TTTGAGAGTCTGAAGGATGATGG - Intronic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188158113 X:26767124-26767146 TTGGAGATGCAGAAGCATGGGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188375836 X:29426907-29426929 TTAGAGACTAAGAAGTATAATGG - Intronic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188887649 X:35569901-35569923 TCTGAGTCTCAAAAGGATGAAGG + Intergenic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1189946414 X:46184589-46184611 TGGGAGGCACAGAGGGATGAAGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190248135 X:48704326-48704348 ATGGAGACTAGGAAGGATGTGGG + Intronic
1190624147 X:52320156-52320178 TTGGAGAATATGAAGGATAATGG - Intergenic
1191178398 X:57531987-57532009 TTGGAGACTCAAAAGAAAGGAGG + Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192805720 X:74506691-74506713 GGAGAGACTCAGAAAGATGAGGG + Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193692477 X:84663488-84663510 GTGGATATTCAGAAGGGTGATGG + Intergenic
1193912971 X:87327989-87328011 TTGGTGGCTCACAGGGATGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194597336 X:95874658-95874680 TTAGAGTCTCAGAAGGGAGAGGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197082285 X:122433612-122433634 TATGAGTGTCAGAAGGATGAGGG - Intergenic
1197371661 X:125634289-125634311 TTGTAGACTTAGAAGCAGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197977634 X:132182524-132182546 TTGGAGTCTAAGCAGGGTGAGGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199134383 X:144233565-144233587 TTGAGGGCTCAGAAAGATGAGGG + Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200806212 Y:7436191-7436213 TTGGAGACTCCAAAGTAGGAAGG - Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201145241 Y:11061156-11061178 CAGGAGACTCAGAAGTGTGATGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202267248 Y:23033222-23033244 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202420240 Y:24666966-24666988 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202450546 Y:25003116-25003138 AGGGATACTCTGAAGGATGAAGG - Intergenic