ID: 1017274549

View in Genome Browser
Species Human (GRCh38)
Location 6:152550898-152550920
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017274546_1017274549 7 Left 1017274546 6:152550868-152550890 CCTTAGACTTTCGGATAAAGGGT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr