ID: 1017275769

View in Genome Browser
Species Human (GRCh38)
Location 6:152566157-152566179
Sequence CCCCTCCAGTGTTGAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017275764_1017275769 8 Left 1017275764 6:152566126-152566148 CCAAGCAAATGTAGCAGCTTCTA 0: 1
1: 0
2: 2
3: 17
4: 185
Right 1017275769 6:152566157-152566179 CCCCTCCAGTGTTGAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017275769 Original CRISPR CCCCTCCAGTGTTGAACCTG GGG Intronic
No off target data available for this crispr