ID: 1017278800

View in Genome Browser
Species Human (GRCh38)
Location 6:152601577-152601599
Sequence CTATCCTGCTGAACAGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017278792_1017278800 15 Left 1017278792 6:152601539-152601561 CCTAACTTTTCCAATATACAAAG No data
Right 1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1017278796_1017278800 -10 Left 1017278796 6:152601564-152601586 CCCAGGCAGGCTGCTATCCTGCT 0: 1
1: 0
2: 1
3: 25
4: 253
Right 1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1017278794_1017278800 5 Left 1017278794 6:152601549-152601571 CCAATATACAAAGAACCCAGGCA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017278800 Original CRISPR CTATCCTGCTGAACAGGTAT GGG Intronic