ID: 1017278800

View in Genome Browser
Species Human (GRCh38)
Location 6:152601577-152601599
Sequence CTATCCTGCTGAACAGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017278794_1017278800 5 Left 1017278794 6:152601549-152601571 CCAATATACAAAGAACCCAGGCA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1017278792_1017278800 15 Left 1017278792 6:152601539-152601561 CCTAACTTTTCCAATATACAAAG 0: 1
1: 0
2: 1
3: 36
4: 480
Right 1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 75
1017278796_1017278800 -10 Left 1017278796 6:152601564-152601586 CCCAGGCAGGCTGCTATCCTGCT 0: 1
1: 0
2: 1
3: 25
4: 253
Right 1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017278800 Original CRISPR CTATCCTGCTGAACAGGTAT GGG Intronic
901276136 1:7992402-7992424 CTTTCCCAATGAACAGGTATTGG - Intergenic
904362199 1:29983540-29983562 TTATCCTGCTGTACAGTGATTGG - Intergenic
906263931 1:44414188-44414210 TATACCTGCTGAACAGGTATCGG + Intronic
912141034 1:106727505-106727527 CTTTCTGTCTGAACAGGTATGGG + Intergenic
914378768 1:147097736-147097758 CTCTCCTGCTGCACAAGTTTGGG - Intergenic
918814097 1:189160968-189160990 CTATCTGTGTGAACAGGTATTGG - Intergenic
1063353449 10:5376631-5376653 CTTTCCTGCTGGACAGCTACCGG + Intergenic
1068247409 10:54390597-54390619 CTATACTACAAAACAGGTATAGG - Intronic
1069749768 10:70737605-70737627 CTGTCCTGCTGAGCAGCTCTGGG + Intronic
1071600557 10:86956786-86956808 CCATCCTGCTGATGAGGTGTTGG - Intronic
1074662021 10:115670971-115670993 TTATCCTGCTGAAGAGGTTAAGG + Intronic
1075178312 10:120186147-120186169 CTATTCTGCTGAAGGGGGATGGG + Intergenic
1083283967 11:61645921-61645943 CTCTCCTGCTGGACAGGAATAGG - Intergenic
1088672995 11:112161900-112161922 CAATCCTGTTGAATAGGTATGGG + Intronic
1099452588 12:82825342-82825364 TTTTCCTGCTGAACATGAATGGG + Intronic
1101197552 12:102400461-102400483 CTACCCTTCTGAGCAGGCATGGG + Intronic
1102640065 12:114359389-114359411 CTTTGCTGTTGAACAGTTATTGG - Intronic
1106759139 13:32850638-32850660 CTATCCTGTTGAAAAGGTTTGGG - Intergenic
1111043783 13:82788070-82788092 CTATTATGCTGAACAGATAGGGG - Intergenic
1111769569 13:92579499-92579521 TTAGCTTGCTGAACAGGTGTGGG + Intronic
1114042977 14:18695901-18695923 CTTTCCACCTGAACATGTATAGG + Intergenic
1114047268 14:18886341-18886363 CTTTCCACCTGAACATGTATAGG + Intergenic
1114116946 14:19633056-19633078 CTTTCCACCTGAACATGTATAGG - Intergenic
1114397426 14:22378502-22378524 CTATCCTGCTGCAGAGGAAGAGG - Intergenic
1115657136 14:35454106-35454128 TTATCCTGCTGAATGGGCATGGG + Intergenic
1122046132 14:99025325-99025347 CTCGCCTGCTGGACAGGGATGGG + Intergenic
1136712758 16:32253545-32253567 CTCTCCTGCTGAAGAGACATTGG + Exonic
1136755158 16:32675884-32675906 CTCTCCTGCTGAAGAGACATTGG - Exonic
1136812955 16:33194485-33194507 CTCTCCTGCTGAAGAGACATTGG + Exonic
1136819431 16:33304565-33304587 CTCTCCTGCTGAAGAGACATTGG + Exonic
1136825994 16:33361100-33361122 CTCTCCTGCTGAAGAGACATTGG + Exonic
1136831060 16:33459871-33459893 CTCTCCTGCTGAAGAGACATTGG + Exonic
1140712495 16:77691451-77691473 TTATCCTGCTGGAAAGGGATTGG + Intergenic
1142316293 16:89347912-89347934 CTTTCCTCATGAATAGGTATGGG + Intronic
1202991532 16_KI270728v1_random:17455-17477 CTCTCCTGCTGAAGAGACATTGG + Intergenic
1203057300 16_KI270728v1_random:936223-936245 CTCTCCTGCTGAAGAGACATTGG - Intergenic
1151678871 17:75613762-75613784 GGATCCTGCAGAGCAGGTATGGG + Intergenic
1153934401 18:9908192-9908214 CTACACTGCTGAACAGCTCTGGG + Intergenic
1158602499 18:58866622-58866644 CTATTCTGCTGAACACGGAGAGG - Intronic
1164213854 19:23125646-23125668 CTATCCTGCAGAACAGAGACTGG - Intronic
1165055772 19:33175458-33175480 CTATCCGGCAGAACACGCATTGG - Exonic
925149730 2:1606775-1606797 ATATCCTGCAGAGCAGGAATGGG + Intergenic
928815580 2:35291637-35291659 CTTTCCTGCTGAACTGGCAGGGG - Intergenic
928889654 2:36188980-36189002 GTGTCCTGCTGATCTGGTATGGG - Intergenic
929511787 2:42570468-42570490 CTATCCTTCTTATTAGGTATGGG - Exonic
939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG + Intronic
940331500 2:152479945-152479967 ATGTCCTGCTTTACAGGTATTGG + Intronic
948665360 2:239531429-239531451 GTCTCCTGCTGGACAGGTGTTGG + Intergenic
1169104069 20:2979354-2979376 CTCTCCTGTTGCACAGGTATTGG + Intronic
1170688988 20:18595124-18595146 CTATCCTTCTTCACATGTATAGG + Intronic
1174903077 20:54521387-54521409 CTAGTCTGCTAAACAGGTGTGGG - Intronic
1175837429 20:62005036-62005058 CTATGCTGCAGAACATGTGTGGG + Intronic
1175872826 20:62216516-62216538 CCATGCCGCTGCACAGGTATGGG - Exonic
1180465801 22:15608996-15609018 CTTTCCACCTGAACATGTATAGG + Intergenic
1185342258 22:50296928-50296950 CTACCCTGCTGCACAGGTAAGGG + Intronic
953364946 3:42336398-42336420 CTATCCAGATGAACAAATATAGG + Intergenic
966623210 3:181988008-181988030 TTATCCTGCTGACCAACTATGGG + Intergenic
970797757 4:19934497-19934519 CTAGCTATCTGAACAGGTATAGG - Intergenic
971382345 4:26110510-26110532 TTATCCTGATGGACAGGTTTTGG - Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
983304660 4:165971143-165971165 CTATCATGCACAACAGGAATTGG + Intronic
986219433 5:5754257-5754279 CTATGCTGCTCAGCAGGAATGGG + Intergenic
988293817 5:29328905-29328927 CTTTTCTGCTGAAGAGTTATTGG + Intergenic
998988025 5:147783359-147783381 CTACCCTTCTGAACAGGACTTGG + Intergenic
1003089441 6:3089264-3089286 ATCTCCAGCTGAACAGGGATGGG - Intronic
1010915556 6:81613704-81613726 CTTTCCTGCTGAACAGTCACTGG + Intronic
1011859761 6:91739819-91739841 CTTTCCTGCTGATCAGTTGTGGG + Intergenic
1012873096 6:104695110-104695132 TTATCCTGCTGATCAGGACTTGG - Intergenic
1017278800 6:152601577-152601599 CTATCCTGCTGAACAGGTATGGG + Intronic
1023565003 7:41515496-41515518 CTGTCCTGATGAATAGGAATAGG + Intergenic
1028716242 7:93973303-93973325 CAATTCTGCTCAACAGCTATAGG - Intronic
1034040562 7:147873099-147873121 CTATCCTGATAGACAGGAATAGG + Intronic
1036341047 8:7915901-7915923 CTATCCACCAGAACAGATATGGG - Intergenic
1042643092 8:70956506-70956528 CTCTCCTTCAGACCAGGTATGGG - Intergenic
1049954438 9:679083-679105 GTATCCTGCCTAACAGGTCTGGG + Intronic
1056586327 9:87929824-87929846 GTAGCCTGCTGCACAGGTAGAGG - Intergenic
1056610555 9:88123119-88123141 GTAGCCTGCTGCACAGGTAGAGG + Intergenic
1057924363 9:99130411-99130433 TTATCATGCTGAACAGGTGGAGG - Intronic
1188365033 X:29305369-29305391 CTATCCTGATGAACATTCATAGG + Intronic
1190406997 X:50098246-50098268 CTATGCTGCTAACCAGGTATAGG + Exonic
1198971937 X:142291858-142291880 GTTTCATGCTGAACAGGTAAAGG - Intergenic
1199298450 X:146185853-146185875 CTTTCCTGCTGGCCAGGCATGGG - Intergenic