ID: 1017282127

View in Genome Browser
Species Human (GRCh38)
Location 6:152636842-152636864
Sequence GGGCGCCGGGCCGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 832
Summary {0: 1, 1: 0, 2: 11, 3: 104, 4: 716}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017282127_1017282132 -6 Left 1017282127 6:152636842-152636864 CCGGCGGCCGCGGCCCGGCGCCC 0: 1
1: 0
2: 11
3: 104
4: 716
Right 1017282132 6:152636859-152636881 GCGCCCGCGCTCACCCTGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 149
1017282127_1017282137 20 Left 1017282127 6:152636842-152636864 CCGGCGGCCGCGGCCCGGCGCCC 0: 1
1: 0
2: 11
3: 104
4: 716
Right 1017282137 6:152636885-152636907 GCCCACACTCACTCCCGCGCCGG 0: 1
1: 0
2: 0
3: 13
4: 117
1017282127_1017282139 21 Left 1017282127 6:152636842-152636864 CCGGCGGCCGCGGCCCGGCGCCC 0: 1
1: 0
2: 11
3: 104
4: 716
Right 1017282139 6:152636886-152636908 CCCACACTCACTCCCGCGCCGGG 0: 1
1: 0
2: 3
3: 17
4: 206
1017282127_1017282130 -10 Left 1017282127 6:152636842-152636864 CCGGCGGCCGCGGCCCGGCGCCC 0: 1
1: 0
2: 11
3: 104
4: 716
Right 1017282130 6:152636855-152636877 CCCGGCGCCCGCGCTCACCCTGG 0: 1
1: 2
2: 5
3: 29
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017282127 Original CRISPR GGGCGCCGGGCCGCGGCCGC CGG (reversed) Intronic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900244011 1:1629466-1629488 GGGCGCCGCGCCGGGGCCCGAGG + Exonic
900366709 1:2314657-2314679 GGGCCCCGCGCCGCGTCCTCAGG + Intergenic
900413919 1:2526428-2526450 GGGCGCCGGGCGCGGGCTGCGGG - Intronic
900513025 1:3069339-3069361 GGCCGCCGGGCCGGGGCGCCCGG + Intronic
901066613 1:6497392-6497414 GGCCGCAGAGCCGCCGCCGCCGG + Intronic
901332805 1:8423859-8423881 GGGCGCGGGGCCCCGGCTGGCGG - Intronic
901361305 1:8703222-8703244 GGGCACCGCGGCGCGGGCGCAGG + Intronic
901540187 1:9910388-9910410 GGGCGCCGGGGCGGGGCCTGCGG + Intergenic
901796294 1:11681272-11681294 GGGGGCCGGGCCTCGGCGTCCGG + Exonic
902323606 1:15684399-15684421 GAGGGCCGGGCGGCGGGCGCCGG + Exonic
902585803 1:17438181-17438203 GGGCGCAGGGCCGGGGCCGGCGG - Intronic
902793384 1:18784417-18784439 GGGCTCGGCGCCGCGGCCGACGG + Intergenic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903072199 1:20732053-20732075 AGGCGCGGGGCTGCGGCGGCGGG - Intronic
903263301 1:22142752-22142774 CGGCGCGGGGCAGCGGGCGCGGG - Intronic
903413792 1:23168163-23168185 GGGCGCGGGGCGCGGGCCGCGGG - Intronic
904199782 1:28812259-28812281 GGCGGCCGGGGCGCGGCAGCCGG + Exonic
904251889 1:29230954-29230976 GGGCGCAGGCGCGCGGTCGCTGG - Intergenic
904483297 1:30807397-30807419 GGGCGGCGGGCGGCGGCCCGGGG - Intergenic
904563362 1:31413224-31413246 GGGCGCCCGGCGCCGGGCGCGGG - Intronic
905580774 1:39081633-39081655 GGGAGCTGGGGCGCGGCCGCCGG - Intronic
905580787 1:39081661-39081683 AGCCGCCTGTCCGCGGCCGCCGG - Intronic
905789782 1:40783938-40783960 AGGGGCCGGGCCGGGGCCGCGGG - Intergenic
905789837 1:40784068-40784090 CGGCGCCGGGCTGGGGGCGCCGG - Exonic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906027147 1:42682965-42682987 GGTCGGCGGCGCGCGGCCGCAGG - Intronic
906130755 1:43453841-43453863 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
906130760 1:43453848-43453870 GGGCGGCGGGCGGCGGGCGGGGG + Exonic
906325521 1:44843158-44843180 GGGCCGTGGGCCGCGGCGGCTGG + Intergenic
908523380 1:64966098-64966120 GGTCGCCGGGCGGGGGCCCCCGG - Intronic
912305170 1:108560013-108560035 GCGCTGCAGGCCGCGGCCGCTGG + Intergenic
912305253 1:108560303-108560325 GTGCGCGGGGGCGCGGCCGGGGG - Exonic
912381291 1:109249583-109249605 GGGCCCGGGGCCGCGGCGACAGG + Intergenic
912800184 1:112715319-112715341 GGGGGCGGGGCCGCGGCCGAGGG - Exonic
913047858 1:115089307-115089329 GGGGGCCGGGTGGCGGGCGCGGG - Intronic
913191747 1:116418759-116418781 GCGCGCCCGGCTGCGGCCCCAGG + Intergenic
913453467 1:119008084-119008106 TTGGGCCGGGCCGGGGCCGCCGG - Intergenic
915367329 1:155323526-155323548 CGGCGCCGGGCTGCGGCTGCTGG + Intronic
915469143 1:156115318-156115340 GGGCGGCGGGCCGGCGCCCCTGG + Intronic
915589135 1:156860788-156860810 CGGGGCCGGGCGGGGGCCGCTGG + Intronic
915740256 1:158113691-158113713 GGGCTCCGGGCGGCCGCCGGGGG - Intergenic
917291599 1:173477224-173477246 GGGGGCCGGGCCGCGGGGGCTGG - Intergenic
918326671 1:183417487-183417509 GGGGGCCGGGCGGAGGCTGCGGG - Intronic
918388766 1:184037060-184037082 GGGCCCCGGGCCGCCGCGGCGGG - Intronic
920278839 1:204828599-204828621 GGGCGCGGGGGCGCGCACGCAGG + Intergenic
921355501 1:214281230-214281252 TGGCGGCGGGGCGCGGCCGCCGG - Exonic
922200078 1:223393862-223393884 GCGGGCAGGGCTGCGGCCGCTGG - Exonic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
922440736 1:225653270-225653292 GGGGGCCCGGCCGCCGGCGCGGG - Intergenic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
922725282 1:227920153-227920175 GGGTGCAGGGCAGGGGCCGCCGG + Exonic
923631004 1:235649633-235649655 GGGCGCCCGGCCGGAGCCCCGGG - Intronic
923744337 1:236686568-236686590 GGGCGGCGGGCGGCGGGCGCGGG - Exonic
924172449 1:241356776-241356798 GGGCGCAGGGCGGCCGCCCCCGG - Intronic
924624676 1:245688504-245688526 GGGAGCAGGTGCGCGGCCGCGGG - Exonic
1063200394 10:3781604-3781626 GGGCCCCGGAGGGCGGCCGCTGG - Intronic
1064354414 10:14604352-14604374 GCGGGCCGGGCCGCCGCCCCCGG - Intronic
1064981900 10:21173934-21173956 GGGCTGCGGGCGGCGGGCGCCGG + Intronic
1065025065 10:21534017-21534039 GGGCGCGGGGGCGCGCACGCGGG - Intergenic
1065025317 10:21534891-21534913 CCGCCCCGTGCCGCGGCCGCGGG + Intronic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065100380 10:22325599-22325621 GGGCGGCGCGCCGCGGGGGCGGG - Intronic
1065343026 10:24723794-24723816 TGGGGCGGGGCGGCGGCCGCCGG + Intergenic
1066402547 10:35090137-35090159 GGGAGCCGGGCTGCAGGCGCCGG - Intronic
1066406966 10:35127320-35127342 GGGCGGCGGGCCGGGACCCCGGG + Intronic
1067087633 10:43251242-43251264 GGGCCCCAGGCGGCTGCCGCTGG - Intronic
1067405971 10:46023607-46023629 GGGGGCCGGGCGGGGGCAGCAGG - Intronic
1067497776 10:46774938-46774960 GGTCGCTGGGCCCGGGCCGCCGG + Intergenic
1067596873 10:47565476-47565498 GGTCGCTGGGCCCGGGCCGCCGG - Intergenic
1068954015 10:62805473-62805495 GGGCGGCGGGCAACGGCCGCGGG + Exonic
1069486646 10:68827896-68827918 GGAAGCCGCGCGGCGGCCGCAGG - Exonic
1069486733 10:68828232-68828254 GGAAGCCGCGCGGCGGCCGCAGG - Intronic
1069615065 10:69801729-69801751 GGCCGGCGGGCTGGGGCCGCCGG + Intergenic
1069761696 10:70815921-70815943 GGGAGCCGGGCCGGTGCCCCCGG + Intergenic
1070140144 10:73732788-73732810 GGCAGCCGGGCCCCAGCCGCAGG - Intergenic
1070768473 10:79069443-79069465 GGCCGCCGGGCCTCGGCCCCCGG - Intronic
1072465184 10:95656491-95656513 GAGCGCCGGGCCGCTGGAGCGGG - Intronic
1072656568 10:97334307-97334329 GGGGGCCGGGCCTTGTCCGCCGG + Exonic
1072670482 10:97425910-97425932 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
1072784046 10:98268368-98268390 GGGCGCCCAGCCGCAGCCGGCGG + Intergenic
1072881338 10:99232654-99232676 GGGCGCAGGGCAGCGGCCAAGGG - Intronic
1073177756 10:101566727-101566749 GGGAGCCCAGCCGCTGCCGCCGG + Intergenic
1073290058 10:102409101-102409123 GGCCGGCGCGCCGCGGCCCCCGG + Intronic
1073491352 10:103855362-103855384 GCGCGCCGGGCCGGGGTGGCGGG - Exonic
1074591918 10:114821862-114821884 GGGCGCCGGGACGCGGCGGGCGG - Exonic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1075032043 10:119030068-119030090 GGGGGCCGGGCCTGGGGCGCTGG + Exonic
1075583721 10:123642507-123642529 GGGCGCCAGGCCTTGGCTGCAGG - Intergenic
1075754755 10:124801911-124801933 GGGCCCCCTGCCGCGCCCGCTGG + Intronic
1075801854 10:125159420-125159442 GCGGGCCGGGCGGCGGGCGCGGG - Intronic
1076096752 10:127738894-127738916 GGCCACCAGACCGCGGCCGCCGG + Exonic
1076157027 10:128212089-128212111 GGGCGCGCGTCTGCGGCCGCGGG + Intergenic
1076306201 10:129467188-129467210 GGGCGCGGGGGCGGGGCCGAGGG - Exonic
1076683593 10:132187124-132187146 GGGCGGCGGGCAGGGGGCGCCGG - Intronic
1076825338 10:132964450-132964472 GAGCGCAGGGAGGCGGCCGCAGG - Intergenic
1076863982 10:133158529-133158551 GGGCCTCGGGCAGGGGCCGCAGG - Intergenic
1076879070 10:133231126-133231148 GCGCGCCCGTCCGCGGCCCCGGG + Exonic
1076993899 11:289271-289293 GGGGGACGGGCCGGGGCGGCCGG - Intronic
1077060413 11:615437-615459 AGACGCCAGGCCGCGGCCACAGG + Exonic
1077076818 11:705904-705926 GGGCGCAGGGCCGCCTCCGCGGG - Intronic
1077076992 11:706417-706439 GGCGGCCGGGCCGAGGGCGCGGG + Intronic
1077090746 11:777258-777280 GGGCGCCGGGCAGGGGCCGGGGG - Intronic
1077124422 11:926109-926131 GGGGCCGGGGCCGGGGCCGCCGG + Intronic
1077250064 11:1557012-1557034 CGGCGGGGGGCCGGGGCCGCCGG + Exonic
1077253753 11:1571806-1571828 GGGCGCCGCGTCGGGGGCGCTGG - Intronic
1078476171 11:11632422-11632444 GGGCGTCGGGCCCCAGCCCCAGG - Intergenic
1078659800 11:13277741-13277763 GGGGGCCGGGCCTGGGCCGGCGG + Intronic
1078800970 11:14643928-14643950 GGACCCCGGGCCGTGGCGGCCGG + Exonic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1079250147 11:18781145-18781167 GGGGGCCGGGGCGGGGCCGGGGG - Intronic
1080406908 11:31987583-31987605 GGGCGCGGGGCTGGGGGCGCTGG + Intronic
1080606825 11:33870482-33870504 GGGCTCCGGGCTGCGGGCTCCGG + Intronic
1080749488 11:35139231-35139253 GGGCGCGGGGCAGGGGCCGGCGG - Exonic
1080802141 11:35618788-35618810 GGGCGCGGGGCCGCCGCTCCGGG - Exonic
1081807844 11:45900005-45900027 GGGAGCCGAGCAGGGGCCGCCGG - Intronic
1082789261 11:57335837-57335859 GGACGCGGGGCCGCGCACGCGGG - Exonic
1083656995 11:64234590-64234612 TGGCGGCGGGCAGCGGCGGCGGG - Exonic
1084010870 11:66347684-66347706 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1084010873 11:66347691-66347713 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1084028406 11:66466950-66466972 CGGCCCCGGGCCGCTGCGGCGGG - Exonic
1084041557 11:66545865-66545887 CGGTCCCGGGCCGCCGCCGCTGG - Exonic
1084146255 11:67266827-67266849 CGGGGTCGGGCCGGGGCCGCGGG - Intronic
1084171280 11:67401983-67402005 GGGGGCGGGGCCTCGGCGGCGGG + Intronic
1084295683 11:68212652-68212674 GGTCGCCGGGCCACGGCCAGGGG + Intronic
1084410813 11:69005064-69005086 GGGAGCCGGGCAGGGGCCACAGG + Exonic
1084538894 11:69774691-69774713 GGGCGGGGGGCAACGGCCGCCGG - Intronic
1084758038 11:71251654-71251676 GGCGGCCGGGCTGCGCCCGCCGG + Intronic
1088462241 11:110093524-110093546 GGGCGCCAGGCGGAGGGCGCCGG + Intronic
1088588337 11:111379410-111379432 GCGCTCTGGGCCGGGGCCGCTGG - Exonic
1088912076 11:114199346-114199368 GGGCCCCGGGACGGGGCTGCTGG + Intronic
1089262413 11:117232175-117232197 GGGAGCCGGACCCCGGGCGCCGG - Exonic
1089700212 11:120240102-120240124 CGGCGCGGGGCGGGGGCCGCCGG - Intronic
1090326170 11:125887976-125887998 GCGCGGCGGGCCGCAGCCCCTGG + Intronic
1090616794 11:128522373-128522395 CGGCGCCGCGTCTCGGCCGCTGG + Intronic
1090699313 11:129279631-129279653 AGGCGCGCCGCCGCGGCCGCGGG + Intergenic
1091730528 12:2877089-2877111 GGGTCCCGGGCCGGGGCCGGGGG + Intronic
1092219124 12:6700760-6700782 GGGCGCGGGGCGGCGGCGGTGGG + Intronic
1092246762 12:6868118-6868140 CGGCGCGGGGACGCGGACGCCGG - Intronic
1092294853 12:7189774-7189796 GGGCCCAGGGACGCGGCCCCGGG - Intronic
1092462334 12:8697828-8697850 GGGCGGGGGGCGGCGGCCGGAGG - Intronic
1093435281 12:19129577-19129599 GGCGGCCGGCCGGCGGCCGCCGG + Intergenic
1093958846 12:25251105-25251127 GGGGGCCGGGCCGGGCCGGCGGG + Intergenic
1094853922 12:34394518-34394540 GGGCGCCTGGCCAAGGCAGCAGG + Intergenic
1095581577 12:43806286-43806308 GGGCCGCCGGCCGGGGCCGCTGG - Intronic
1095810995 12:46372937-46372959 CGGGGCTGGGCCGCGGGCGCGGG - Intergenic
1096154315 12:49333313-49333335 GGCGGCCGGGCAGCCGCCGCAGG + Intronic
1096284131 12:50283524-50283546 GGGGTCCGGGGCGGGGCCGCAGG - Intronic
1096482436 12:51951646-51951668 GGGAGCCGGGCCGCGGGAGGAGG + Intronic
1096482517 12:51951889-51951911 AGGCCTCGAGCCGCGGCCGCTGG + Intronic
1097891445 12:64781098-64781120 AGGCGGCGGGCGGGGGCCGCGGG + Intergenic
1098161129 12:67648943-67648965 CGGCGGCGGGCCCCGGCCGAGGG + Exonic
1100260652 12:92929334-92929356 GCGGGCCCGCCCGCGGCCGCCGG + Intergenic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1102197194 12:111034070-111034092 GGGCGGCCGGCGGCGGCCCCGGG + Exonic
1102197265 12:111034338-111034360 GGGCGGCGGGCGGCGGCTGCCGG + Intronic
1102254060 12:111406028-111406050 CGCCCCCGGGCCGCCGCCGCCGG - Exonic
1102256467 12:111418393-111418415 GGGCGCCGGGCCGCGACTACCGG + Exonic
1102644620 12:114396134-114396156 GGGAGGCGAGCCGCGGCCGGGGG + Intronic
1102644647 12:114396223-114396245 GGCGGCCGGGCCACGGCGGCCGG - Intronic
1102933775 12:116880935-116880957 GAGAGCCGGGGCGCGGCAGCTGG - Intronic
1103364071 12:120369463-120369485 CGGCGCGGGGGCCCGGCCGCGGG + Intergenic
1103595601 12:122022717-122022739 GGGCGCCGGGCCCGGGAGGCGGG - Intronic
1103698545 12:122835650-122835672 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1103698548 12:122835657-122835679 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1103698551 12:122835664-122835686 GGGCGGCGGGCGGCGGCGGGCGG + Intronic
1103749771 12:123150840-123150862 GCCGGCCGGGCCGGGGCCGCGGG - Intergenic
1103800315 12:123533620-123533642 GGGCAGCGGGCGGCGGGCGCGGG + Exonic
1104049498 12:125186290-125186312 GAGGGCGGGGCCGCGGCCGGGGG - Intergenic
1104376260 12:128267327-128267349 GGGCGGCCGGCGGGGGCCGCGGG + Intergenic
1104692790 12:130839190-130839212 TGGCGCCGGGCCGGGACCGCGGG - Exonic
1104841602 12:131828511-131828533 GGGCGGCGGGCCGGGTCCCCGGG - Exonic
1104854298 12:131894888-131894910 GGGCGCGGGGCCGGGGGCGCGGG - Exonic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1104980147 12:132570056-132570078 GGGAGCCGGGCGGGGGCCCCGGG - Exonic
1105031475 12:132887380-132887402 GGGCGCCGAGTCTCGGCCTCTGG - Intronic
1105454251 13:20525806-20525828 GGACGCGGCGCCGCGGGCGCTGG + Exonic
1105578594 13:21674318-21674340 GGGCCCCTGGCCGGAGCCGCAGG + Intronic
1106033161 13:26020651-26020673 GGGCGCCTGGACACGGCGGCAGG - Exonic
1106226338 13:27789829-27789851 AGGCGGCGGGCAGAGGCCGCGGG + Intergenic
1108689298 13:52847441-52847463 GGGCGCAGGACCGCGGACCCGGG - Exonic
1109284787 13:60397425-60397447 GGCTGCCGGGCCGCGGGTGCGGG + Intronic
1109284872 13:60397628-60397650 GGGCGGCGGGCCTGGGCCCCGGG + Intronic
1109284878 13:60397641-60397663 GGGCCCCGGGCGGCGGGCGGCGG + Intronic
1110318639 13:74135697-74135719 GCGGGCCGGGCCGGGGGCGCGGG - Intergenic
1110450796 13:75636124-75636146 GGGGCCCGGGCCGCGGCCCCTGG + Intronic
1110573065 13:77026937-77026959 GCGCGGGGGGCCGCGGCTGCGGG - Exonic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1113201077 13:107867626-107867648 GGGAGCCGGGCGGGGGCCCCCGG - Intergenic
1113494215 13:110714662-110714684 GGGCGCCGAGACGGGGCTGCAGG + Intronic
1113655769 13:112067158-112067180 GGGCGGCGCGCCGCGTGCGCTGG - Intergenic
1113768441 13:112894613-112894635 GGACGCTGGGCAGGGGCCGCGGG - Intronic
1114270689 14:21098363-21098385 GGGCGGCGGGCCGGCGGCGCGGG + Exonic
1114270710 14:21098431-21098453 GGGGGCCGGGCCGGGGGCGGGGG - Exonic
1115028467 14:28767669-28767691 GGGCGGCGGGCCGGGGGAGCTGG + Exonic
1115203121 14:30874597-30874619 GAGCCCCGGGCGGCGGGCGCGGG + Intronic
1115545461 14:34462049-34462071 GGGGGCCGGGCTGGGGGCGCGGG - Intronic
1115687282 14:35809135-35809157 TGGCGGCGAGCGGCGGCCGCTGG - Exonic
1116886951 14:50231371-50231393 GGGCGGGAGGCGGCGGCCGCCGG - Exonic
1116887108 14:50231930-50231952 GAGCGCCGGGCCGAGGGGGCGGG - Intergenic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1118841921 14:69519872-69519894 GGGCGCCTGGCCGCGCACGGTGG + Intronic
1118932383 14:70254949-70254971 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932386 14:70254956-70254978 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932389 14:70254963-70254985 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932392 14:70254970-70254992 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932395 14:70254977-70254999 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932398 14:70254984-70255006 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932401 14:70254991-70255013 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1118932404 14:70254998-70255020 GGGCGGCGGGCGGCGGGCGGCGG - Intergenic
1119003911 14:70907541-70907563 GGGGGCCGGGCCGCGGCTCCGGG + Exonic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119701997 14:76761854-76761876 GAGCGGCGGGCTGCGGCCGCGGG - Intergenic
1120167880 14:81220308-81220330 GAGCGCCGGGCGGCGGGCGCGGG - Intronic
1120881296 14:89417011-89417033 GGGCGGCGGGGGGCGGCCGCGGG + Intronic
1121050488 14:90816443-90816465 GGGAGGCGGGCGGCGGCGGCGGG + Intronic
1121074925 14:91060230-91060252 GGGCGCGGGGCCGCAGCCGTGGG - Intronic
1122270959 14:100568285-100568307 AGCAGCGGGGCCGCGGCCGCCGG - Intronic
1122273176 14:100577533-100577555 GGGCTCTGGGCTGCGGCCTCTGG + Intronic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122543377 14:102509726-102509748 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1122719865 14:103716018-103716040 CGGGGCCGGGCCGGGGCGGCGGG - Intronic
1123014707 14:105368152-105368174 GGGCGCGGAGCCCCGGCCCCAGG - Intronic
1124121694 15:26893884-26893906 GCGCGCGGGGCGGCGGCAGCCGG + Intronic
1124426890 15:29570415-29570437 GGCCGCCGGGACGCCACCGCGGG - Intronic
1124790144 15:32718945-32718967 TGGCGCCGGGCAGCGGCCACCGG + Intronic
1125329181 15:38565174-38565196 GTGCTCCGAGCAGCGGCCGCAGG - Intronic
1125508832 15:40282197-40282219 GGGCGGCGGCCTGCGGCCACGGG - Exonic
1128160986 15:65422830-65422852 GGGACGCCGGCCGCGGCCGCGGG - Exonic
1128264317 15:66253720-66253742 GGGCGGCGGGCAGCGGGCACCGG + Exonic
1128743176 15:70097016-70097038 GGGCGCCGGGGCCGGGCGGCGGG + Exonic
1128743179 15:70097022-70097044 CGGGGCCGGGCGGCGGGCGCGGG + Exonic
1129162192 15:73753085-73753107 GGGCGCCGGGTCGCCGCCGGTGG + Intergenic
1130115598 15:81002097-81002119 GGGCACTGGGCTGCGGCGGCGGG - Exonic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131061932 15:89409791-89409813 GGGCTCCAGGTCGCGGCCGCGGG + Intergenic
1131144037 15:90000439-90000461 GGGCGCCGAGGCGTGGTCGCTGG - Intergenic
1131272810 15:90957204-90957226 GCGCGCCGGGCCGGGGCCGGAGG + Exonic
1132105334 15:99059057-99059079 CAGCGCCGGGGAGCGGCCGCTGG - Intergenic
1132251979 15:100341320-100341342 GGGCTGCGGGCAGCGGCGGCAGG + Exonic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132498593 16:275103-275125 GAGCGCGGGGCCGCGGAAGCGGG + Intronic
1132519716 16:381651-381673 GGGCGTGGGGCCGGGGCTGCGGG - Intronic
1132523498 16:402081-402103 GGGGTCCGGTCCGCGGGCGCCGG + Intronic
1132591169 16:727080-727102 GGAGGCGGGGCCTCGGCCGCCGG - Intronic
1132719651 16:1309485-1309507 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1132719739 16:1309786-1309808 GGGGGCCGGGCCGGGGCCGCGGG + Intronic
1132875572 16:2135561-2135583 GGGCGCTGGGCCGCAGAGGCAGG + Exonic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1132915435 16:2341213-2341235 GGGCGCTGGGGCGCGACCGAAGG + Intergenic
1132942171 16:2513796-2513818 GGGCGCCGGGGCCGGGTCGCTGG + Intronic
1132978031 16:2720178-2720200 GGGCGCAGGGCCGTGGTCGGCGG + Exonic
1133032932 16:3020323-3020345 GGGGGCGGGGCGGCGGCCGTGGG + Exonic
1133272361 16:4616438-4616460 GGGCGCTGGGCCGGGGAGGCCGG + Intergenic
1134134149 16:11668581-11668603 GGGCGCCGGGGCCCGGGGGCGGG + Intronic
1134849796 16:17470603-17470625 CGGCGCGGGGCCGGGGCCGGGGG + Exonic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1136365469 16:29807212-29807234 GGGGGCGCGGCCTCGGCCGCGGG - Exonic
1136408910 16:30065358-30065380 CGGCCCCGGGCCGCGCGCGCTGG + Intronic
1136630890 16:31488728-31488750 GGTCGCCGGCGCGTGGCCGCAGG - Exonic
1136779105 16:32885961-32885983 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1136891512 16:33975557-33975579 GTGAGCCGGGCAGCCGCCGCGGG + Intergenic
1137454809 16:48610087-48610109 GGGCGGCGGGGCGCGGGCGGGGG - Exonic
1137620966 16:49876519-49876541 GGGCGCAGGCCCGAGGCCGGGGG + Intergenic
1138595215 16:58026064-58026086 GGGAGCCGGGCCCCAGGCGCTGG + Exonic
1139364827 16:66427040-66427062 GGGAGCCGCGCCGCCGCCGAGGG + Intergenic
1140223112 16:73058194-73058216 CGGCCCCGCGCCGCCGCCGCCGG - Intronic
1141054530 16:80803721-80803743 GGGGGGCGCGCCGCGGCCGGCGG - Intronic
1141054641 16:80804086-80804108 CGGCGGCGGGCGGCGGCGGCGGG - Intronic
1142008463 16:87701567-87701589 GGGTGCTGGGCCCAGGCCGCTGG + Intronic
1142120096 16:88382963-88382985 GGACGCCGGCCGGCGGCCGCGGG - Intergenic
1142191581 16:88720632-88720654 GGCGGCCGGGCGGCGGCTGCAGG - Exonic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1203081520 16_KI270728v1_random:1148049-1148071 GTGAGCCGGGCAGCCGCCGCGGG - Intergenic
1142600172 17:1050018-1050040 GGGCGCCGGGGCGAGGCTGAGGG - Intronic
1142855103 17:2724698-2724720 TGGCGCCGGGGCCCGGGCGCGGG + Intergenic
1142876385 17:2853896-2853918 GGGGGCCGGGGCGCGGGCTCAGG + Intronic
1143106613 17:4533462-4533484 GGGAGCTGGGCCTGGGCCGCGGG + Intronic
1143478722 17:7217152-7217174 GGGGGCCTGGCCGCGGCGGCGGG + Exonic
1143750353 17:9022579-9022601 GCGCGCCGGGGGCCGGCCGCAGG - Exonic
1143830387 17:9645905-9645927 CGGCGATGGGGCGCGGCCGCCGG + Exonic
1144759690 17:17700399-17700421 GGGCGGCGGGGCGCGGCCGCTGG - Intronic
1144854148 17:18258727-18258749 GAGCGCCGGGGCGAGGGCGCTGG + Exonic
1145041736 17:19582343-19582365 GGGCGCCGGGCAGGCGCCCCTGG - Intergenic
1145042675 17:19588358-19588380 GGGCGCCGGGCAGGCGCCCCTGG + Intergenic
1145846254 17:28041708-28041730 GGGGGCGGGGCCTCGGCGGCTGG + Intergenic
1146022707 17:29293124-29293146 GGGCGCGGGGCGCCGGCCTCGGG + Intronic
1146052885 17:29567051-29567073 GGGCCCTGGGCAGCCGCCGCCGG - Exonic
1146126538 17:30235827-30235849 GAGCGCGGAGCCGCGGCCGCGGG - Exonic
1146182934 17:30709064-30709086 GGGCGCCAGGCCGGGCCCGTGGG - Intergenic
1146208308 17:30922774-30922796 GGTCGCCGCGCAGCGGCCGGTGG + Intronic
1146377187 17:32302752-32302774 GGGACCCGAGCCGCGGCCCCTGG + Intronic
1146393674 17:32444732-32444754 GGGGGCCGGGCCGGGGGCGCAGG + Intronic
1147006380 17:37407062-37407084 GGGCTGCGGGCCCCGGCGGCGGG + Intronic
1147139621 17:38453862-38453884 GGGCGCCTAGCAGCGGCCCCGGG + Intronic
1147159459 17:38561919-38561941 CTGAGCCTGGCCGCGGCCGCCGG - Exonic
1147264087 17:39224829-39224851 GGACGCGAGGCCGCGGCCGGGGG - Intronic
1147264384 17:39225886-39225908 GGGTGCCGGGCTGGGGCCGGCGG - Intergenic
1147319453 17:39637056-39637078 GGGCGAAGGGGCGGGGCCGCAGG + Exonic
1147612801 17:41811661-41811683 GGGCGCGGGGCCGCTGCAGTTGG + Exonic
1147896568 17:43755386-43755408 GGGCGCGGGGCCGCGGCTTCCGG + Exonic
1147994583 17:44353889-44353911 GGGGGCGGGGCCGCAGCCGCGGG - Exonic
1148156834 17:45429590-45429612 GGGCGCTGGGGCGCGGAGGCGGG - Intronic
1148183145 17:45620798-45620820 GCGAGCCGGGCAGCGGCCGCGGG + Intergenic
1148211208 17:45809709-45809731 GGGCGTCTGGCCGGGGCGGCTGG + Intronic
1148265705 17:46224893-46224915 GCGAGCCGGGCAACGGCCGCGGG - Intronic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148452687 17:47790205-47790227 GGGCTCCGCTCCGCGGCCACTGG + Intergenic
1148818229 17:50346003-50346025 GCGCGCCGGGGCGGGGCCGGGGG - Intergenic
1150002664 17:61451661-61451683 GGGTGCGGGGCGGCGGCGGCAGG - Intergenic
1150137558 17:62704048-62704070 GGGCGCCTGGGCGCGGCGCCGGG + Intronic
1150250065 17:63700169-63700191 GGGCGCGGGGCGGGGGCCGGCGG - Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1151696604 17:75721272-75721294 GGGCGCTGGGCGGGCGCCGCGGG + Intergenic
1152225467 17:79090666-79090688 GGGCGCCGAGGAGCGGCCCCAGG - Intronic
1152406624 17:80101626-80101648 GTGAGCCGGGCCGGGGCTGCGGG + Intergenic
1152627330 17:81393692-81393714 GCGGGCCGGGCCGGGGACGCAGG - Intergenic
1152663120 17:81552141-81552163 GAGCGCCGGCCCGCGGGGGCGGG - Intronic
1152789895 17:82273276-82273298 GGGCGGCGGGCGGGGGCGGCGGG + Intronic
1152808609 17:82370918-82370940 AGGGGCCGGTCCGCGGCCTCAGG + Intergenic
1152834335 17:82519762-82519784 GGGGGCCGAGCGGAGGCCGCCGG - Exonic
1152844900 17:82593661-82593683 GGGAGCCGGGCTGAGGCTGCGGG + Intronic
1152861442 17:82698700-82698722 GGGCGGCGGGGCGGGGCCGGAGG - Exonic
1153688112 18:7566925-7566947 AGCCGCCTGGCCGCGCCCGCGGG + Exonic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1154125712 18:11690024-11690046 GGGCACCGGGGAGCGGCGGCGGG + Intronic
1154266477 18:12883553-12883575 GCGAGCCGGGCCGCGGCGTCCGG - Intronic
1154303969 18:13217703-13217725 GGACGCGGCGCTGCGGCCGCCGG - Intronic
1155257913 18:24014645-24014667 GGGCGTCCGGCCGCCGCCGCGGG - Exonic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1156171671 18:34493717-34493739 CGGCGCCGGGGCGCGGACACAGG + Intronic
1156446954 18:37243972-37243994 GGGCGCCTGGCTGCCGACGCCGG - Exonic
1156448596 18:37254060-37254082 GGGCACCGGGGCGGGGCCGGGGG - Intronic
1157279106 18:46334197-46334219 CGGCTCCGGGGCGCGGGCGCGGG - Intronic
1157384034 18:47247412-47247434 GGGGCAGGGGCCGCGGCCGCCGG - Intronic
1157473692 18:48008323-48008345 GGGCGCTGGGCCGGGGGCGGGGG + Intergenic
1159586570 18:70288775-70288797 GGGCGCCGGGCCGGGGTCGTGGG - Intergenic
1159670155 18:71212536-71212558 GGGCGGCGGGGCGGGGCGGCGGG + Intergenic
1160025432 18:75211798-75211820 GGACGCGGGGCCCCGGGCGCGGG - Intronic
1160163186 18:76491214-76491236 GGGCTCCGGGCCGGGGCAGGCGG - Intronic
1160204620 18:76822669-76822691 GGGCGCGAGGGCGCGGCCGCGGG - Intronic
1160453335 18:78979739-78979761 GGCCGCCCGGCGGCGGCGGCGGG + Intergenic
1160592353 18:79951580-79951602 GGGCGCGGGGCTGGGGGCGCAGG - Exonic
1160631169 18:80247242-80247264 GGGCGCAGGGCCGCCGGGGCGGG + Intronic
1160680342 19:409221-409243 GGGGGCGGGGGCGCGGGCGCGGG - Intergenic
1160763762 19:798111-798133 GCGCCCCGGGCCGCGGCCAAGGG + Intronic
1160766813 19:812525-812547 GGGGGGCGGGCCGAGGGCGCGGG - Exonic
1160766865 19:812681-812703 GGGCGCTGGGCCCGGGCAGCCGG - Exonic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1160930714 19:1568357-1568379 CGGGGCCGGGGCGGGGCCGCGGG - Intergenic
1160935484 19:1592661-1592683 GGGGTCCGGGCGGCGGCGGCGGG - Exonic
1161006737 19:1940969-1940991 GGCCGCCGGGCCGCTGCCCGCGG - Intergenic
1161015503 19:1980925-1980947 AGGCGCCGGGGCGCAGCCTCCGG - Exonic
1161210222 19:3062055-3062077 GGGCGCCGGGCCGGAGGCACCGG + Intronic
1161215821 19:3094599-3094621 GGGGGCCGGGGGGCGGCGGCGGG + Exonic
1161219978 19:3113985-3114007 GGTGGCCGGGCCATGGCCGCAGG + Intronic
1161222089 19:3122477-3122499 GGGCCCCGGGAGGCGGCCCCCGG - Exonic
1161249029 19:3270678-3270700 GGGCGCCGGGCCGCGGGGTGGGG + Intronic
1161276519 19:3421328-3421350 GGGCGCCAGGCCGTGGGCACAGG - Intronic
1161293530 19:3507899-3507921 AGGCGCCGGGCAGCGGCCAGTGG - Intronic
1161396401 19:4047114-4047136 GGGCGACGGGGGGAGGCCGCAGG + Exonic
1161396629 19:4047983-4048005 GGGCGCCCCGCCCCGGACGCGGG + Exonic
1161569121 19:5020597-5020619 GGAAGCCAGGCCGCGGGCGCTGG + Intronic
1161721183 19:5903567-5903589 GGGTGGAGGGCCGAGGCCGCAGG - Intronic
1161820900 19:6530938-6530960 GGGCGGAGGGGCGTGGCCGCGGG + Intergenic
1161851395 19:6739695-6739717 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1161925133 19:7294133-7294155 GGGGCCCGGGCCGCAGCGGCCGG - Intergenic
1161973419 19:7596218-7596240 GGGCGCCGGGCCGGGAAGGCAGG + Intronic
1162013184 19:7830279-7830301 GGGGGCCGGGCCGGGGCTGCGGG + Intronic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1162535828 19:11262452-11262474 GGGCCCGGGGCGGCGGCGGCGGG - Exonic
1162940397 19:14005904-14005926 GGGGGCCGGGCCGCGGGGACGGG + Intronic
1162975876 19:14206741-14206763 GGGCGCCGGGCCGGGCCCGTGGG + Intergenic
1163033694 19:14560125-14560147 GGACGCCGGGCTGCGGCAGGAGG - Intronic
1163085882 19:14979593-14979615 AAGCGCCCGGCCGGGGCCGCGGG + Intronic
1163123829 19:15233436-15233458 CGGCGCCGGGCCGAGGCCGCTGG - Intergenic
1163138647 19:15331960-15331982 GGGCGCCGCGGCGGGGCCGGCGG - Intronic
1163334333 19:16661141-16661163 AGTCGCCGGGCCGCGGGCGGCGG + Exonic
1164639006 19:29811639-29811661 GAGGGGCGGGCCGCGGGCGCCGG - Intergenic
1164834755 19:31349894-31349916 GGGCGCCGCGCCCCCGCCCCCGG + Intergenic
1165040238 19:33063810-33063832 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
1165129175 19:33621702-33621724 GGGCGCGGTCCGGCGGCCGCGGG - Intergenic
1165349828 19:35269381-35269403 GGGCGCGGGGGCGGGGGCGCGGG + Intronic
1165349830 19:35269387-35269409 GGGGGCGGGGGCGCGGGCGCGGG + Intronic
1166043815 19:40218019-40218041 GCGCGCCGGCCCGGGGCTGCTGG + Exonic
1166194835 19:41198732-41198754 GGGGGCCTGGCAGGGGCCGCAGG - Exonic
1166330528 19:42075817-42075839 AGGCGGCGGAGCGCGGCCGCGGG - Intronic
1166331572 19:42080791-42080813 CGGCGGCGGGCAGGGGCCGCAGG - Exonic
1166518360 19:43463570-43463592 GGGGGCCGGGCCGTAGCTGCGGG - Intronic
1166524968 19:43504911-43504933 TGGGGCCGGGCCGGGGCCGGTGG - Exonic
1166797979 19:45439675-45439697 GGGCGTCGGGACGCGTCCGCCGG - Intronic
1166803676 19:45472679-45472701 GGGGCCCGGGCCGGGCCCGCTGG + Exonic
1167268250 19:48493882-48493904 GGGCGCGGCGGCGGGGCCGCGGG - Exonic
1167391260 19:49196644-49196666 GGGAGCCGGGCGGCGCCGGCTGG - Exonic
1167441906 19:49513510-49513532 GGGCGGCGGGAGGCGGCCCCAGG + Intronic
1167738757 19:51311857-51311879 CGGAGCCGGGCCCCGGGCGCAGG - Exonic
1167975775 19:53224847-53224869 GCGCTCCGGGCCCGGGCCGCTGG - Intergenic
1168297303 19:55383739-55383761 GGGCCCGGGGCGGCGGGCGCGGG - Exonic
1168297347 19:55383862-55383884 GGGCGCTGGCCCGCGGCGGCGGG + Exonic
1168412186 19:56146995-56147017 GGGCGACGCGCCGGGCCCGCGGG + Exonic
924987773 2:287764-287786 GGGCGGCGGGGCGCGGCCGGGGG - Exonic
925959796 2:9003861-9003883 GGGCGCCGGGGCGGGGACGACGG - Intergenic
926190065 2:10721669-10721691 GGGCGACGGGCGGCGGGTGCGGG - Exonic
926202603 2:10812583-10812605 CCCCGGCGGGCCGCGGCCGCAGG - Intronic
926217041 2:10912186-10912208 GGGCGCCCGGGCGAGCCCGCGGG - Exonic
926285291 2:11482924-11482946 AGGAGCGGGGCCGCGGCGGCCGG + Intergenic
926914338 2:17878500-17878522 GCGCCCCGGGCCGAGGGCGCGGG - Intronic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927652398 2:24920346-24920368 AGGCGCCGGGCGGCGGTCCCAGG + Intergenic
927714313 2:25342172-25342194 GGGCCCCGGGGCGCCGCGGCGGG + Intronic
927751458 2:25673717-25673739 GGTGGGCGGGGCGCGGCCGCGGG - Intergenic
928143709 2:28752340-28752362 GGGCGCGGGGGAGCGGCCTCTGG + Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
929756354 2:44768676-44768698 GGGCTCCGGGACGCGGCCGCCGG + Intronic
929874036 2:45781634-45781656 GGGGGCCGGGGGGCGGGCGCGGG - Intronic
930700945 2:54457088-54457110 GGGCGCGGGGCCGCCGCCTCCGG - Intronic
930701087 2:54457683-54457705 TGGGGCCGGGCGGGGGCCGCAGG - Intronic
931321460 2:61177654-61177676 GAGGGCCGGGCCGCGGGAGCCGG + Exonic
931671590 2:64653421-64653443 GGGGCCCGGACCGGGGCCGCGGG + Intronic
931671795 2:64654059-64654081 CCGCGGCCGGCCGCGGCCGCAGG + Intronic
932725758 2:74178633-74178655 TGGGGTCGGGCCGCGGGCGCCGG - Intronic
933278219 2:80304613-80304635 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
933278222 2:80304620-80304642 GGGCGGCGGGCGGCGGGCGGTGG + Exonic
933847374 2:86337067-86337089 GGGCGGCGGGGCGCGGCGCCGGG + Intronic
933858482 2:86441577-86441599 GGGCGCCGGGGCGGGGCGGCGGG + Intronic
935112288 2:100104733-100104755 GGGCGCAGGGCCGGGGGCGGGGG - Intronic
935255718 2:101308265-101308287 GGGCGCGGCCCCTCGGCCGCCGG + Exonic
935265108 2:101387184-101387206 CGGCGCCCGCCCGGGGCCGCAGG + Exonic
935301615 2:101697929-101697951 GGGCCGCGGGCGGCGGCGGCGGG - Intronic
936433287 2:112482302-112482324 GGCCGCCGGGCAGCCGCCGCAGG - Exonic
937221930 2:120346769-120346791 GCGCGCAGGGCCACGGCCGAAGG - Intronic
937283536 2:120736220-120736242 GGGCGCCGGGCGGTGGCTGTGGG - Intronic
938034701 2:128027091-128027113 GGGCGGCGGGCGGCGGCTACAGG - Exonic
938035064 2:128028268-128028290 GAGCGCCGGGGCGGGGCCGCAGG + Intergenic
938416143 2:131105260-131105282 GCGCGGCGGGCCCCGGCCGGTGG - Exonic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
939630809 2:144524353-144524375 GGGCGGCGGGCGGGGGTCGCAGG - Intronic
940640776 2:156342445-156342467 GGCCGCGGGGCCGAGTCCGCGGG - Intergenic
941666364 2:168247296-168247318 GGGGCCGGGGCCGGGGCCGCGGG + Exonic
941934815 2:170974111-170974133 GGGCGCCGGGGTGGGGCGGCTGG + Intergenic
942314093 2:174682585-174682607 GGGCGCGGGCGCGCGGCCTCGGG - Intronic
942459116 2:176157431-176157453 GGGCGCGGGAGCGCGGCCGCAGG + Intronic
942463845 2:176188502-176188524 GGGCGCTGGGCGGCGGCCCTGGG + Intergenic
943333832 2:186590250-186590272 AGGCGGCGGGCCGCGGGCACTGG + Exonic
943342084 2:186693928-186693950 GGGCGCGGGACCGCGGGCCCCGG + Intergenic
943669985 2:190649500-190649522 GGGCTCCGCGCGGCCGCCGCCGG + Intronic
945225845 2:207530389-207530411 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
945879556 2:215311989-215312011 GGGCGCCGGGCAGGGCCGGCGGG + Exonic
946339182 2:219057389-219057411 GGGCCCGGGGCCGGGGCCGCAGG - Intronic
946921521 2:224585491-224585513 GGGAGCCCGGCGGCCGCCGCGGG + Intergenic
947119407 2:226799803-226799825 GGCAGCCGGGCAGCCGCCGCCGG + Intergenic
947523359 2:230864853-230864875 GGGCGCCGGGGCCCTCCCGCGGG + Intronic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948255937 2:236567973-236567995 GGGCGCGGGGCCGGGGCTGGCGG + Intronic
948393308 2:237627512-237627534 GGGCGCTGGGCCGGGGACGCGGG - Intergenic
948473799 2:238203647-238203669 GGGCGACGGGCAGGGGCGGCCGG + Exonic
948479162 2:238239648-238239670 GGGCGCCGAGGTGCGGCGGCCGG - Exonic
948824633 2:240568370-240568392 GGGCGCGGGGCCGGGGCGCCGGG - Intronic
948824693 2:240568529-240568551 CCGCGCCGGGCCGCGGGCGAGGG - Intronic
948909625 2:240996541-240996563 GGGCGCCTGGCCTGGGCAGCTGG + Intergenic
949004291 2:241636828-241636850 GGGCGCCGGGCCTCGGCGGCCGG - Intronic
949040089 2:241844055-241844077 GGGCGCGGGGGCGCGGGCGTGGG + Intergenic
1168757238 20:325957-325979 GGACGGCGGGCCGCCGCCCCCGG + Exonic
1169065485 20:2692623-2692645 CGGGCCCGGGCCGCGGCGGCGGG - Intergenic
1169113349 20:3046804-3046826 GGGCACCGCGACGCGGGCGCTGG + Intronic
1169367238 20:5001432-5001454 CGGCGCCGAGGCGCGGCGGCAGG - Intronic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1171452972 20:25248607-25248629 CTGCGCAGGGCCGCGGCCACGGG + Intronic
1172015426 20:31870255-31870277 CAGCGCCGGGCCGCGGCGGCCGG + Intronic
1172037318 20:32019157-32019179 GCGCGCCGGGGCGCGGGCGTCGG + Exonic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1172703018 20:36863952-36863974 GGGCGCAGGGGCGCCTCCGCCGG - Intergenic
1172742371 20:37179165-37179187 GGGATCCCGGCCGCGGCTGCTGG + Exonic
1173166239 20:40688968-40688990 GCGCAGCGGGCCGGGGCCGCCGG + Exonic
1173516203 20:43667164-43667186 GGGCCCCGGGCCGCGCTCGAAGG - Exonic
1173605163 20:44326683-44326705 TGGCGCCAGGACACGGCCGCGGG + Intergenic
1174204394 20:48828175-48828197 GAGCGCCGCGCCGCGTCCCCAGG - Intergenic
1174873971 20:54208159-54208181 CGGCGCCGGATCTCGGCCGCTGG + Intronic
1175215288 20:57389305-57389327 GGGGGCCGGGCCCAGGCGGCAGG - Intergenic
1175427540 20:58878254-58878276 GGGCATCGGGCCCCGGCCCCAGG + Intronic
1175439648 20:58981551-58981573 GGGTCCCGCGGCGCGGCCGCCGG + Intronic
1175831096 20:61965873-61965895 GGGGGCAGGGCCGAGGCGGCAGG - Intronic
1175847334 20:62065644-62065666 GAGGTGCGGGCCGCGGCCGCCGG - Exonic
1175847584 20:62066453-62066475 GGGCGCCGGTCCCCGTCCCCAGG - Intergenic
1175856000 20:62121640-62121662 GGCCTCCGGGCCGCAGCCCCGGG + Intergenic
1175902956 20:62367173-62367195 GGGCCCCGCGCCGCTGCTGCTGG - Exonic
1176173740 20:63708097-63708119 GGGCGCCGGGCCGCTCTAGCCGG + Exonic
1176243295 20:64084871-64084893 GGGGGCTGGGCCTCGGCTGCAGG - Intronic
1176247007 20:64102219-64102241 GGGCCCCGGGGCGCTGCGGCGGG + Intergenic
1176380802 21:6111333-6111355 GGGCGCCGGGCCGGGGCTCGGGG + Intronic
1176548914 21:8213285-8213307 GGACGCCGGGCCGCCACCGGGGG - Intergenic
1176556809 21:8257498-8257520 GGACGCCGGGCCGCCACCGGGGG - Intergenic
1176575748 21:8440539-8440561 GGACGCCGGGCCGCCACCGGGGG - Intergenic
1179209366 21:39312975-39312997 GGGCGGCGGGCGGCGGGCGGGGG + Intronic
1179209369 21:39312982-39313004 GGGCGGCGGGCGGGGGGCGCGGG + Intronic
1179444225 21:41420280-41420302 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1179674903 21:42974738-42974760 CGGCGGCGGGCGGCGGCCGCGGG - Intronic
1179742670 21:43426907-43426929 GGGCGCCGGGCCGGGGCTCGGGG - Intronic
1179833432 21:44012465-44012487 GGGGGCCGGGCCGGTGACGCCGG + Exonic
1179929623 21:44558593-44558615 GGGGGCCGGGGCGCAGCAGCTGG + Exonic
1179931505 21:44573889-44573911 GGGGGCCGGGGCGCAGCAGCTGG - Exonic
1179939183 21:44627272-44627294 GGGGGCCGGGGCGCAGCAGCTGG - Exonic
1179942030 21:44646559-44646581 GGGGGCCGGGGCGCAGCAGCTGG - Exonic
1180085372 21:45505735-45505757 GGGTGCTGGGCAGGGGCCGCAGG - Intronic
1180649982 22:17369597-17369619 GGGCGCCGGGCGGGGGGCGGCGG - Exonic
1180650146 22:17370100-17370122 GGGCGTCGGGCCGGGGACGCCGG + Intronic
1180762250 22:18219785-18219807 GGGCGCGGGGCAGCTGCTGCGGG + Intergenic
1180784055 22:18537103-18537125 GGGTGCCTGGCCCCGGCCCCAGG - Intergenic
1180805976 22:18715038-18715060 GGGCGCGGGGCAGCTGCTGCGGG + Intergenic
1180940301 22:19656512-19656534 GGGAGCCGGGCTGAGGCCGCGGG - Intergenic
1180960803 22:19761451-19761473 GAGCGCCGGGCGGCTGTCGCCGG - Intronic
1181127623 22:20711151-20711173 GGGTGCCTGGCCCCGGCCCCAGG - Intronic
1181192513 22:21151756-21151778 GGGCGCGGGGCAGCTGCTGCGGG - Intergenic
1181216926 22:21340819-21340841 GGGCGCGGGGCAGCTGCTGCGGG + Intergenic
1181240956 22:21476455-21476477 GGGTGCCTGGCCCCGGCCCCAGG - Intergenic
1181813710 22:25421139-25421161 GCGCGGCGGGCGGCGGCCGCGGG + Intergenic
1181831612 22:25564797-25564819 GGGCGCCGGGCGGCGCGCGAGGG + Intergenic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182260997 22:29073094-29073116 GGGCCCCGGGGCGCGGCCCGGGG - Intronic
1182424916 22:30266811-30266833 GTGCTCCGGCCCGCGCCCGCTGG + Exonic
1182445474 22:30387180-30387202 GGGCCCGGGGCCGCGGCGGACGG - Exonic
1182809376 22:33103019-33103041 GGGCGGGGGGCAGGGGCCGCGGG - Intergenic
1182903912 22:33920611-33920633 GGGCGCGGGGCCGGGGGCGCGGG + Intronic
1183050685 22:35257998-35258020 GGGCTCGTGGCCGCGGCCACGGG + Intronic
1183093687 22:35540324-35540346 GCGCGTGGGGCCGGGGCCGCTGG - Intergenic
1183093963 22:35541229-35541251 GGGCTCCGGCTCGCCGCCGCCGG - Exonic
1183393731 22:37560372-37560394 GGGGGCCGGGCCCCGCCCGCGGG + Intergenic
1183517050 22:38272767-38272789 GGACGCCCGGCTTCGGCCGCCGG - Intronic
1183702155 22:39457063-39457085 CGGCGCGGGGCGGCGGCGGCCGG + Intergenic
1183903239 22:41021813-41021835 GGGGGCTGGGCGGGGGCCGCAGG + Intergenic
1184033919 22:41909880-41909902 TGGCGCCGGGCCGCGTGCCCGGG + Exonic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184046770 22:41976902-41976924 GGGCGGCGCGGCGGGGCCGCGGG + Exonic
1184411958 22:44331084-44331106 CCGCGCCGGGACGCGGCGGCCGG - Intergenic
1184439082 22:44497920-44497942 GGGCGCGGGGCGGGCGCCGCGGG - Intronic
1184640494 22:45867658-45867680 GCGCGCCGGGCCGCGGGCAGAGG - Intergenic
1184677910 22:46053664-46053686 GGGGGCCGGGGGCCGGCCGCCGG + Intronic
1184697949 22:46150356-46150378 GGGCCCCGGGCCTCGGCCCCGGG - Intergenic
1184769164 22:46587866-46587888 GGGCGTCGGGGTGGGGCCGCGGG + Intronic
1184796763 22:46737707-46737729 GGGCGCGGGGTCGTGGCCCCCGG - Intronic
1184796953 22:46738232-46738254 GGGCGGCGGGCGGCGGGCGGCGG + Exonic
1185056274 22:48580052-48580074 GTACACCGTGCCGCGGCCGCTGG - Intronic
1185255214 22:49827786-49827808 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1185272346 22:49935233-49935255 GGGCGCCGGGCAGAGGCTGGAGG - Intergenic
1185272696 22:49936096-49936118 GAGCGCGGGGCCGGGGCGGCGGG - Intergenic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1185329404 22:50245430-50245452 GGGGTCCGGATCGCGGCCGCGGG + Exonic
1203235247 22_KI270731v1_random:145805-145827 GGGCGCGGGGCAGCTGCTGCGGG - Intergenic
1203253799 22_KI270733v1_random:129593-129615 GGACGCCGGGCCGCCACCGGGGG - Intergenic
1203261855 22_KI270733v1_random:174672-174694 GGACGCCGGGCCGCCACCGGGGG - Intergenic
949987811 3:9553640-9553662 GCGCGCGAGGCTGCGGCCGCGGG + Intronic
950215321 3:11154584-11154606 GGGAGCGGGGCCGCCGCGGCTGG + Intronic
950438431 3:12994010-12994032 GGGCCCCGGGCGGGGGTCGCTGG - Intronic
950759214 3:15206102-15206124 AGGAGCCGGGCCGCGGGGGCGGG - Intergenic
952788240 3:37176562-37176584 GGGCGGCGAGGCGCGGCTGCCGG + Intronic
952889201 3:38029686-38029708 GGGCGCAGGGCAGCGGGGGCGGG - Intronic
952942284 3:38454057-38454079 GGGGGCCGGGGGGCGGCGGCGGG - Exonic
953618225 3:44510733-44510755 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618228 3:44510740-44510762 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618231 3:44510747-44510769 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953618234 3:44510754-44510776 GGGCGGCGGGCGGCGGGCGGCGG + Intergenic
953705438 3:45226504-45226526 GGGCGCCCGGGCGCGTCCGCAGG - Intergenic
954151821 3:48661746-48661768 GCGCCCCGGGCCGCGTCCCCCGG - Exonic
954186272 3:48919153-48919175 GGGCGCCCGGCCGCTGACGGCGG - Exonic
954632916 3:52056608-52056630 GGGGGCGGGGCCGCGGGGGCCGG + Intergenic
954702022 3:52455543-52455565 GGGCGACGGGCGGCGGGGGCCGG + Exonic
954717476 3:52533781-52533803 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
956675096 3:71725488-71725510 GGGCGGCGGGCGGCGGGCGGCGG - Intronic
956678301 3:71754774-71754796 GGACGGCGGGCTTCGGCCGCGGG + Exonic
960896772 3:122514468-122514490 GGGCGGCGTGGCGCGGCGGCGGG - Intronic
961340351 3:126213189-126213211 CGGCGAAGGGCCGCGGCCGCCGG - Intergenic
961585118 3:127915664-127915686 GGGCGCCGACCCGGGGCCACCGG + Intronic
963091396 3:141486926-141486948 GGGGGCGGGGCCGCGGCGGGCGG + Intergenic
963236680 3:142963390-142963412 GGGCGCTGGGCAGCCCCCGCCGG + Exonic
963808642 3:149752497-149752519 AGGCGCCGGGACACGGGCGCCGG - Exonic
964786289 3:160399898-160399920 GGCCGCCGGGGAGCGGCCGAGGG - Intronic
966808732 3:183825555-183825577 GGGAGCGGGGCGGCGGGCGCCGG - Exonic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
966878356 3:184336152-184336174 GGGAGTCGGGCTGCGGCCGCCGG + Intronic
966886529 3:184380389-184380411 GGGCTCTGGGCCGGCGCCGCGGG - Exonic
967596358 3:191329810-191329832 GGGCACCGGGCGAGGGCCGCGGG - Intronic
967840808 3:194003315-194003337 GAGCGCCGGGCCCAGCCCGCCGG + Intergenic
967916725 3:194583908-194583930 CGGCGGCGGGGCGGGGCCGCGGG + Intergenic
968046160 3:195624841-195624863 GGGCGCGGGGCGGAGGCTGCGGG + Intergenic
968075416 3:195813439-195813461 GGGCGCCTGGACGGGGCAGCAGG + Intergenic
968170145 3:196503565-196503587 GGGCCCCGGGACGCGGCTCCGGG + Exonic
968308494 3:197665246-197665268 GGGCGCGGGGCGGAGGCTGCGGG - Intergenic
968479163 4:826221-826243 AGGGGCGGGGCCGCGGGCGCCGG + Intergenic
968512957 4:1003348-1003370 GGGCGGGGCGCCGCGGCCACCGG - Exonic
968522330 4:1039626-1039648 GGGTGCTGGGCCGGGGCCGCAGG + Intergenic
968571811 4:1346292-1346314 GGGTGCAGGGCGGGGGCCGCCGG - Intergenic
968632891 4:1661310-1661332 GGGCGCCGGGCTGTGACCTCCGG - Intronic
968640529 4:1712349-1712371 GGGCGCCGGGCCCCGCCCCTCGG + Exonic
968674602 4:1870979-1871001 GGGCGCGCGGCCGCGGAGGCTGG - Intergenic
968701281 4:2059347-2059369 GGGCGCGGGGCGGAGGCGGCGGG - Intergenic
968815199 4:2818297-2818319 CGGCCCCGGGCCGCGTCCCCCGG - Exonic
968962212 4:3751375-3751397 GGGCTCAGGGCCGTGGCAGCAGG - Intergenic
968968261 4:3780522-3780544 GGGGGCTGGGCCGAGGCCTCTGG - Intergenic
969330764 4:6472427-6472449 GGTGGGCGGGCGGCGGCCGCGGG + Intronic
969379167 4:6782954-6782976 GGAGGCCGGGCCGCAGCCGAAGG + Intronic
969734125 4:8975570-8975592 GGGGCCCTGGCCGAGGCCGCTGG + Intergenic
971195691 4:24470717-24470739 GACCGTCGGGCCGCCGCCGCGGG - Intergenic
971244125 4:24913055-24913077 GGGAGGAGGGGCGCGGCCGCCGG + Intronic
971405624 4:26319477-26319499 GGGCGGCGGGCGGCGGGCGCGGG - Intronic
973110435 4:46390501-46390523 GGGCGGCAGGGCGCGGCCCCAGG - Intronic
975139163 4:70902600-70902622 GGGCGGCGGGCGGCGGGCGGGGG - Intronic
975139168 4:70902607-70902629 GGGCGACGGGCGGCGGGCGGCGG - Intronic
975701986 4:77075674-77075696 GGACGCACGGCTGCGGCCGCTGG + Exonic
975779055 4:77819917-77819939 GGCCCCGCGGCCGCGGCCGCCGG + Intergenic
978503650 4:109434132-109434154 GGGCGCGGTGCGGAGGCCGCGGG + Intronic
978646992 4:110945838-110945860 TGGCGCCCGGCCGCGGCCCAAGG + Intergenic
982564538 4:156971481-156971503 GGGCGCCGGAGCGGGGCCGGGGG + Intergenic
982573295 4:157076477-157076499 GGGCGCCTGGCAGCGGCAGCCGG + Intronic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
983919812 4:173333832-173333854 GTGCGCCGGGGCGCGGGCGGGGG - Intronic
984167531 4:176320297-176320319 GGCTGCCGTGCCGGGGCCGCGGG + Intronic
984714968 4:182917185-182917207 GGGCCTGGGGCCGCGGACGCTGG - Intronic
984823496 4:183905205-183905227 GGGCGCTGGGCCCGGGACGCGGG - Intronic
984823909 4:183906978-183907000 TGCCCCCGGGCCGGGGCCGCGGG + Intronic
984889048 4:184474922-184474944 GGGCGCAGGCCCGCGGCGGTAGG + Intergenic
984966215 4:185142931-185142953 AGACACCGGGCCGCTGCCGCCGG - Intergenic
985064063 4:186104744-186104766 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
985566396 5:620478-620500 GGGCGCAGGGCTGGGGCCGTGGG + Intronic
985629845 5:1008730-1008752 GCGCTGCGGGCAGCGGCCGCCGG + Intergenic
985747151 5:1654034-1654056 GGGCGCGGGGCGGAGGCTGCGGG - Intergenic
985894983 5:2743522-2743544 GGGCGCCGGGCCGCGGAGCCGGG + Intergenic
985896354 5:2751792-2751814 AGCCTCCGGGCCGCGGCCGGGGG + Intergenic
986330819 5:6714640-6714662 GGGTGCCGGGCCGCGGCGCCTGG - Exonic
986402801 5:7396090-7396112 GGGGGCCGGGCGGCGGCCTCGGG - Intergenic
986733283 5:10650145-10650167 TGGGGCCGGGGCGGGGCCGCAGG + Exonic
987099800 5:14581854-14581876 GGGCGCTGGGCCTCGGCCCGTGG - Exonic
987258401 5:16179889-16179911 GGGTGACGGGGCGCGGGCGCGGG + Intronic
988564837 5:32312713-32312735 GGGCGTCGGGCAGGGGCGGCCGG - Intronic
988734655 5:34008112-34008134 GGGCGCGGCGCCGCGGCTGGGGG - Intronic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
989102301 5:37834665-37834687 GGGCGCGCGGCGGCGGCCGAGGG + Exonic
990347448 5:54884128-54884150 GGACGCGGGGCCGCCGCGGCGGG - Intergenic
990753113 5:59039417-59039439 GGGCGTGGGGCCGCGGCTCCGGG - Intronic
995342255 5:111073031-111073053 GGGCTCCGGGACGCCGCCGCCGG + Intronic
995623898 5:114056204-114056226 GAGCTCCGGGGCGCGGGCGCGGG - Intergenic
996184964 5:120464220-120464242 GAGCGCCGGGCGGCGGCGGGAGG + Intergenic
996329334 5:122312008-122312030 GGGCGCCCGGCCGGGGACGGGGG - Intronic
996404191 5:123090218-123090240 GAGAGGCGGGCCGCGGGCGCAGG - Exonic
996724632 5:126663653-126663675 GGGCGGCGGGTCGCGTCAGCGGG - Intergenic
996948164 5:129094697-129094719 GGAGGCGGGGCCGCGGCAGCCGG + Intergenic
996978290 5:129460361-129460383 GGGCGAGAAGCCGCGGCCGCGGG + Exonic
997402171 5:133611870-133611892 GGGCACCGGGCCCGGGCCGAGGG + Intronic
997454079 5:134004795-134004817 GCGCGCCGGGCCGGGCGCGCAGG - Intronic
997521639 5:134527238-134527260 GGGCGCCGCTCCGCAGGCGCAGG - Intronic
997585218 5:135039788-135039810 GGGCGACGGGCGGCGGCGGCGGG - Intronic
997704111 5:135930633-135930655 GGCGGCCGGGCCCGGGCCGCGGG - Intronic
998371807 5:141666589-141666611 GGGCCCCGGGCTGCTGCGGCTGG - Exonic
998583485 5:143403750-143403772 AGGGGCCGCGCGGCGGCCGCGGG + Intronic
999462697 5:151771067-151771089 GGGCGCTGCGAGGCGGCCGCGGG - Intronic
1000463408 5:161548177-161548199 GGCCGCCTCGCCGTGGCCGCCGG + Intronic
1001035134 5:168291952-168291974 CGGCGCCGGGTCGGGGCTGCAGG + Intronic
1001064988 5:168529360-168529382 GGGCGGCGGGCGGCGGGGGCAGG - Exonic
1001064992 5:168529367-168529389 GGGCGGCGGGCGGCGGGCGGCGG - Exonic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1002133186 5:177093568-177093590 GGGGGCAGGGACGCGGGCGCCGG + Intronic
1002442835 5:179273234-179273256 GGGCGGCGGGGGGCGGCCTCTGG - Intronic
1002455487 5:179343916-179343938 GGGCGTTGGGCCGCAGCCGCAGG + Exonic
1002512751 5:179733365-179733387 AGGCGCGGGGCCGGGGCGGCGGG - Exonic
1002532839 5:179858928-179858950 AGGGGCGGGGCCGCGGCGGCCGG - Intronic
1002771183 6:292123-292145 GGACCCCGGCTCGCGGCCGCCGG - Intronic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003290634 6:4776164-4776186 GGGGGCGGGGCCGCGAGCGCGGG - Intronic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1003426988 6:6003987-6004009 GGGCGCCTGTCCGCGAGCGCCGG + Intronic
1003645330 6:7909969-7909991 GGGCGCTGGGCAGGGACCGCGGG + Intronic
1003645442 6:7910316-7910338 GGGCGCGGGGCCGGGAGCGCGGG - Intronic
1004043951 6:12009163-12009185 GGGCGGAGGGCCGGGGCCGCGGG + Intronic
1004627885 6:17393806-17393828 GGGCGCCTGGCGGCGGGCGCTGG + Intronic
1005957021 6:30671371-30671393 TGGGGCCGGGCCGCGGGGGCAGG - Intronic
1006180390 6:32150525-32150547 GGGGGCGGGGCGGCGGCAGCGGG + Exonic
1006300731 6:33192505-33192527 GGGGGCCGGGCCGGGGGCGGGGG - Intergenic
1006458376 6:34144555-34144577 GGTTGCCGGGCTCCGGCCGCTGG + Intronic
1006634592 6:35452688-35452710 GGGCGCTGGGCAGCCGCGGCTGG + Exonic
1006814324 6:36840050-36840072 AGGGGCCGGGGCGGGGCCGCGGG + Intergenic
1006851629 6:37102768-37102790 GGGCGAGGGGCCGGGGCGGCCGG - Intergenic
1007327460 6:41073223-41073245 AGGCCCCGGGCCGGGGCCGCTGG - Intronic
1007600118 6:43076229-43076251 GGGCGCCGTGCGGGGGCCGGAGG + Intergenic
1007614398 6:43171739-43171761 GGCGGCCGGGCGGCGGCGGCGGG + Exonic
1007775733 6:44223492-44223514 GGGGGCGGGGCCGCGGGCGTCGG + Intronic
1012912912 6:105137248-105137270 CGGCGCCGGGCTCCGCCCGCCGG - Intergenic
1013225734 6:108118478-108118500 GGGCGCACGGCCTCGGCGGCTGG - Intronic
1016330170 6:142946206-142946228 GGGCCCGGGGCAGGGGCCGCCGG + Intergenic
1017146601 6:151240642-151240664 GGCCGAGGGGCCGCCGCCGCTGG - Exonic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017446315 6:154510203-154510225 GGGCGCAGGGGAGCAGCCGCGGG - Exonic
1017793650 6:157823108-157823130 GGAGGCCGGGCCGCGGCCGAGGG + Intronic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1018013603 6:159693338-159693360 GGGCGCGGGGCGGGGCCCGCGGG - Intronic
1018876533 6:167826886-167826908 GGGCGGCGGGCGGCGGGCGCCGG + Intergenic
1019111936 6:169724033-169724055 GGGGGCGGGGCCGGGGCGGCGGG - Exonic
1019349885 7:549739-549761 GGAGCCAGGGCCGCGGCCGCAGG - Exonic
1019544988 7:1569907-1569929 GGGTCCCGGGCCGCGGCTGCAGG - Exonic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1019828195 7:3301148-3301170 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1019828407 7:3301813-3301835 TGGGGCCGGGCCGCCGCGGCTGG + Exonic
1020007985 7:4792368-4792390 GGGGGCGGGGCCGAGGCCGGAGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1020274306 7:6615525-6615547 GGGCGCGGGGGCGCGGCGGGCGG + Intergenic
1021716831 7:23469236-23469258 TGGCGCGGGGCTGCGGCCTCCGG - Intronic
1021827880 7:24573153-24573175 GGGCGCCCAGCCGCGGCGGGAGG + Intergenic
1021998332 7:26201613-26201635 GGGCCGCGCGCCGCGCCCGCTGG - Intronic
1022105322 7:27192623-27192645 GTGCGCCGGGTCCCGGCCTCGGG + Intergenic
1022110181 7:27225384-27225406 AGGCTTCGGGCGGCGGCCGCCGG - Intergenic
1022207606 7:28179780-28179802 CGGCCCCCGCCCGCGGCCGCCGG + Intronic
1022285906 7:28956321-28956343 TGGGGCCGGGCTGCCGCCGCTGG - Exonic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1023015656 7:35967546-35967568 GGGCGCCTGGGCGCGGCCGCCGG - Intergenic
1024043825 7:45574471-45574493 GGGCGCCGGGGCGCGGGCGGCGG - Intronic
1024065280 7:45727141-45727163 GGGCGCCCGGGCGCGGCCGCCGG + Intergenic
1024262397 7:47582146-47582168 GGGGGCCCTGCCGCGGGCGCCGG - Intronic
1025069765 7:55887804-55887826 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069768 7:55887811-55887833 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069771 7:55887818-55887840 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1025069774 7:55887825-55887847 GGGCGGCGGGCGGCGGGCGGCGG + Intronic
1026017545 7:66682696-66682718 CGGCGCCCTGCCGCGGCCGGGGG - Intronic
1027654944 7:80919122-80919144 GGGCGGCGCGCCGGGGCAGCCGG - Exonic
1028641136 7:93043490-93043512 CGGCGCTGGGCTGCGGCAGCTGG - Intergenic
1029298311 7:99558862-99558884 CGGCGTCCGGCCGCGGCCGACGG + Exonic
1029578550 7:101420067-101420089 TGGCGCAGGGCCCCGGCCACCGG - Exonic
1029746399 7:102517752-102517774 GGGTGGCGGGCGGCGGGCGCTGG + Exonic
1029764338 7:102616731-102616753 GGGTGGCGGGCGGCGGGCGCTGG + Exonic
1031966590 7:128031782-128031804 GGGGGCCGGGCAGCGGCGGGCGG - Intronic
1032125147 7:129188449-129188471 GGGCGCGGGGCGGCGGCAGGCGG + Intergenic
1032344449 7:131106206-131106228 GGGCGGCGGGCCGCCGGAGCCGG - Intergenic
1032947568 7:136870371-136870393 GGGCGCCGGGCAGCGCGCACAGG - Intronic
1033227860 7:139575163-139575185 GGGGGCCCGGCCGCTGCTGCCGG + Exonic
1033300018 7:140177054-140177076 GCGCGCGAGGCCGCGGCGGCTGG + Intergenic
1033300079 7:140177301-140177323 GGGCGCGCGGCCGCAGCCGGAGG + Intergenic
1033339230 7:140479112-140479134 GGGCGCGGGGAGGGGGCCGCGGG - Intronic
1033361476 7:140641163-140641185 CGGCACCGGGCCGGGGCCGGGGG + Intronic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034342731 7:150368718-150368740 CGCCCCCAGGCCGCGGCCGCGGG + Intronic
1034347678 7:150397271-150397293 GGGGCCCGGGCCGCGGTCTCCGG + Exonic
1034440542 7:151083523-151083545 ATGCCCCGGGCCGCGGCGGCGGG - Intronic
1035390457 7:158500969-158500991 AGGCTCCGGGCCACGTCCGCTGG + Intronic
1036032677 8:4991567-4991589 GGGCGCCCGGCCACTGCCGTGGG - Intronic
1036664608 8:10730515-10730537 AGGGGCCGGGTCGCGGCTGCGGG - Intronic
1036688023 8:10924603-10924625 GGGTGGCGGGGCGCGGCCGGCGG + Intronic
1037450645 8:19013532-19013554 CGGGGCCGGGGCGCGGGCGCGGG - Intronic
1037825187 8:22156497-22156519 GGGCCCGGGGCCGGGGCTGCTGG - Exonic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1038204959 8:25457903-25457925 GGGCGCGGGGACGGGGGCGCGGG - Intronic
1038543981 8:28411912-28411934 GGACGCCGGGCTGAAGCCGCGGG - Intronic
1039936602 8:42051655-42051677 GGGCCGCGGGCCGGGGCAGCCGG + Intronic
1040495234 8:47960198-47960220 GGGCTGCGGGGCGCGGCGGCAGG + Intronic
1041028607 8:53712526-53712548 GGGCGCCCGGGCGCGGGTGCGGG + Intergenic
1041068145 8:54101862-54101884 GGGCGCCCGGCCGCGGCCCAAGG + Exonic
1041167261 8:55102322-55102344 GGGCGGCGGGCGGCGGCGGACGG + Intergenic
1041355240 8:56993413-56993435 GGGCCCGCGGCCGCGGCCGATGG - Exonic
1041919873 8:63169087-63169109 GGGCGCGGTGCCGCGGCGGGTGG + Intronic
1042155562 8:65841538-65841560 GCCCGCCCTGCCGCGGCCGCCGG + Exonic
1042563804 8:70093305-70093327 GGGTGCTGGGCCGAGGGCGCCGG + Intergenic
1042591675 8:70403309-70403331 GAGCGCCGAGGCGCGGCCGGGGG - Intronic
1042611887 8:70608607-70608629 GGGCACCCGGCCGCGGCCTCAGG - Exonic
1042679178 8:71361834-71361856 AGGCGCCTGGCCGCTGCCGCAGG + Exonic
1043463707 8:80486040-80486062 GGGGGCGGGGGTGCGGCCGCGGG - Intronic
1044306534 8:90646149-90646171 GGGGGCGGGGCCGCGGGCGATGG + Intronic
1045215589 8:100145694-100145716 AGGAGCCGGGCAGCAGCCGCTGG + Intronic
1047393726 8:124475036-124475058 GGGCCCGGGGCCGCGGCCGGGGG - Exonic
1048472058 8:134712723-134712745 GGCCGCCGGCCGCCGGCCGCCGG - Intronic
1048472060 8:134712730-134712752 GTGCGCCGGCCGCCGGCCGCCGG - Intronic
1049145930 8:141001093-141001115 GGGCGCCGGGCGCGGGGCGCGGG - Intronic
1049419555 8:142510786-142510808 GGGCGCGCGGCTGCGGGCGCAGG + Intronic
1049558723 8:143296838-143296860 GGGCGCGAGGCCGAGGCCGGGGG + Exonic
1049680634 8:143916428-143916450 GGGCACGGGGCTGCGGCTGCTGG - Exonic
1049752536 8:144291916-144291938 GGGAGCAGGGCCGCGGCGGACGG + Intronic
1049769793 8:144374541-144374563 GGGCGCCGGGCACCCGCCTCCGG - Intronic
1050091299 9:2017673-2017695 GGGGGCCGGGCCGCGGGCTGTGG + Intronic
1050151556 9:2622781-2622803 GTGCGCCAGCTCGCGGCCGCCGG - Intronic
1050230892 9:3525491-3525513 CGGCGCAGGGCCGGGGCCGGCGG + Intronic
1050552242 9:6758374-6758396 GAGCGGCCGGCCGCGGCCGCAGG + Intronic
1051174010 9:14346111-14346133 GGGGGGCGCGCCGCGGGCGCGGG + Intronic
1051629316 9:19127600-19127622 GGGCGCCGGGACGTGCCCGAGGG - Intronic
1052494935 9:29213484-29213506 GGGCGGCGGGCGGCGGCGCCAGG + Intergenic
1053306143 9:36986086-36986108 GCGCGCCGGGGCGAGGGCGCCGG - Intronic
1053372724 9:37576234-37576256 GGAGTCCGGGCCGCGGCCGCCGG + Exonic
1056126089 9:83537787-83537809 GGGCGCGGGGCAGCTGCCTCCGG - Intronic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1057146859 9:92764463-92764485 CGGCGCCGGGCGGGGGTCGCAGG + Intronic
1057869900 9:98709327-98709349 GGTCGGCGGGCAGCGGCAGCTGG - Intergenic
1057881530 9:98796304-98796326 GGGCCCGGGGCCGCAGCGGCGGG - Exonic
1057922058 9:99105387-99105409 TGGCGCGGGGCCGGGGGCGCAGG + Intronic
1058492746 9:105519811-105519833 TGGCGGCGAGCGGCGGCCGCTGG + Intronic
1059375131 9:113875892-113875914 GGGAGCCGGGGAGCGGGCGCGGG + Intergenic
1060139891 9:121201253-121201275 CGGGGGCGGGCTGCGGCCGCGGG + Intronic
1060209091 9:121699464-121699486 GGGGACCGGGCGGCGGCGGCGGG - Intronic
1060468760 9:123930229-123930251 GGGGGCGGGGCCGTGGCCGGTGG + Intergenic
1060528925 9:124336490-124336512 AGGCACCGGGCCGAGGCCTCAGG - Intronic
1060555427 9:124505135-124505157 GGGAGCCGGGCTGCGGCTGGGGG - Intronic
1060770263 9:126327079-126327101 GGGCGCGGGCCCCCGGCCGAGGG + Intronic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1061004735 9:127922047-127922069 GGGCGTCGGGCAGCAGCCGGCGG + Exonic
1061275928 9:129569272-129569294 GGGGGCGGGGGCGCGGGCGCGGG + Intergenic
1061559674 9:131394347-131394369 GGGCCCCCGGCGGCGGCCGCGGG - Intronic
1062022576 9:134326389-134326411 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1062230697 9:135480029-135480051 GGGTGCAGGGCCGGGGCCGGGGG + Intronic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1062346791 9:136118691-136118713 GGGCTCTCGGGCGCGGCCGCCGG + Exonic
1062568518 9:137173830-137173852 GGGTGCTGGGCGGCGGCTGCAGG + Intergenic
1062584150 9:137241521-137241543 GGCCGCCGGGCCCCCTCCGCGGG + Intronic
1062659147 9:137619209-137619231 CGAGGCCGGGCCGAGGCCGCCGG + Intronic
1203470199 Un_GL000220v1:112741-112763 GGACGCCGGGCCGCCACCGGGGG - Intergenic
1203478020 Un_GL000220v1:156713-156735 GGACGCCGGGCCGCCACCGGGGG - Intergenic
1186463358 X:9765645-9765667 GGCCGCCGGCCCGCGGGCCCCGG - Exonic
1187419543 X:19122527-19122549 GGGGGCGGCGCCGAGGCCGCGGG - Exonic
1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG + Exonic
1190839124 X:54129127-54129149 GGGCGGCCGGCCGGGGCGGCTGG + Intronic
1192434761 X:71136442-71136464 AGGCGCGGGGCCGGGGCCTCAGG - Exonic
1195156050 X:102125686-102125708 GGGCGCCCGGACCCGACCGCTGG - Exonic
1197694895 X:129540298-129540320 GGGCGCCGGGCGCCGGGAGCCGG - Exonic
1197745975 X:129932411-129932433 GGGCCGCGGGGCGCGGCCGCGGG - Intergenic
1197754451 X:129984134-129984156 GGGCGGCGGGGCGGGGCCGGGGG + Intronic
1198302424 X:135344942-135344964 GTGCCCCGGGCGGCGGGCGCCGG + Intronic
1198636870 X:138711191-138711213 GGGAGCCGGACCGCCGCCGGAGG - Exonic
1199724554 X:150568285-150568307 GGGCGCCGGGCGGAGGCGGCTGG - Intergenic
1199772507 X:150983773-150983795 GGGCGCTGGGCGGCGGCAGCGGG + Intronic
1199772641 X:150984154-150984176 CCGCCCCGGGCCGCGGGCGCCGG - Intronic
1200003143 X:153072327-153072349 GAGCGCAGGGCCGTTGCCGCGGG - Intergenic
1200004580 X:153077682-153077704 GAGCGCAGGGCCGTTGCCGCGGG + Intergenic
1200058752 X:153474725-153474747 GGGGGCGGGGGCGCGGGCGCTGG + Intronic