ID: 1017288018

View in Genome Browser
Species Human (GRCh38)
Location 6:152700992-152701014
Sequence GTATTATTCCACAACTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017288018_1017288019 5 Left 1017288018 6:152700992-152701014 CCTATATAGTTGTGGAATAATAC 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1017288019 6:152701020-152701042 AACATATGATAAAATAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017288018 Original CRISPR GTATTATTCCACAACTATAT AGG (reversed) Intronic
903445763 1:23422222-23422244 GTATCATTCTATAACTATAATGG + Intronic
910044262 1:82892316-82892338 AAATTCTGCCACAACTATATGGG + Intergenic
910648629 1:89540203-89540225 GTATTATTTTAAAACTATACAGG - Intronic
910723949 1:90317935-90317957 GTATTACTGCACACCTATCTGGG - Intergenic
911900087 1:103492523-103492545 TTATTATTTCACAATTCTATAGG - Intergenic
913444064 1:118931121-118931143 AAATTATTACACAACTTTATTGG - Intronic
916834160 1:168525183-168525205 GTTTTATTCAACAAGCATATTGG - Intergenic
917068293 1:171121952-171121974 GTCTTATTCCACCAATGTATGGG - Intergenic
917204069 1:172550643-172550665 GTCTTATTTCAGATCTATATAGG + Intronic
917226778 1:172791775-172791797 ATATTATTCAACAACTAAAAAGG - Intergenic
917999579 1:180479687-180479709 GTATTTTCCTACAAATATATGGG - Intronic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
919317243 1:195987348-195987370 TTATTTTTCCACAAATTTATTGG - Intergenic
921648901 1:217653014-217653036 GTATTATTCAAAAACTATCGAGG + Intronic
924004583 1:239594449-239594471 GTATTGTTGCACTAGTATATAGG + Intronic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
1065107937 10:22409296-22409318 GTAATATTCTATAAATATATTGG - Intronic
1065695416 10:28375309-28375331 ATATTATTGCACATCTAGATGGG - Intergenic
1066014516 10:31226634-31226656 GTTTTATTCCAGAAGTTTATTGG + Intergenic
1071915178 10:90287118-90287140 GCATGATGCCACAATTATATTGG - Intergenic
1072148126 10:92661375-92661397 GTATTTTTCTCCAACTATAATGG - Intergenic
1077972516 11:7209653-7209675 ATATTATTGCTCAACTATTTGGG + Intergenic
1082646971 11:55738628-55738650 GCATTATTACACAACTTTAGTGG + Intergenic
1085911418 11:80831233-80831255 GTATTATTCCAGGAGTAAATGGG + Intergenic
1086189476 11:84061400-84061422 GTTTTATTCCACAAAGTTATAGG - Intronic
1086273002 11:85090664-85090686 GTATTAGTCTACACATATATAGG + Intronic
1088409560 11:109519411-109519433 GTATTACTCCTCAACAAAATTGG + Intergenic
1088479014 11:110275425-110275447 GTATTATCCCACAGTTTTATAGG - Intronic
1090634393 11:128681468-128681490 ATATTATTCCACAGTTGTATTGG + Intergenic
1091177046 11:133569390-133569412 GTATTATTTCACAACTGTAATGG - Intergenic
1093127578 12:15348882-15348904 GTATTATCCTACAATTCTATAGG - Intronic
1098640378 12:72831883-72831905 GTATTTTCCCACAACTTTAAGGG - Intergenic
1099749994 12:86761397-86761419 GTATTATTCCACTACTTTTGTGG - Intronic
1100889845 12:99113039-99113061 ATATTATTTCCCAACTTTATTGG + Intronic
1110279577 13:73677200-73677222 GTATTTATCCACAAATATACTGG - Intergenic
1111538170 13:89631316-89631338 GTTTTATTTCAGAATTATATTGG + Intergenic
1112048374 13:95620604-95620626 GTGTCATTCCACAACTGTATTGG + Intronic
1116017706 14:39427222-39427244 TTTTTATTCCACAGCTGTATTGG - Intronic
1124833495 15:33173164-33173186 GGTTTATTACACAACTAGATAGG + Intronic
1124989022 15:34652336-34652358 GTATTAATCCACAGCTAAATGGG - Intergenic
1129957215 15:79649893-79649915 GTTTTATTCAATAACTATTTTGG + Intergenic
1133630838 16:7619570-7619592 GTACTATTACAGAACTATTTAGG - Intronic
1133941206 16:10310584-10310606 TGATTATTCCACAAATCTATTGG - Intergenic
1135355964 16:21769205-21769227 GTATTATCTCACAGCTCTATAGG - Intergenic
1135387088 16:22051995-22052017 AAATTATTCCACATATATATAGG - Intronic
1135454454 16:22585344-22585366 GTATTATCTCACAGCTCTATAGG - Intergenic
1137326977 16:47449658-47449680 GTATTATTACTCTAGTATATTGG + Intronic
1137470928 16:48757816-48757838 TTTTTATTCAACAAGTATATGGG + Intergenic
1138078944 16:54070501-54070523 GTATTATTCCAGAAAAATACTGG + Intronic
1140761870 16:78116712-78116734 TAATTATTCCACAATTGTATGGG - Intronic
1149098688 17:52876496-52876518 GTAAAATGACACAACTATATTGG + Intronic
1149366441 17:55950153-55950175 GTGTTGTTCCACAACTATTGTGG + Intergenic
1154447053 18:14444402-14444424 GTTTTTTTCCTAAACTATATGGG - Intergenic
1156370919 18:36470550-36470572 GTATAATTATACAACCATATAGG - Intronic
1159412275 18:68094771-68094793 TTATTCTTTCACAAATATATTGG + Intergenic
927084941 2:19665649-19665671 TTATTTTTGCGCAACTATATAGG - Intergenic
930080750 2:47446407-47446429 GTTATATTCGACAACTATTTAGG - Intronic
931215920 2:60244561-60244583 ATATTTTTCCAAAACTATATAGG - Intergenic
933353353 2:81184116-81184138 GTATTATTACAGCAATATATTGG + Intergenic
935477846 2:103546273-103546295 GTTTTACACCATAACTATATAGG - Intergenic
935745925 2:106190279-106190301 AGATTATACCACATCTATATAGG + Intronic
940647752 2:156409314-156409336 GTATTAATGCACAAATATACTGG - Intergenic
940841687 2:158590135-158590157 GTGTTACTCCACAATTAAATAGG + Intronic
941453842 2:165692539-165692561 TTCCTATTCCACAACTCTATAGG - Intergenic
942437183 2:175992026-175992048 GTAATATTCCTCAGGTATATTGG + Intronic
943199882 2:184808047-184808069 GTAATATTCCTTAACTTTATGGG + Intronic
945584710 2:211645374-211645396 TTATAATTTCAAAACTATATAGG + Intronic
946681391 2:222220724-222220746 ATATTATTACACAAATATTTAGG - Intronic
946808338 2:223495665-223495687 TTATATTTCCACTACTATATAGG - Intergenic
946877857 2:224147934-224147956 GTATTATTCTAGAATTATTTTGG - Intergenic
947043798 2:225954001-225954023 GAATTATACCACAACCAAATAGG + Intergenic
1169630874 20:7629856-7629878 CTAATATTTCACAATTATATAGG + Intergenic
1170676801 20:18489714-18489736 ATATTATTCTACTCCTATATTGG + Exonic
1174950640 20:55037949-55037971 GTCTTGTTTCACCACTATATTGG + Intergenic
1176728018 21:10459697-10459719 GTAATATTCAACAACTAAATGGG + Intergenic
1185205773 22:49537393-49537415 GTATCATTTCACAATTAAATAGG + Intronic
954819263 3:53311171-53311193 GTATTATAGCAGAACTGTATGGG + Intronic
957135403 3:76281322-76281344 TTATTATTCTGCAACTATATGGG + Intronic
957255937 3:77837998-77838020 GTATTGTTACACACTTATATGGG - Intergenic
957673499 3:83336591-83336613 TTATTATTCCACTACTCTGTTGG - Intergenic
957929475 3:86860206-86860228 GTATATTTCCACATATATATAGG + Intergenic
958973101 3:100635213-100635235 TTATTATTTCACAAAAATATTGG - Intronic
959400476 3:105895463-105895485 ATATAATTCAACAACTCTATGGG - Intergenic
959999591 3:112716594-112716616 GTATTCTGGCAAAACTATATAGG - Intergenic
960402007 3:117211638-117211660 TTAATATTCCTCAAGTATATTGG - Intergenic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
962226107 3:133610981-133611003 GTATTAAAACACAATTATATAGG - Intronic
963475369 3:145796992-145797014 GTATTGTTACACAAGTATGTTGG - Intergenic
968250594 3:197207893-197207915 GTATTATGTTACAGCTATATAGG - Intronic
970656023 4:18230632-18230654 TTATTATTCTCCAACTTTATTGG + Intergenic
971193979 4:24454255-24454277 GTATAAGTGCACAATTATATGGG - Intergenic
973163017 4:47042009-47042031 GTATAATTCCTAAATTATATTGG - Intronic
978878219 4:113667863-113667885 GTAAGATCCTACAACTATATAGG + Intronic
983481727 4:168282840-168282862 TTATTATTCCAGAAATAGATTGG + Intronic
983786251 4:171733235-171733257 TTATTATTCCAGAGCTTTATTGG - Intergenic
986421124 5:7584096-7584118 GTAATGTTCCACATCTTTATAGG + Intronic
988216223 5:28276875-28276897 GTATTATTACACATACATATTGG + Intergenic
990565864 5:57028197-57028219 TTATTATAGCAGAACTATATTGG + Intergenic
991272282 5:64798309-64798331 GTAGTATTCCACAATTCCATGGG - Intronic
991401201 5:66253458-66253480 GTATTCTTCCACACCCATTTGGG + Intergenic
993041357 5:82818200-82818222 ATATTAGTCCTTAACTATATGGG + Intergenic
993933702 5:93974394-93974416 GTTTTATTCAACAAATAAATAGG + Intronic
994828939 5:104752435-104752457 GGACTATTCCACAACTCTGTAGG + Intergenic
996220513 5:120926743-120926765 GTATTATTCAAGAACTACTTTGG + Intergenic
996446647 5:123560980-123561002 GTATTTTACCACAAATAAATTGG + Intronic
997554759 5:134786295-134786317 CTTTTTTGCCACAACTATATTGG - Intronic
999718702 5:154382461-154382483 GTATTATTCTACAAGGATTTAGG - Intronic
999915456 5:156254118-156254140 GTATTAGTCAACAATTGTATCGG - Intronic
1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG + Intergenic
1000501659 5:162058844-162058866 GTAATATTCCACATTTTTATAGG - Intergenic
1006046698 6:31305138-31305160 GTATTATCCCACATTTCTATGGG - Intronic
1009864748 6:69383170-69383192 GTTTTATATCAAAACTATATTGG + Intronic
1010587615 6:77672909-77672931 GTATGATTTTACAAATATATTGG + Intergenic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1015437883 6:133210930-133210952 CAATTATTCCACAACTTTACTGG + Intergenic
1015482822 6:133732609-133732631 GTATTATACCACAACCAAGTGGG + Intergenic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1017707513 6:157137279-157137301 GTATTTTTACACATTTATATTGG - Intronic
1023260306 7:38351799-38351821 GTATTATTTCACAACTTTATAGG - Intergenic
1023261282 7:38360949-38360971 ACATTATTTCACAACTTTATAGG - Intergenic
1030483539 7:110135877-110135899 TGAATATTCCACAACTATTTCGG - Intergenic
1031111866 7:117620433-117620455 GGATTATTCCACATCCTTATAGG + Intronic
1031693972 7:124826248-124826270 GTAACAGTCCACAACTCTATGGG + Intronic
1032105977 7:129030199-129030221 GTATTATTCATCCAGTATATGGG + Intronic
1032899030 7:136285415-136285437 TTATTATCCTACATCTATATTGG - Intergenic
1033237372 7:139648986-139649008 GTATTATTCAAAAACAATATGGG + Intronic
1035426020 7:158774181-158774203 GTTTTGTTACTCAACTATATGGG - Intronic
1038956509 8:32474100-32474122 GTACTCTGCCACAAATATATGGG - Intronic
1040605822 8:48930216-48930238 ATTTTATACCGCAACTATATGGG + Intergenic
1041536537 8:58932465-58932487 GTATTATTCCACCATTAAATGGG + Intronic
1045798481 8:106074439-106074461 GTATTATGAGACATCTATATAGG + Intergenic
1046017658 8:108624784-108624806 TTATTATTCCTTAACTGTATAGG + Intronic
1049031283 8:140039912-140039934 GTATGAGTCCACAACTCTAAAGG + Intronic
1053169116 9:35865882-35865904 GTATTTTTCAAAAAATATATTGG + Intergenic
1055549387 9:77417189-77417211 GTATTATTCAGTAACTAAATAGG - Exonic
1059782954 9:117549187-117549209 GTATAATACCACATCTATCTTGG + Intergenic
1185650947 X:1647787-1647809 ATATTATTCCTCTACCATATGGG + Intergenic
1187009024 X:15261103-15261125 GTATTATTCCAGAAATAATTAGG - Intronic
1187692415 X:21882891-21882913 ATATTATTCCACAAGCATCTGGG - Exonic
1188796626 X:34474563-34474585 GTGTTATTCCCAAACAATATTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192566339 X:72166965-72166987 GTATGATTCCATAACATTATTGG + Intergenic
1192861602 X:75079069-75079091 GTAAAATTGCACAACTTTATTGG - Intronic
1193660494 X:84251123-84251145 ATTTTATTCCACAACTAAAAAGG - Intergenic
1195495202 X:105523191-105523213 TTCTTATTCCACAAATATTTTGG + Intronic