ID: 1017289078

View in Genome Browser
Species Human (GRCh38)
Location 6:152713848-152713870
Sequence TAGCTTTACCTGTCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017289076_1017289078 19 Left 1017289076 6:152713806-152713828 CCTTTGTTTCTCAAGATCAGAAA 0: 1
1: 0
2: 2
3: 30
4: 320
Right 1017289078 6:152713848-152713870 TAGCTTTACCTGTCCCAGACTGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017289078 Original CRISPR TAGCTTTACCTGTCCCAGAC TGG Intronic
904053719 1:27656618-27656640 TAGCTTCCCCGCTCCCAGACTGG + Intergenic
919767341 1:201135907-201135929 AAGCCTTACCTTCCCCAGACTGG + Intronic
922504548 1:226118972-226118994 TATCTGTCCCTGTCCCAGACAGG + Intergenic
923298703 1:232620212-232620234 TAGTTTTACCTGTTCCAAAAAGG + Intergenic
923428961 1:233901960-233901982 TAGTTTTGCCTCTCTCAGACCGG + Intergenic
1074334745 10:112560031-112560053 TAGTTCTAACTGACCCAGACAGG + Intronic
1074395987 10:113098234-113098256 TAGATTTTGCTGTCCCAAACAGG - Intronic
1080362309 11:31529968-31529990 TCTCTCTACCTGTGCCAGACAGG + Intronic
1083657228 11:64235289-64235311 TAGCTTTACCTGTCCTCTCCTGG - Intronic
1086384032 11:86288925-86288947 TAGCAGTTCCTGTCCCAGACTGG + Intergenic
1086541344 11:87916092-87916114 GAGCTTGACCTGTCTCAGATGGG + Intergenic
1088798599 11:113285690-113285712 TGGCTCTACCTGGCCCAGAGAGG + Intergenic
1092682818 12:11006265-11006287 TGTTTTTTCCTGTCCCAGACAGG - Intronic
1092837614 12:12505944-12505966 TGGCTTGAAATGTCCCAGACTGG + Intronic
1094095455 12:26699319-26699341 TAGGATTACCCGTCCCTGACTGG + Intronic
1098776366 12:74624640-74624662 TAGTTTTAACTGTTCCAGAATGG - Intergenic
1100504205 12:95204193-95204215 TAGCTTTAGGTGTTCCAGATAGG - Intronic
1104065902 12:125305643-125305665 TTCCATTACCTGTCCCAGATTGG - Intronic
1106315676 13:28591195-28591217 TAGCTGGACCTTTCCCAGTCTGG + Intergenic
1110777228 13:79422073-79422095 TAGATTCTCCTGCCCCAGACAGG - Intergenic
1114300851 14:21375990-21376012 TAGCTTTAGCTGTCACAGTTAGG + Intronic
1116631882 14:47346430-47346452 TTGCTTTTTCTGTCCCACACTGG - Intronic
1117794316 14:59376613-59376635 TAGTTTTACCTTTTCCAGAGTGG - Intergenic
1121307151 14:92913872-92913894 TAGCTTTACCTCTTACTGACTGG - Intergenic
1122273273 14:100577895-100577917 TAACCCTACCTGTCCCAGGCAGG - Intronic
1123696226 15:22880886-22880908 AAGCTTTCCCTGTACCACACTGG + Intronic
1126048344 15:44664836-44664858 GTGATTTACCTGTCCCAGCCTGG + Intergenic
1126581652 15:50247798-50247820 TAGGTCTACCTGTCCAAGCCAGG + Intronic
1126881794 15:53106792-53106814 TTGTTTTGCCTATCCCAGACAGG + Intergenic
1131087855 15:89592044-89592066 TAGCTTCTCCTGTTCCAGAGTGG + Exonic
1131187521 15:90287489-90287511 TATTTTTTCCTCTCCCAGACTGG - Intronic
1140898656 16:79348460-79348482 TAACATTACGTGTCCCAGAAGGG - Intergenic
1141230702 16:82164554-82164576 TAGCTTTACCTATGTCAGACGGG - Intronic
1146930653 17:36775263-36775285 TAGATTTCCCAGCCCCAGACAGG + Intergenic
1153895419 18:9554746-9554768 TCCCTTTCCCTGTCCCAGCCTGG - Intronic
1155203432 18:23537044-23537066 TAGCTTGTTCTCTCCCAGACTGG + Intronic
1155208441 18:23580604-23580626 TAGCTTTACCCATCCAGGACAGG - Intronic
1157546860 18:48552784-48552806 AAGCTTTGCCTGTCACACACAGG + Intronic
1163118663 19:15202741-15202763 TAGCTTTTTCTTCCCCAGACTGG - Intergenic
1166914812 19:46188189-46188211 TATCTTTACCTGTTCCAGATCGG + Intergenic
928777569 2:34784132-34784154 TGGATTTACCTTTCCCAGAGTGG + Intergenic
931592206 2:63897204-63897226 TAGCTTTCCCTATTCCAAACAGG - Intronic
931848638 2:66230891-66230913 TTGTTTTACCTCTCCCAGGCAGG + Intergenic
934795488 2:97095563-97095585 GAGCTTTACTTGTCCCACAAAGG + Intergenic
936659209 2:114523499-114523521 TAGCTTTCCCTGTCACTGACTGG + Intronic
945925062 2:215794956-215794978 CAGCTTTTCTTGTCCCAGAAGGG - Intergenic
947083606 2:226425901-226425923 TAGCTCTCCCTGGCCTAGACAGG + Intergenic
1179382135 21:40909546-40909568 CAGCTTTACCTCTACCACACGGG + Intergenic
1184668617 22:46001430-46001452 CAGCTTTGCCTGTCCCTCACTGG + Intergenic
952873585 3:37923020-37923042 TAGCTCTACATGGCTCAGACTGG - Intronic
961998832 3:131273930-131273952 TAGCCCTACCTGTACCAGAGTGG + Intronic
962238320 3:133728856-133728878 TAGCTTTCCTTTTACCAGACAGG + Intergenic
964201592 3:154123056-154123078 TACCTTTATCCTTCCCAGACTGG - Exonic
964548196 3:157858381-157858403 TGGCTGTACCTTTCCCAGGCTGG - Intergenic
967229577 3:187324714-187324736 AAGCTTAACATGTCCCAAACTGG - Intergenic
967349496 3:188496578-188496600 TGGCATTAACTGTCCCAGGCAGG + Intronic
969111884 4:4849480-4849502 TAGCTTCTCCTGTCCCAGCCAGG - Intergenic
979443534 4:120781812-120781834 TAACTTTCCCTCTCCCAGAATGG - Intronic
980298172 4:130951032-130951054 TAGCTTTGCCTTTTCCAGAGTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
992447764 5:76849455-76849477 TAGCTTTTCCAGTCACATACTGG + Intergenic
993859574 5:93118814-93118836 TGGCTTTCCCTGTCCCTGAAAGG + Intergenic
994109148 5:95980938-95980960 CAGCTATTCCTGTCTCAGACTGG - Intergenic
996278156 5:121693926-121693948 TGGCTTCTCCTGTCCCAGAATGG - Intergenic
998568299 5:143235428-143235450 TGGCTTTTCCTGGCCCAGAATGG - Intergenic
999788162 5:154911141-154911163 GTTCTCTACCTGTCCCAGACTGG + Intronic
1003847030 6:10184107-10184129 TCTCTTTACCTCTCCCACACTGG + Intronic
1006237192 6:32643962-32643984 TAGCTTTCCCTGTGCCACTCTGG + Intronic
1017289078 6:152713848-152713870 TAGCTTTACCTGTCCCAGACTGG + Intronic
1019210726 6:170402446-170402468 TAGCTCTTCCTGACCCAGAAAGG + Intronic
1021412062 7:20339996-20340018 TCGCTTTTTCTCTCCCAGACTGG - Intronic
1021579948 7:22141893-22141915 TAGGTTTCCCAGTCACAGACTGG - Intronic
1026616224 7:71907045-71907067 CAGCTTTACCTGGCCCAGGGTGG - Intronic
1027442795 7:78238288-78238310 AAGCTTGACATGTCCCAGACTGG + Intronic
1030082783 7:105791811-105791833 TAGCTTGACCTGTTGCAGAAAGG - Intronic
1032531954 7:132629164-132629186 TAGGTTTATCTGTCCAAGGCAGG - Intronic
1036797181 8:11764718-11764740 TAGCTTCAGGTGTCCAAGACTGG + Intergenic
1037909059 8:22732995-22733017 GCTCTTTACCTGACCCAGACGGG - Intronic
1039688057 8:39829141-39829163 TAGTTTTACCTTTCCCATTCAGG - Intronic
1040725378 8:50376321-50376343 GAGGTTTACATGTCCCAGAATGG + Intronic
1048897169 8:139002284-139002306 TCCCTTTACTTGTCACAGACTGG + Intergenic
1051628237 9:19118688-19118710 TTGCTTTACCTGTGCTAAACTGG - Intronic
1053573525 9:39334468-39334490 TAGTTTTACCTTTTCCAGAAAGG + Intergenic
1053838145 9:42163027-42163049 TAGTTTTACCTTTTCCAGAAAGG + Intergenic
1054095093 9:60893154-60893176 TAGTTTTACCTTTTCCAGAAAGG + Intergenic
1054116561 9:61169077-61169099 TAGTTTTACCTTTTCCAGAAAGG + Intergenic
1054123619 9:61284541-61284563 TAGTTTTACCTTTTCCAGAAAGG - Intergenic
1054591197 9:67013483-67013505 TAGTTTTACCTTTTCCAGAAAGG - Intergenic
1055316458 9:75039082-75039104 TTGCTCTACCTTTCCCAAACAGG - Intergenic
1055522834 9:77099217-77099239 AAGCTTTTCCTGTCTCACACTGG - Intergenic
1057738651 9:97691310-97691332 TAGCTTTACCTTACCTAGAGTGG - Intronic
1191957855 X:66665523-66665545 TTGCGTCACCTATCCCAGACTGG - Intergenic
1200366885 X:155675635-155675657 CAGCTATACCTTTCCCACACTGG - Intergenic
1201524034 Y:14911447-14911469 TAGGTATACTTGTCCCATACTGG + Intergenic