ID: 1017289091

View in Genome Browser
Species Human (GRCh38)
Location 6:152713953-152713975
Sequence GACCAAATGCTTGTAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017289091_1017289093 -5 Left 1017289091 6:152713953-152713975 CCAGTAGCTACAAGCATTTGGTC 0: 1
1: 0
2: 1
3: 6
4: 62
Right 1017289093 6:152713971-152713993 TGGTCATTCTTAAGGCCTTTAGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017289091 Original CRISPR GACCAAATGCTTGTAGCTAC TGG (reversed) Intronic
906419930 1:45657169-45657191 GACCCAAAGCTTGGAGCTAGTGG - Intronic
912590404 1:110813183-110813205 AACCAAATGCTTGAATCAACAGG + Intergenic
1067239092 10:44475215-44475237 GGCCAAATGCTTGTTGCTATGGG - Intergenic
1068800835 10:61138055-61138077 GTCAAATTGCTTTTAGCTACTGG - Intergenic
1078446542 11:11409182-11409204 GCCCACCTGCTTCTAGCTACTGG + Intronic
1078529149 11:12122950-12122972 GACCAAATGCCAGAAGCTATAGG - Intronic
1082032808 11:47618542-47618564 GACAAAGTGCCTGTAGCTTCAGG + Exonic
1085843778 11:80042813-80042835 GACTGAATACTTATAGCTACAGG - Intergenic
1087207596 11:95413634-95413656 GAGCCAATTCTTTTAGCTACAGG + Intergenic
1087342204 11:96921018-96921040 GTCCAAATTCTTTTATCTACTGG - Intergenic
1089505085 11:118957335-118957357 AACCAAATTCTAGTAGGTACTGG + Exonic
1093867022 12:24239609-24239631 GACCAGATAATTGTAGCTCCAGG - Intergenic
1094502983 12:31036923-31036945 GACCACATGCATGTAGGTCCTGG - Intergenic
1105362799 13:19736241-19736263 GACCAAATTCTAGTAAATACAGG - Intronic
1110532047 13:76609244-76609266 TACGAAATGCTAGTAGCTGCTGG - Intergenic
1115814713 14:37151345-37151367 GACCAATTGCCTGTAGCATCTGG + Intronic
1115848067 14:37559351-37559373 GAAAAACTGCTTGTAGTTACTGG - Intergenic
1116656518 14:47659962-47659984 GACCAAATGCTTGAAACTAATGG - Intronic
1118825162 14:69373223-69373245 CAACAAATGCTTGTAGGTAAAGG + Intergenic
1120798403 14:88661697-88661719 GACAAAATGGTTCTAGCTACCGG - Exonic
1130645560 15:85723441-85723463 AACTAAATGCTTGTTGCTCCTGG - Intronic
1141932375 16:87214654-87214676 GAGCATATGCTGGTAGCTTCAGG - Intronic
1156840068 18:41600638-41600660 GATCCTATGCTTGTAGTTACAGG + Intergenic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
925545424 2:5010683-5010705 AACCATATGCTTTTACCTACAGG + Intergenic
928177144 2:29042285-29042307 GAATAAATGCTTGTAGCTGCAGG - Intronic
928813192 2:35254324-35254346 GGCCATATGCTTGAAGCCACTGG - Intergenic
931823022 2:65971587-65971609 GACCAAAGGCTGGGAGCAACTGG + Intergenic
935570259 2:104652971-104652993 GATTAAATGCATGTAGATACAGG + Intergenic
935577401 2:104725133-104725155 GTCCAAATGTTTGCAGCTGCTGG - Intergenic
937566064 2:123290441-123290463 GACAAAATGCTTGAAGGAACTGG + Intergenic
940156943 2:150667158-150667180 GAACAAATGCTGGTAACCACAGG + Intergenic
941751440 2:169139010-169139032 GTCCAAATGGTTGTGCCTACTGG - Intronic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1169379933 20:5097569-5097591 AGCCAAATGCTTTTAGGTACTGG - Intronic
1170178817 20:13504646-13504668 TAACAAATTATTGTAGCTACAGG - Intronic
1182235594 22:28873744-28873766 GAACCAATGCTTGTAGTTAGGGG + Intergenic
951396984 3:22180892-22180914 GAACAAAAGCATATAGCTACTGG - Intronic
955014315 3:55053860-55053882 GACCAAATGCTTTTACCTTAAGG - Intronic
955118509 3:56031192-56031214 GACCAAAAGCTTGTATCCATGGG - Intronic
955278143 3:57567762-57567784 GAACAAGTGCTTGTACCTTCTGG - Intergenic
960002292 3:112745444-112745466 GAAAAAATGCTGGTATCTACTGG + Intronic
960220131 3:115097551-115097573 TACCAAATTGTTTTAGCTACAGG + Intronic
964441011 3:156710038-156710060 GAACTAATGCTTATAGATACTGG - Intergenic
964840012 3:160983610-160983632 TCCCAAATGCTTGTAGATATAGG - Intronic
966745488 3:183271500-183271522 TACCACATCCATGTAGCTACTGG + Exonic
967967274 3:194971936-194971958 GACCAAATGCTGGTATCGACTGG + Intergenic
972733641 4:41819112-41819134 GACCAAGTGTTTATAGGTACTGG - Intergenic
977455591 4:97255895-97255917 GACCAGATGGTTGTAGATAGTGG + Intronic
993651876 5:90531300-90531322 GACAAAATGCTTGTTCCTACTGG - Intronic
996566682 5:124886902-124886924 GATCAAATGCTTTTGGTTACTGG - Intergenic
1004349834 6:14881310-14881332 GACCAGATGCTGGGAGATACTGG - Intergenic
1012928790 6:105295233-105295255 GTCCATCTGCTTGTAGCTCCTGG + Intronic
1015221415 6:130808137-130808159 GCCCAAATTCTTGTATCTTCTGG - Intergenic
1017289091 6:152713953-152713975 GACCAAATGCTTGTAGCTACTGG - Intronic
1017585558 6:155918881-155918903 AACCAAATGCCTGTAGATATTGG + Intergenic
1019222058 6:170480628-170480650 AGCCAGATGCTTGTAGCTGCTGG - Intergenic
1019856942 7:3618761-3618783 AACCAAAAGCTTGTATGTACAGG + Intronic
1020837997 7:13178384-13178406 GGTCAAATATTTGTAGCTACTGG + Intergenic
1035425737 7:158771552-158771574 GACTAAATGCTTGTAGCTGCAGG + Intronic
1037436465 8:18869078-18869100 GACCAAATGCTTGTTCTTAATGG + Intronic
1041821381 8:62037830-62037852 TTCCAAATACTTGGAGCTACAGG - Intergenic
1048060308 8:130912714-130912736 GAAGAAATGCTTGTAACTAATGG + Intronic
1048097200 8:131309842-131309864 GACCACATGCCTTTAGCTGCAGG - Intergenic
1050840231 9:10139734-10139756 GATCAGATGGTTGTAGGTACAGG - Intronic
1058577979 9:106423776-106423798 GTCCAAATGGCTGTAGCTGCAGG - Intergenic
1060044413 9:120328366-120328388 TCCAGAATGCTTGTAGCTACAGG - Intergenic
1186836980 X:13447963-13447985 GACTAAATGCTTTTAAATACTGG - Intergenic
1189892019 X:45612760-45612782 GACCATGTGCTTGTAAGTACTGG - Intergenic
1198894970 X:141443518-141443540 AACCAAATACTTGCAGGTACTGG + Intergenic