ID: 1017291000

View in Genome Browser
Species Human (GRCh38)
Location 6:152736489-152736511
Sequence GACCAGGTTCAAGACCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017290995_1017291000 24 Left 1017290995 6:152736442-152736464 CCGTGGTCCTGTGAGGGGACTAT No data
Right 1017291000 6:152736489-152736511 GACCAGGTTCAAGACCCCAAAGG No data
1017290996_1017291000 17 Left 1017290996 6:152736449-152736471 CCTGTGAGGGGACTATTAGAGTA No data
Right 1017291000 6:152736489-152736511 GACCAGGTTCAAGACCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017291000 Original CRISPR GACCAGGTTCAAGACCCCAA AGG Intergenic
No off target data available for this crispr