ID: 1017292220

View in Genome Browser
Species Human (GRCh38)
Location 6:152752128-152752150
Sequence ATCTTTGGCTGGAAGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017292218_1017292220 -10 Left 1017292218 6:152752115-152752137 CCTTGCTGGTGACATCTTTGGCT 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1017292220 6:152752128-152752150 ATCTTTGGCTGGAAGAACTGAGG 0: 1
1: 0
2: 3
3: 24
4: 295
1017292215_1017292220 23 Left 1017292215 6:152752082-152752104 CCATTGAAAATTACTGCTAGACA 0: 1
1: 0
2: 2
3: 20
4: 290
Right 1017292220 6:152752128-152752150 ATCTTTGGCTGGAAGAACTGAGG 0: 1
1: 0
2: 3
3: 24
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017292220 Original CRISPR ATCTTTGGCTGGAAGAACTG AGG Intronic
902596802 1:17515193-17515215 ATTTTTGGCTGACAGAAGTGTGG + Intergenic
902764196 1:18604028-18604050 ATCTTTGGGTGAGAAAACTGAGG + Intergenic
903032208 1:20472029-20472051 ACCTGAGGCTGGAAGAAATGAGG - Intergenic
903502790 1:23810840-23810862 CTTTTTGGCTAGCAGAACTGAGG + Intronic
904774070 1:32895998-32896020 CTCCTTGGCTGGAGGAACAGGGG + Intronic
905950680 1:41948013-41948035 TTCATTGTCTGGAAGAAATGTGG - Intronic
906583709 1:46957389-46957411 TTCATTGTCTGGAAGAAATGTGG - Intergenic
907617861 1:55942999-55943021 ATCCTTGGCTGTAACCACTGAGG + Intergenic
908895188 1:68890711-68890733 ATCTTGTGCTGTCAGAACTGTGG + Intergenic
910804784 1:91179626-91179648 TTCATTGTCTGGAAGAAATGTGG - Intergenic
910934760 1:92478725-92478747 AGCTTTGACTGTAAGATCTGTGG - Exonic
912449476 1:109760407-109760429 ATGTTTGGCTGGGAGAAGGGAGG - Intronic
912463635 1:109854141-109854163 TTCATTGTCTGGAAGAAGTGTGG + Intergenic
912640620 1:111342198-111342220 ATCTGTTGCTGGATGAATTGGGG - Intergenic
912666142 1:111581374-111581396 ATTTTTGGCTGTCACAACTGGGG + Intronic
915255367 1:154624419-154624441 CTCCTTGGGTGGAGGAACTGAGG + Intronic
916886751 1:169076531-169076553 ATCTCTGGGTGGTAGAATTGGGG + Intergenic
917003974 1:170391189-170391211 ATCTTTAGCTAGATGAACTAAGG - Intergenic
917077332 1:171218880-171218902 ATTTTTGGCTGGAGGGACTCAGG - Intergenic
920666940 1:207969838-207969860 ATCTTTTACTGGAAGAAGTAGGG + Intergenic
921347085 1:214197341-214197363 ATATTTGGCTGGAAAAACCAGGG - Intergenic
922684393 1:227627951-227627973 TTCATTGTCTGGAAGAAATGTGG + Intronic
923501871 1:234571740-234571762 ATCTTTGCATGGAAGAAATGAGG - Intergenic
923970261 1:239194015-239194037 ATTTTTGTCTGGAAGCACTGGGG - Intergenic
924612596 1:245586537-245586559 AAATTTGGCTGGAAGAATAGAGG - Intronic
1063044947 10:2382338-2382360 ATTTTTGGCTGGAACAACTGTGG - Intergenic
1064277607 10:13921059-13921081 ATCTTGGGCTTCCAGAACTGTGG - Intronic
1065056804 10:21853064-21853086 ATTTTTAGCTGGAAGGAATGGGG - Intronic
1065199217 10:23297721-23297743 TTCTTTGTCTGGAAGAAATGTGG + Intronic
1065669672 10:28102728-28102750 ATATTTTGATGGTAGAACTGAGG - Intronic
1066405839 10:35117209-35117231 ATGTTTAGCTAGAAGAATTGCGG + Intergenic
1067263687 10:44716946-44716968 ATCCTTGCCTAGCAGAACTGGGG + Intergenic
1068506088 10:57900711-57900733 TTCTTTGGCTGGGATAACTCTGG + Intergenic
1069955663 10:72049771-72049793 ACTTTTGGCTGCCAGAACTGTGG + Intergenic
1072019337 10:91382752-91382774 ATTTTTGGTTGTCAGAACTGGGG + Intergenic
1072035107 10:91556021-91556043 ATTTTTGGCTGTCACAACTGGGG - Intergenic
1074761219 10:116668846-116668868 ATATTTGGCTGTCAGAAGTGGGG + Intronic
1074780817 10:116800655-116800677 ATTCTTGGCTGGAAAAAATGGGG + Intergenic
1074919833 10:117996247-117996269 CTCTTTTGCTGGAATGACTGAGG + Intergenic
1075010070 10:118860158-118860180 ATCTTTGGCTGGGACAACTGGGG - Intergenic
1078942317 11:16021616-16021638 GACTTTGGCTGGAGGAAATGAGG + Intronic
1079307372 11:19335056-19335078 ATCTTTGAGTGGTAGAACTTGGG - Intergenic
1083744530 11:64727859-64727881 ATCTGTGGCTGAAAAAGCTGTGG - Intronic
1084477298 11:69396202-69396224 ATTTTTGGCTGTAACAACTCTGG + Intergenic
1084489363 11:69470074-69470096 ATCTATTGGTGGAATAACTGGGG + Intergenic
1084539606 11:69777537-69777559 GTCATTGGCAGGAAGATCTGGGG - Intergenic
1085601480 11:77859786-77859808 TTCATTGTCTGGAAGAAATGTGG + Intronic
1086622335 11:88902220-88902242 AACTTAGGGTGGAAGAACTTGGG + Intronic
1087112814 11:94489634-94489656 ATATTTGGGAGGAAGAACTAAGG + Intronic
1087127385 11:94641293-94641315 TGCTTTGGCAGGAAGAACTATGG + Intergenic
1088265290 11:107982621-107982643 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1088400238 11:109415779-109415801 ATCTTTGGTTGTCACAACTGGGG + Intergenic
1090469327 11:126965965-126965987 ATCTTTGGAAGGAACAAATGGGG + Intronic
1090505850 11:127312636-127312658 ATCTTTGGCTGGATGAGAAGAGG - Intergenic
1091910078 12:4223317-4223339 ATCTTTGGCTGGCAGAAGTCTGG + Intergenic
1092321407 12:7480216-7480238 TTCTTTGGATGGAAGAAGTGAGG + Intronic
1094552020 12:31461831-31461853 ATCTTTGGGAGGAAGAATTTAGG + Intronic
1094806751 12:34101461-34101483 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1095125599 12:38472926-38472948 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1097376963 12:58853794-58853816 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1097673528 12:62570684-62570706 ATTTTTTGCTGGAATAACTATGG + Intronic
1098957630 12:76703968-76703990 ATCTGTGGCTGGAATAATTTTGG - Intergenic
1099254041 12:80293718-80293740 ATGTTTTGCAGGAAGATCTGAGG - Intronic
1100818973 12:98413380-98413402 CTCGTAGGCTGGAAGATCTGGGG - Intergenic
1101985314 12:109441510-109441532 ATCCTTTGCTGGATAAACTGTGG - Intronic
1102404921 12:112664886-112664908 GTCTGTGGCTGGAAGAGCTGGGG + Intronic
1102732018 12:115119901-115119923 ATTTTTGGTTGTCAGAACTGTGG + Intergenic
1103327843 12:120133361-120133383 ATATTTGGCTGCGAGCACTGTGG - Intronic
1103803405 12:123554381-123554403 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1104163537 12:126204215-126204237 ATGTGTGGCCAGAAGAACTGAGG - Intergenic
1104525967 12:129522437-129522459 ATCTGTGGCTTGAAGTCCTGGGG - Intronic
1104851202 12:131875132-131875154 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1105507844 13:21025478-21025500 ATCATTTTCTGGAAGACCTGTGG + Intronic
1105586634 13:21751037-21751059 ATGCTTGCCTTGAAGAACTGTGG - Intergenic
1106342978 13:28848821-28848843 ATTTTTGGCTGTCATAACTGGGG + Intronic
1107457248 13:40566227-40566249 CTCTGTGGCTGGAAGAAGTGAGG + Intronic
1108876966 13:55059554-55059576 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1109682387 13:65769664-65769686 ATATTTGGGTGAAAGAACTGAGG - Intergenic
1110751127 13:79118028-79118050 TTCTCTGGCTGGGAGAACTAGGG - Intergenic
1112666755 13:101584126-101584148 ATCTTTGACTGTAAATACTGTGG + Intronic
1113029731 13:105979745-105979767 ATGCTGGGCTGGAAGTACTGGGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1115420350 14:33186867-33186889 ATTTTTGGCTGCTACAACTGGGG + Intronic
1116447160 14:45023275-45023297 TTCATTGTCTGGAAGAAATGTGG + Intronic
1116661210 14:47712439-47712461 ATTTTTGGCAAGATGAACTGTGG - Intergenic
1117570459 14:57043898-57043920 ATCTTTTGGTGGAAAAATTGGGG + Intergenic
1117854489 14:60013540-60013562 ATCATTGGCTAAAATAACTGGGG + Intronic
1118144828 14:63124097-63124119 ATTTTTGGCTTCCAGAACTGTGG - Intergenic
1118393093 14:65312912-65312934 ATGGTTGGCTGGAAGTACTTGGG - Intergenic
1118985746 14:70753228-70753250 ATCTATGGCTAGTAGACCTGTGG + Intronic
1119378272 14:74212387-74212409 ATCTTTGGCTTTAAGATCAGTGG - Intergenic
1119498412 14:75101114-75101136 ACCTTTGGCTGCAACAAGTGTGG - Exonic
1121744817 14:96279820-96279842 GTCTTTGGCTGTCACAACTGGGG + Intergenic
1121941126 14:98072139-98072161 ATCTTTGTCTAGAAGCACTCTGG - Intergenic
1122699637 14:103579274-103579296 ATCTGTGGTTGGTTGAACTGAGG - Intronic
1123063530 14:105605183-105605205 ATTTTTAGCTGAAAGCACTGAGG - Intergenic
1123087590 14:105723969-105723991 ATTTTTAGCTGAAAGCACTGAGG - Intergenic
1125086949 15:35741058-35741080 ATCTTGGGTAGGAAGAGCTGGGG - Intergenic
1125233083 15:37480750-37480772 ATATTTGGTTTGAAAAACTGCGG + Intergenic
1125576715 15:40760902-40760924 ATCTTGGTCTGTAAGAACAGAGG - Intergenic
1128061408 15:64738031-64738053 ATCTGTGGGTGGGAGAAGTGGGG + Intergenic
1128959324 15:71984872-71984894 ATCATTGGCTGGATCCACTGTGG + Intronic
1130374259 15:83314047-83314069 ATCTTTGGCTGGCAGAATCATGG + Intergenic
1130847894 15:87764511-87764533 ATCTTTGGCTGCTCAAACTGAGG - Intergenic
1131420475 15:92300683-92300705 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1131604989 15:93894052-93894074 ATCTTTGGCTCAAAGATCTTTGG - Intergenic
1133855462 16:9545402-9545424 GTATTTGGTTGGAAGAACTCTGG - Intergenic
1134308239 16:13052854-13052876 ATCTTTGGTTGGGGAAACTGAGG + Intronic
1142567156 17:847949-847971 ATGTTGGTCTGGAAGAAGTGGGG - Intronic
1143758718 17:9085565-9085587 ATCTGTAGATGCAAGAACTGAGG - Intronic
1144317973 17:14082037-14082059 ATGTTAGGCTGGAAGAACCAGGG + Intronic
1146558981 17:33851719-33851741 ATTTTTGGCTGTCACAACTGGGG - Intronic
1146586998 17:34091026-34091048 ACCCTTGGTGGGAAGAACTGAGG - Intronic
1149495033 17:57112123-57112145 ATCTTTGGCCAGGAGAAGTGTGG + Intronic
1150820619 17:68431413-68431435 CTCTGTGGCTGGAGGAAATGAGG + Intronic
1150962381 17:69928504-69928526 GTCATTGGCTGGCAGAAGTGGGG - Intergenic
1151324634 17:73371502-73371524 AACTTTGGCAGGAAGAGCTTCGG + Intronic
1151444505 17:74154373-74154395 ATCTTTGTATGGAAAGACTGTGG - Intergenic
1152975755 18:216553-216575 TTGGTTGGCTGGAAGAAGTGAGG + Exonic
1155317849 18:24590154-24590176 GTCCTTGGCTGGAAGCTCTGCGG - Intergenic
1155588255 18:27393830-27393852 GTCTTTGTCTAGAAGAACTGTGG - Intergenic
1155739181 18:29265455-29265477 ATCTTAGGCTAGAAAAACTCTGG - Intergenic
1156477818 18:37417316-37417338 ATCTGTGGCTGGAAGAAGGAAGG - Intronic
1159200778 18:65180952-65180974 ATCTTTGGCTGTCACCACTGAGG - Intergenic
1160298736 18:77659661-77659683 TTCTATGGCTGGAAGGAATGGGG + Intergenic
1161938034 19:7384112-7384134 GTCTGTGGCTGGCAGAACTCAGG + Intronic
1162733577 19:12733552-12733574 ATTTTTGGTTGTCAGAACTGCGG - Intronic
1162850349 19:13426392-13426414 ATTTTTGGCTGCCACAACTGGGG + Intronic
1164173848 19:22750564-22750586 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1164763149 19:30743318-30743340 ATATTTGGGTGGAAGCTCTGGGG + Intergenic
1165953921 19:39489859-39489881 GTCTTGGTCTGGAAGCACTGGGG - Exonic
1166459110 19:42970386-42970408 AGCTTTTGCTGGTAGGACTGTGG + Intronic
1166476056 19:43125655-43125677 AGCTTTTGCTGGTAGAACTGTGG + Intronic
1168487836 19:56779641-56779663 ATCTTTGGTTGTCATAACTGTGG + Intronic
924973842 2:155458-155480 TTCATTGTCTGGAAGAAATGTGG + Intergenic
925711196 2:6742539-6742561 ATATTTGTTTAGAAGAACTGAGG - Intergenic
925787955 2:7451543-7451565 ATCTTTGGCTGCTATAACTAGGG + Intergenic
928379186 2:30803192-30803214 ATGTTTGGCGAGAAGAACAGGGG + Intronic
932136673 2:69237195-69237217 GTCTTTGGATGCCAGAACTGAGG - Intronic
932515876 2:72348660-72348682 ATCATTGGCTGGGGAAACTGAGG - Intronic
932759200 2:74428521-74428543 AGATTTGGGTGGAAGAAATGGGG - Intronic
933174963 2:79164654-79164676 TTCATTGTCTGGAAGAAATGTGG + Intergenic
934909473 2:98237690-98237712 GTATTTGCCTGGAAGCACTGAGG - Intronic
935748980 2:106213831-106213853 TTCATTGTCTGGAAGAAATGTGG - Intergenic
936735954 2:115443940-115443962 ATCTTTGGCTGTCACTACTGGGG - Intronic
937858210 2:126687871-126687893 ATATTTGGCTTGAACAACTTGGG - Intronic
938402296 2:131003982-131004004 ATCTTTGGTTGGGAGAGATGGGG + Intronic
940030925 2:149260439-149260461 CTGGTTGGCTGGAAGAAATGAGG + Intergenic
941068113 2:160926090-160926112 TTCTTGGGCTGGAACAACTAAGG - Intergenic
941370663 2:164659416-164659438 TTCATTGTCTGGAAGAAATGTGG + Intronic
941679491 2:168381580-168381602 ATCTTTAGCTGGAATAATTAAGG + Intergenic
941991490 2:171561510-171561532 TTCATTGCCTGGAAGAAATGTGG + Intergenic
943244609 2:185430873-185430895 ATCTTTTGCTGGATCAAATGGGG - Intergenic
943387337 2:187218096-187218118 ATCCCTGGCTTGAAGAAATGTGG + Intergenic
944249685 2:197568750-197568772 CTTCTTGGCTGGAAGGACTGTGG - Exonic
944977446 2:205071316-205071338 ATCTTTGGCGAGAAGAATGGCGG - Intronic
945056497 2:205873892-205873914 ATCCTTTTGTGGAAGAACTGGGG - Intergenic
945872930 2:215246495-215246517 TTCTTTTGGTGGAGGAACTGTGG - Intergenic
946291298 2:218747450-218747472 CTCTTTGGCTGGGAGAACAAAGG - Intronic
948580232 2:238982161-238982183 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1170586945 20:17741832-17741854 ATATTTGGCCGGAAGTAGTGCGG - Intergenic
1170720635 20:18874977-18874999 ATCTTTGGCTGTAAGCATTTGGG + Intergenic
1170779323 20:19409918-19409940 GTCTTTGGGTGGTAGAATTGTGG + Intronic
1172391375 20:34567633-34567655 ACCTTTGGCTTTAAGAGCTGAGG - Intronic
1172869732 20:38128728-38128750 CCCTTGGGCTGGAAGAATTGGGG - Exonic
1173159397 20:40641131-40641153 ATTTATGGCTGGATGAATTGAGG + Intergenic
1173339955 20:42144183-42144205 ATCATTAGTTTGAAGAACTGAGG + Intronic
1173426367 20:42946918-42946940 ATTTTTGGCTGTCAGAACTGTGG - Intronic
1173706627 20:45114998-45115020 GTCTTTGGCAGGAAGAAGGGAGG - Exonic
1174977408 20:55350710-55350732 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1175159879 20:57000336-57000358 ATCTTTGGTTGTTAGGACTGGGG - Intergenic
1177801953 21:25836525-25836547 ATCTGAGGCTGGAAGAGTTGTGG + Intergenic
1178741313 21:35204734-35204756 ATGTTTTCCTGCAAGAACTGGGG + Intronic
1180141838 21:45897888-45897910 ACCTGAGGCAGGAAGAACTGGGG - Intronic
1180621392 22:17164896-17164918 AGCTGTGGCTGGAAGAACAGGGG + Intronic
1181880547 22:25976085-25976107 ATTTTTGGCTGGCACAACTTGGG + Intronic
1182013572 22:27020625-27020647 ATCCTTGGGGGGAAGAACTTTGG + Intergenic
1184342403 22:43893241-43893263 ATCTGTGCCTGGAAGAAGTGTGG + Intergenic
950103811 3:10375711-10375733 ATCTTTGGCTGAAAGAGCTCCGG + Intronic
950134397 3:10570612-10570634 AACTTTGGCTGGAGAAAGTGAGG - Intronic
952921925 3:38291349-38291371 TTCATTGTCTGGAAGAACTGTGG + Intronic
953523910 3:43670728-43670750 ATCTATGGCTGGTAGCACAGTGG + Intronic
954086432 3:48247619-48247641 ATCCTTGGCAGGCAGAGCTGGGG - Exonic
955147838 3:56337726-56337748 ATCTTGGAGTGGAAGTACTGGGG - Intronic
955380930 3:58437383-58437405 TTCTCTGGCTGGCAGAAGTGGGG + Intergenic
955812410 3:62805134-62805156 ATTTTTGGTTGTAACAACTGGGG - Intronic
955939550 3:64134587-64134609 ATTTTTGGTTGTAATAACTGGGG - Intronic
956903394 3:73740482-73740504 ATCTTGGGCTGGTAGAAATCTGG - Intergenic
956999985 3:74874327-74874349 TTCATTGTCTGGAAGAAATGTGG + Intergenic
958132245 3:89442486-89442508 ATTTTTGGCTGTCACAACTGGGG + Intronic
958649505 3:96920213-96920235 ATCTTTGGCTGTAGGAAGAGAGG - Intronic
959513452 3:107240217-107240239 ATCGTTGGCTGTCACAACTGGGG + Intergenic
959904518 3:111695782-111695804 ATCCTGGGCTGGAAGGCCTGTGG + Intronic
960297263 3:115959456-115959478 AACTTTGGTTGGAAAAATTGAGG + Intronic
961695022 3:128698496-128698518 ATGTTTGGCGGGGAGAAATGCGG + Intergenic
961991677 3:131198366-131198388 TTCATTGTCTGGAAGAAATGTGG + Intronic
962495748 3:135937390-135937412 TTCATTGTCTGGAAGAAATGAGG - Intergenic
962653278 3:137517466-137517488 ATCCTTGGCTGGAATAGCAGGGG + Intergenic
962829656 3:139128877-139128899 ATCTCTGCCTGGGAGAGCTGGGG + Intronic
962925022 3:139984932-139984954 ATTTTTGGCTGGAGCAGCTGTGG - Intronic
963188259 3:142441768-142441790 TTCATTGTCTGGAAGAAATGTGG - Intronic
963809185 3:149757962-149757984 TTCATTGTCTGGAAGAAATGTGG + Intergenic
963916062 3:150859825-150859847 TTCATTGTCTGGAAGAAATGTGG - Intergenic
964667926 3:159194061-159194083 GTCTTTTGGGGGAAGAACTGAGG + Intronic
965054505 3:163696411-163696433 TTCATTGTCTGGAAGAAATGTGG + Intergenic
965184103 3:165440746-165440768 ATTTTTTTCTGGAATAACTGTGG + Intergenic
966138231 3:176725584-176725606 ATCTTTGGCTGGTATTATTGGGG + Intergenic
966353802 3:179058315-179058337 TTCATTGTCTGGAAGAAATGTGG - Intronic
967420640 3:189268434-189268456 ATATTTATCTGGAAGAAATGGGG - Intronic
967576148 3:191096184-191096206 ACCTTTGGAAGGAAGGACTGGGG - Intergenic
967822396 3:193850147-193850169 CGCAATGGCTGGAAGAACTGAGG + Intergenic
969645261 4:8424712-8424734 TTCATTGTCTGGAAGAAATGTGG - Intronic
969940692 4:10728069-10728091 ATATTTGGTTGTCAGAACTGGGG + Intergenic
971171810 4:24241417-24241439 ATATTTGCTTGGAACAACTGGGG - Intergenic
971246296 4:24931516-24931538 ATCTTTAGCTGCAACACCTGGGG + Intronic
972179207 4:36443186-36443208 TTCATTGTCTGGAAGAAATGTGG + Intergenic
972702257 4:41505484-41505506 AACTTTGGCTGGCAGAGCTTGGG + Intronic
973946205 4:55958794-55958816 ACCTGGGGCTGGAAGCACTGTGG + Intronic
975281823 4:72569678-72569700 TTCTCTGGCTGGGAGAACAGTGG - Intergenic
976298068 4:83491858-83491880 ATCTTTGGATGGAAGGATTATGG - Intronic
976383539 4:84428398-84428420 ATCTTTGGTTGACTGAACTGAGG + Intergenic
976495310 4:85722506-85722528 ATGTTTTGCTGGTAGAGCTGAGG + Intronic
977330213 4:95628334-95628356 TTTTTTGGCTGGAAGACCAGGGG + Intergenic
978586500 4:110280695-110280717 TTCATTGTCTGGAAGAAATGTGG + Intergenic
980816853 4:137958917-137958939 TTGTTTGGCTTGAAGAACAGAGG - Intergenic
980872503 4:138625990-138626012 TTCATTGACTGGAAGAAATGTGG + Intergenic
981529217 4:145735636-145735658 AACTTTGGCTGGCATAAATGAGG + Intronic
983193950 4:164784054-164784076 ATCATTGGCTGGAAGAATGGTGG + Intergenic
984724037 4:183002887-183002909 TTCATTGTCTGGAAGAAATGTGG - Intergenic
986437632 5:7749781-7749803 ATCTCTGCCTGGAAGAACGTTGG - Intronic
987378458 5:17260075-17260097 ATGTTAGGCTGCAATAACTGGGG + Intronic
988212399 5:28222154-28222176 ATCTTTTACTAGAAGAGCTGGGG + Intergenic
988957010 5:36330190-36330212 TTCATTGTCTGGAAGAAATGTGG + Intergenic
989160352 5:38384893-38384915 ATTTTTGGCTGTCACAACTGGGG + Intronic
989509440 5:42267328-42267350 ATGTTTGCCAGGAAAAACTGAGG - Intergenic
990373598 5:55146541-55146563 ATCTTTGTCTTGTAGAACTAAGG - Intronic
990619353 5:57543060-57543082 TCCTGTGGCTGGGAGAACTGAGG - Intergenic
990892582 5:60664512-60664534 TTCATTGTCTGGAAGAAATGTGG - Intronic
991551491 5:67841736-67841758 ATCTTTTGCTAGCAGAGCTGTGG + Intergenic
993330646 5:86595960-86595982 ATCATTGCCTAGAAGAACTATGG - Intergenic
995008882 5:107235393-107235415 ATTACTGGCTGGAAGAAATGTGG - Intergenic
995974004 5:118008714-118008736 ATTTTTAGATGGAAGAAATGAGG - Intergenic
996591164 5:125149274-125149296 TTCTTTGGCTGAAAAATCTGAGG - Intergenic
996965173 5:129299560-129299582 AAGTTTGGCTGGATGATCTGAGG - Intergenic
997067209 5:130575546-130575568 ATTTTTGGATGGAAAACCTGAGG - Intergenic
997178555 5:131804084-131804106 ATCATTAGCTGGAAGAAGTTGGG + Intergenic
999417772 5:151414877-151414899 ATCTGTGGCTGTGAGAAGTGAGG - Intergenic
1005012813 6:21351846-21351868 ATCTTTGGCTGGTAGAACTAAGG - Intergenic
1005323366 6:24677243-24677265 TTCATTGTCTGGAAGAAATGTGG + Intronic
1006236167 6:32634948-32634970 GTCTTTGGCTGGAGGCATTGAGG - Intronic
1006799369 6:36750244-36750266 ATCTTGGGCTGATAGAGCTGTGG - Intronic
1006830112 6:36963454-36963476 GTCCTGGGCTGGAAAAACTGAGG - Exonic
1006939113 6:37739899-37739921 TTCATTGGCTTGAAGAACTGAGG - Intergenic
1008391209 6:50954116-50954138 AAATTTGGTTGGAAGATCTGAGG + Intergenic
1009276801 6:61692818-61692840 CACATTGGCAGGAAGAACTGTGG - Intronic
1009545088 6:65010449-65010471 TTCATTGTCTGGAAGAAATGTGG - Intronic
1010740642 6:79499632-79499654 ATCTTCGGCTGGCAGGACTATGG + Intronic
1011077079 6:83448886-83448908 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1011539558 6:88415679-88415701 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1013198302 6:107865511-107865533 ACCTTTGGTTGAAATAACTGAGG - Intergenic
1013598872 6:111685515-111685537 TCCTTTGGCTGTAAGAAATGAGG + Intronic
1014755132 6:125294129-125294151 CTCTGTGGTTAGAAGAACTGAGG - Intronic
1015865187 6:137720437-137720459 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1016342949 6:143082420-143082442 TTCATTGTCTGGAAGAAATGTGG + Intronic
1016444412 6:144117821-144117843 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1016497042 6:144675311-144675333 ATCCATGGCTGGGAGACCTGAGG - Intronic
1017292220 6:152752128-152752150 ATCTTTGGCTGGAAGAACTGAGG + Intronic
1018761345 6:166896738-166896760 TTCATTGTCTGGAAGAAATGTGG - Intronic
1019398615 7:837210-837232 TTCCGTGGCTGGAAGAGCTGGGG + Intronic
1021537243 7:21719827-21719849 ATCGTTGCCTGCAAAAACTGGGG + Intronic
1023995459 7:45156770-45156792 ACCTGTGGCTGGAGAAACTGAGG + Intergenic
1024374235 7:48619452-48619474 ATCTTTTGCTCGTAAAACTGAGG + Intronic
1027404542 7:77846192-77846214 TTCTTTGGCTGTAAGACCTGTGG - Intronic
1028324872 7:89510318-89510340 ATCTTAGACTAGATGAACTGTGG - Intergenic
1028588278 7:92472154-92472176 TTCATTGTCTGGAAGAAATGTGG + Intronic
1028846794 7:95490551-95490573 ACCTTTGGCTGTAATAACAGAGG + Intronic
1030337602 7:108342959-108342981 TTCATTGCCTGGAAGAAATGTGG - Intronic
1030344757 7:108420471-108420493 ATTTGTGGCTAGAAGAAATGTGG - Intronic
1030493799 7:110272024-110272046 ATAATTGGCTGGGAGTACTGGGG - Intergenic
1030695237 7:112577912-112577934 ATCTGTAGCTGGAAAAACTATGG + Intergenic
1030843203 7:114380585-114380607 TTCATTGTCTGGAAGAAATGTGG + Intronic
1031264859 7:119569322-119569344 TTCATTGCCTGGAAGAAATGTGG - Intergenic
1032708789 7:134444734-134444756 ATGTGTGGCTGGAGGAACTGAGG + Intronic
1037408161 8:18565850-18565872 ATTTTTGGTTGTTAGAACTGGGG + Intronic
1038235973 8:25755552-25755574 TTCTTTGGGTGGTTGAACTGAGG + Intergenic
1038362259 8:26892541-26892563 ATCTTTGGCTCAGACAACTGTGG + Intergenic
1039300997 8:36208606-36208628 ATCTGTGGCTTACAGAACTGTGG - Intergenic
1040527451 8:48237435-48237457 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1041707256 8:60859707-60859729 CTCTTGGGTTTGAAGAACTGAGG + Intronic
1043062506 8:75522658-75522680 ATTTTTGGCTGTGATAACTGAGG - Intronic
1043442746 8:80290706-80290728 ACCTTGGGCAGGAAGAACTGAGG + Intergenic
1045532099 8:102994777-102994799 ATCTTTCACTGGAAGGACTTGGG - Intergenic
1046019530 8:108648014-108648036 CTCTTTGATTGGAATAACTGAGG - Intronic
1047934674 8:129765274-129765296 TTTTATGGCTGGAAGAAATGAGG - Intronic
1049953567 9:670469-670491 ATCCTTTGCTAGAAGAACAGAGG - Intronic
1051024476 9:12590450-12590472 ATTTTTGGCTGTCACAACTGGGG + Intergenic
1053134564 9:35642240-35642262 TTCATTGTCTGGAAGAAATGTGG + Intronic
1054839032 9:69715570-69715592 AACTTTCACTGGAAGAACAGTGG - Intronic
1055706686 9:79013121-79013143 ATATTTGGCTAGCACAACTGAGG + Intergenic
1057281969 9:93719847-93719869 ATCTTTGGCAGTCAGAGCTGAGG + Intergenic
1058907914 9:109496761-109496783 ATTTTTGATTGGAACAACTGGGG + Intronic
1059798181 9:117722555-117722577 ATCTTTGGCTGAATTAGCTGTGG + Intergenic
1060556150 9:124508042-124508064 GTCGATGGCTGGAAAAACTGAGG + Intergenic
1060891538 9:127192352-127192374 AGCCTTGGCTGGAGGCACTGTGG - Intronic
1061655452 9:132086610-132086632 CTCTCTAGCTGCAAGAACTGAGG - Intergenic
1185514418 X:688432-688454 TTCTGTTGCTGGAAGAACTGTGG + Intergenic
1189113787 X:38322906-38322928 ATGTTTGGCAGTAACAACTGGGG - Exonic
1191248010 X:58243274-58243296 CTCTTTGGCTGGAATGACTGGGG - Intergenic
1191248022 X:58243344-58243366 CTCTTTGGCTAGAATGACTGTGG - Intergenic
1191924906 X:66298572-66298594 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1193306990 X:79961580-79961602 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1195036428 X:100974143-100974165 ATCATTGGCTTGAACAACTCTGG + Exonic
1195535254 X:106002611-106002633 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1195871780 X:109493927-109493949 CCCTTAGGCTGGAAGGACTGAGG + Intergenic
1196527047 X:116739455-116739477 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1196751625 X:119122876-119122898 AACTTTGTCTGGAAGAACAGAGG - Intronic
1196908973 X:120467394-120467416 ATTTTTGGTTGTAACAACTGGGG - Intronic
1196972560 X:121125564-121125586 TTATTTGGCTGAAAGAATTGAGG - Intergenic
1197687952 X:129463509-129463531 ATCTGTAGCTTGAAGGACTGAGG - Intronic
1197954510 X:131931522-131931544 TTCATTGTCTGGAAGAAATGTGG + Intergenic
1198765838 X:140078529-140078551 TTCATTGTCTGGAAGAAATGTGG - Intergenic
1199048500 X:143206592-143206614 CTCTTTGGTTGAAAGGACTGAGG + Intergenic
1201298302 Y:12484700-12484722 CTCTTTGGCTGGGAAAACTGAGG - Intergenic