ID: 1017293649

View in Genome Browser
Species Human (GRCh38)
Location 6:152769945-152769967
Sequence TCCTGCTTCTCAGCCGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017293649_1017293652 -9 Left 1017293649 6:152769945-152769967 CCCAGACCGGCTGAGAAGCAGGA No data
Right 1017293652 6:152769959-152769981 GAAGCAGGATTCACTTTTCCAGG No data
1017293649_1017293653 6 Left 1017293649 6:152769945-152769967 CCCAGACCGGCTGAGAAGCAGGA No data
Right 1017293653 6:152769974-152769996 TTTCCAGGAATCAAACACTCAGG No data
1017293649_1017293656 25 Left 1017293649 6:152769945-152769967 CCCAGACCGGCTGAGAAGCAGGA No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data
1017293649_1017293654 7 Left 1017293649 6:152769945-152769967 CCCAGACCGGCTGAGAAGCAGGA No data
Right 1017293654 6:152769975-152769997 TTCCAGGAATCAAACACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017293649 Original CRISPR TCCTGCTTCTCAGCCGGTCT GGG (reversed) Intergenic
No off target data available for this crispr