ID: 1017293651

View in Genome Browser
Species Human (GRCh38)
Location 6:152769951-152769973
Sequence AGTGAATCCTGCTTCTCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017293651_1017293656 19 Left 1017293651 6:152769951-152769973 CCGGCTGAGAAGCAGGATTCACT No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data
1017293651_1017293653 0 Left 1017293651 6:152769951-152769973 CCGGCTGAGAAGCAGGATTCACT No data
Right 1017293653 6:152769974-152769996 TTTCCAGGAATCAAACACTCAGG No data
1017293651_1017293654 1 Left 1017293651 6:152769951-152769973 CCGGCTGAGAAGCAGGATTCACT No data
Right 1017293654 6:152769975-152769997 TTCCAGGAATCAAACACTCAGGG No data
1017293651_1017293657 30 Left 1017293651 6:152769951-152769973 CCGGCTGAGAAGCAGGATTCACT No data
Right 1017293657 6:152770004-152770026 AGCAGTAGCTGGTTTGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017293651 Original CRISPR AGTGAATCCTGCTTCTCAGC CGG (reversed) Intergenic
No off target data available for this crispr