ID: 1017293655

View in Genome Browser
Species Human (GRCh38)
Location 6:152769977-152769999
Sequence TACCCTGAGTGTTTGATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017293655_1017293659 19 Left 1017293655 6:152769977-152769999 CCAGGAATCAAACACTCAGGGTA No data
Right 1017293659 6:152770019-152770041 GCATCAGGACTCTGTCCCGAGGG No data
1017293655_1017293657 4 Left 1017293655 6:152769977-152769999 CCAGGAATCAAACACTCAGGGTA No data
Right 1017293657 6:152770004-152770026 AGCAGTAGCTGGTTTGCATCAGG No data
1017293655_1017293658 18 Left 1017293655 6:152769977-152769999 CCAGGAATCAAACACTCAGGGTA No data
Right 1017293658 6:152770018-152770040 TGCATCAGGACTCTGTCCCGAGG No data
1017293655_1017293656 -7 Left 1017293655 6:152769977-152769999 CCAGGAATCAAACACTCAGGGTA No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017293655 Original CRISPR TACCCTGAGTGTTTGATTCC TGG (reversed) Intergenic
No off target data available for this crispr