ID: 1017293656

View in Genome Browser
Species Human (GRCh38)
Location 6:152769993-152770015
Sequence CAGGGTATTAAAGCAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017293650_1017293656 24 Left 1017293650 6:152769946-152769968 CCAGACCGGCTGAGAAGCAGGAT No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data
1017293655_1017293656 -7 Left 1017293655 6:152769977-152769999 CCAGGAATCAAACACTCAGGGTA No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data
1017293651_1017293656 19 Left 1017293651 6:152769951-152769973 CCGGCTGAGAAGCAGGATTCACT No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data
1017293649_1017293656 25 Left 1017293649 6:152769945-152769967 CCCAGACCGGCTGAGAAGCAGGA No data
Right 1017293656 6:152769993-152770015 CAGGGTATTAAAGCAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017293656 Original CRISPR CAGGGTATTAAAGCAGTAGC TGG Intergenic
No off target data available for this crispr