ID: 1017294364

View in Genome Browser
Species Human (GRCh38)
Location 6:152776872-152776894
Sequence CTGCCCACCAGCACCCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017294364_1017294371 21 Left 1017294364 6:152776872-152776894 CCCACTGGGGTGCTGGTGGGCAG No data
Right 1017294371 6:152776916-152776938 TATGACATTTATGAAGAATTTGG No data
1017294364_1017294372 24 Left 1017294364 6:152776872-152776894 CCCACTGGGGTGCTGGTGGGCAG No data
Right 1017294372 6:152776919-152776941 GACATTTATGAAGAATTTGGAGG No data
1017294364_1017294374 28 Left 1017294364 6:152776872-152776894 CCCACTGGGGTGCTGGTGGGCAG No data
Right 1017294374 6:152776923-152776945 TTTATGAAGAATTTGGAGGGAGG No data
1017294364_1017294373 25 Left 1017294364 6:152776872-152776894 CCCACTGGGGTGCTGGTGGGCAG No data
Right 1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017294364 Original CRISPR CTGCCCACCAGCACCCCAGT GGG (reversed) Intergenic